ID: 1161842945

View in Genome Browser
Species Human (GRCh38)
Location 19:6693700-6693722
Sequence GAGGAGAAGGATATTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 587}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161842945 Original CRISPR GAGGAGAAGGATATTGAGGG TGG Intronic
900120190 1:1045576-1045598 GAGGAGAAGCACAGTGATGGGGG - Intronic
900721083 1:4176183-4176205 CAGGAGAAGAATAGAGAGGGAGG - Intergenic
901150028 1:7095197-7095219 GAGGAGAGGGATTTTTAGTGGGG + Intronic
901670462 1:10853024-10853046 GTGGAGGAGGCTAGTGAGGGTGG - Intergenic
901755981 1:11441860-11441882 GAGGAGGAGGAAGATGAGGGAGG + Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
902139710 1:14342679-14342701 GAGGAGAAAGAGGTTGGGGGAGG + Intergenic
902748768 1:18491910-18491932 AAGGAGATGGATAATGACGGTGG - Intergenic
902777286 1:18682907-18682929 GTGGAGAAGGGGATTGAGTGAGG - Intronic
903394058 1:22985865-22985887 GAGGAGAATCATGTAGAGGGAGG + Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904322839 1:29707995-29708017 GGGGAGAAGGTTACTGTGGGTGG - Intergenic
904819738 1:33234241-33234263 GAGGAAATGGAGATAGAGGGAGG - Intergenic
905028729 1:34867633-34867655 AAGCAGAAGGAAATTCAGGGAGG + Intronic
905326587 1:37156788-37156810 GAGGATAAGGCTATCAAGGGTGG - Intergenic
905805929 1:40877687-40877709 GAGGAAAAGAATATTGGTGGAGG + Intergenic
905942321 1:41873957-41873979 GAGGAGAAGGGAAGCGAGGGTGG - Intronic
906135158 1:43494237-43494259 GAGCAGCAGGAAATTGAGGAGGG - Intergenic
906745774 1:48221328-48221350 GAGGAGAGGGATATTGATCTGGG - Intergenic
907118289 1:51988967-51988989 GAGAAGAAGCATTTTGGGGGAGG - Intronic
908427159 1:64018279-64018301 GAGAAGCAGGAAACTGAGGGAGG - Intronic
909043295 1:70679250-70679272 GAGGAAAAAATTATTGAGGGAGG + Intergenic
909665940 1:78133537-78133559 GGAGAGAAGGATTTTGATGGTGG + Intronic
909946416 1:81668943-81668965 TAGGAGCAAGATATTGAGGAAGG - Intronic
910174495 1:84414494-84414516 GAGGAGAAAGATAGTGAGGTTGG - Intronic
910547982 1:88440797-88440819 GAGGAGAAGGAGAAAGAAGGAGG + Intergenic
910845174 1:91598374-91598396 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911549869 1:99265148-99265170 TAGGAGAAGGATTTGGGGGGGGG - Intronic
912537756 1:110388358-110388380 GAGGACAAGGATTTTGAAGGGGG - Intronic
912978801 1:114352526-114352548 GAGGAGAGGCATATTGACCGGGG - Intergenic
913586109 1:120277426-120277448 GAAGAGAAGGAAATAGAGGGTGG - Intergenic
913622077 1:120620943-120620965 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
914568118 1:148889284-148889306 GAAGAGAAGGAAATAGAGGGTGG - Intronic
914604706 1:149240965-149240987 GAAGAGAAGGAAATAGAGGGTGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915704290 1:157829034-157829056 GAGGAGAAGGTTTTTGGGAGAGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916485321 1:165253696-165253718 GAGGAGAAGCATATCGAGATAGG - Intronic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
917329561 1:173868084-173868106 GATGAGAGGAAGATTGAGGGAGG - Intronic
917460107 1:175222205-175222227 GAGGAGAAGGAAGGAGAGGGAGG + Intergenic
917590135 1:176468229-176468251 CATGAAAAGGATTTTGAGGGAGG - Intronic
917752988 1:178071236-178071258 GAGGAAAAGGATTTAGAGGAAGG + Intergenic
918374487 1:183895439-183895461 AGGGAGAAGGAGATTGATGGAGG + Intronic
919209497 1:194461562-194461584 GAGGAGGAGGAGATTGAGGCGGG + Intergenic
921276789 1:213528621-213528643 GAGGAGAAGGACACAGAGAGTGG - Intergenic
921402627 1:214743045-214743067 GAGGAGAAGGAGAGAGATGGGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923033996 1:230271512-230271534 GAGTAGAAGCATCTTGTGGGAGG - Intronic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923872972 1:238016295-238016317 GAGGCCAAGGATATTAAAGGTGG - Intergenic
924802150 1:247335385-247335407 TAGGAGGAGGAAAGTGAGGGAGG + Intergenic
1062882101 10:987721-987743 GAGGAGAAGGTTGATGAGGATGG - Intergenic
1064416728 10:15156294-15156316 GAGAAGAATGAGAGTGAGGGGGG - Intronic
1064723104 10:18249907-18249929 GAGAAGAAAAATATTTAGGGAGG - Intronic
1064839393 10:19573518-19573540 GAAGAGAAAGAAAATGAGGGAGG - Intronic
1064963763 10:20994868-20994890 GAGGAGGAGGAGGTAGAGGGGGG + Intronic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1068345420 10:55771722-55771744 GAGGATACTGATAATGAGGGAGG - Intergenic
1069723589 10:70564126-70564148 GAGGAGAGGGATGCTCAGGGAGG + Intronic
1070164243 10:73886002-73886024 GAGGAGAAGGAGATATAAGGAGG - Intergenic
1070511638 10:77166591-77166613 GAGGGGAAGGACATGGAGGAGGG + Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071117201 10:82235255-82235277 GAGTTGATGGATATTGATGGTGG + Intronic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1072077089 10:91987652-91987674 CAGGAGAGGGATGTTCAGGGTGG - Intronic
1072133813 10:92523746-92523768 GAAGACAAGAATATAGAGGGTGG - Intronic
1072904748 10:99442431-99442453 AAGGAGAAGGAAATACAGGGTGG - Intergenic
1073380899 10:103077331-103077353 GCGGAGGAGGACAGTGAGGGAGG + Exonic
1073581216 10:104667268-104667290 GAGGAGAAGGGTATTGGTTGTGG - Intronic
1073622060 10:105060130-105060152 GAGGAGTTGGAATTTGAGGGGGG + Intronic
1073718289 10:106135032-106135054 TAGGATAAGGAGATTGAAGGAGG + Intergenic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1075077371 10:119360149-119360171 GGGGTGAAGGAAGTTGAGGGAGG + Intronic
1075978955 10:126720864-126720886 GAGGAGAAGACTATGGAGGTTGG + Intergenic
1076077354 10:127545062-127545084 GAGGAGAGGGAAAAGGAGGGAGG - Intergenic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1077017806 11:404653-404675 GAGGAGAAGGCTAATGACGGAGG + Exonic
1078134170 11:8638565-8638587 GAGGAGGAGGATAGGGTGGGGGG - Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1080091346 11:28352755-28352777 GAGGTGAAGCTCATTGAGGGAGG + Intergenic
1080434692 11:32228866-32228888 GAGGAGAGGGGAATTGAGAGTGG + Intergenic
1081293711 11:41359404-41359426 GGGGATGTGGATATTGAGGGAGG + Intronic
1081696796 11:45117455-45117477 GAGGAGAAGCAGGTTGAGTGTGG + Intronic
1081842112 11:46210020-46210042 GGGGATAAGGAGATTCAGGGAGG + Intergenic
1084706862 11:70820685-70820707 GGGGAGAAGGACATGGAGAGAGG + Intronic
1084892863 11:72244922-72244944 GACGAGAAAGAGAGTGAGGGAGG + Intronic
1085157502 11:74309873-74309895 GAAGAGAAGCATTTTGTGGGTGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086500271 11:87445700-87445722 AAGGAGAAGGGACTTGAGGGGGG + Intergenic
1088076731 11:105858654-105858676 GCTGGGAAGGATAGTGAGGGAGG - Intronic
1088190823 11:107226400-107226422 GGGGAGAAGAATACTGAGGGGGG - Intergenic
1088578640 11:111296883-111296905 GAGGGGAAGGACAATGGGGGTGG - Intergenic
1089140523 11:116280456-116280478 CTGGAGAAGGAGATTGGGGGAGG - Intergenic
1092444421 12:8540846-8540868 GAGGAGAAAGAAAGAGAGGGAGG - Exonic
1092518253 12:9238518-9238540 GAGATGAAGGAAATTGAGGGAGG + Intergenic
1093547834 12:20369147-20369169 GAGAAGAAGGATTCCGAGGGTGG + Intergenic
1093706053 12:22276017-22276039 CAGGGGAATGATATGGAGGGAGG + Intronic
1093950925 12:25164411-25164433 GAGAAGAAGGGAATGGAGGGCGG - Intronic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095332853 12:40989827-40989849 CAGAAGAAGTATATTGAGTGTGG + Intronic
1095646243 12:44551548-44551570 GAGGAGAAGGCCATTGAGAGAGG - Intronic
1095856628 12:46866893-46866915 GAGGAACAGAATATTAAGGGTGG - Intergenic
1096152841 12:49325467-49325489 GAGGAGAAGGAAAAGGAAGGGGG - Intronic
1096529682 12:52234751-52234773 GAGAGAAAGGATATTGAGGAAGG + Intronic
1096676463 12:53228995-53229017 GAGGAGAAGGAGGTAGAGAGAGG + Intronic
1096795549 12:54075295-54075317 GAGGAGAAGGAACTAAAGGGTGG + Intergenic
1097181395 12:57173995-57174017 CAGGAGAAGGGTAGGGAGGGTGG + Intronic
1097936782 12:65261430-65261452 GCAGAGAAGGATATTCAAGGAGG + Intergenic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1099133695 12:78865551-78865573 GGGGAGAGGGATATGGGGGGGGG + Intronic
1099442418 12:82714640-82714662 GAAGCGAAGGAAAATGAGGGAGG - Intronic
1101555718 12:105807243-105807265 CATGAGAAGGACAATGAGGGAGG - Intergenic
1101645526 12:106627809-106627831 GAGAAGAAGGAAGTTCAGGGTGG + Intronic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102866525 12:116379259-116379281 GAGGAGATGGATATTCAGAGAGG + Intergenic
1103947154 12:124532936-124532958 GAGGAGTGGGATTTGGAGGGAGG - Intronic
1103947165 12:124532965-124532987 GAGGAGTGGGATTTGGAGGGAGG - Intronic
1103947182 12:124533024-124533046 GAGGAGTGGGATTTGGAGGGAGG - Intronic
1104488475 12:129172919-129172941 GAGGAGAGGGAAAATGATGGGGG + Intronic
1107126237 13:36849936-36849958 GTGGAGAAGTATCTTGAAGGTGG - Intronic
1107329053 13:39277866-39277888 GGGGAGAAGGAAAGGGAGGGTGG - Intergenic
1107969346 13:45626292-45626314 GAGTAGAAGGTTATTAGGGGAGG + Intergenic
1108790273 13:53961529-53961551 GAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1109677636 13:65700136-65700158 GAGGAGAAGTAAATGGAGTGTGG - Intergenic
1109800751 13:67375426-67375448 GAGGTTAAGGAAATTGAAGGCGG - Intergenic
1110529188 13:76576597-76576619 GGGGAGAAGGAGATGAAGGGAGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111640515 13:90963851-90963873 GAGGAGAAGGAGAGAGATGGGGG - Intergenic
1112341650 13:98557486-98557508 GAGGAGGAGGGATTTGAGGGAGG - Intronic
1113066592 13:106379050-106379072 GAGGAGGAGGATGTTGGGTGGGG + Intergenic
1113839609 13:113351254-113351276 GAGGAGACGGGCATTGAGGAGGG - Intronic
1114680769 14:24482105-24482127 GAAGAGAAGGTCATCGAGGGTGG + Intergenic
1114959026 14:27859811-27859833 GAGCAGTTGGATATTGAGGTTGG + Intergenic
1116105456 14:40497344-40497366 GGGGAGTAGGAGATTTAGGGAGG - Intergenic
1116110777 14:40577889-40577911 GAGGAGGAGGAGAGAGAGGGTGG + Intergenic
1116524775 14:45891121-45891143 GAGGAGCAGGAGAGAGAGGGAGG - Intergenic
1116788943 14:49318910-49318932 GAGGAGAAGGGAAGGGAGGGAGG + Intergenic
1117616200 14:57536178-57536200 GAGGGGAAGGACCTTGTGGGAGG - Intergenic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1119009727 14:70972234-70972256 GAGGAGGAGCAGATTCAGGGTGG + Intronic
1119707515 14:76793444-76793466 GAGGAGAAGGAAGAAGAGGGAGG + Intronic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1121153669 14:91663074-91663096 GAGGAGAAGGAGGTGGAGGAGGG - Intronic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1123428501 15:20193410-20193432 GAGGAGAAAGAACTTGAAGGAGG - Intergenic
1123433523 15:20238001-20238023 GAGGAGAACGTCATTGAGTGTGG + Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124816731 15:33001538-33001560 GAGGAGGAGGAGGATGAGGGGGG - Intronic
1124883521 15:33662853-33662875 GAGGAGAAGGCTGTGGAGGCTGG + Exonic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1124957865 15:34371238-34371260 GAGGAGAAGGAGATGGGAGGGGG - Intergenic
1124957872 15:34371257-34371279 GAGGAGAAGGAGGTGGGGGGAGG - Intergenic
1125311670 15:38385897-38385919 GAGGAGATGGAAGGTGAGGGAGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126343566 15:47669667-47669689 GAGGAGAAGGAGATTGACAGAGG - Intronic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127582339 15:60349830-60349852 GAGGGGAAGGAAAGGGAGGGAGG + Intronic
1127815686 15:62606968-62606990 GAGGAGGAGGATGATGATGGTGG - Intronic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128806043 15:70532042-70532064 AAGGTCAAGGTTATTGAGGGAGG + Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129077836 15:73012639-73012661 GAGGAGAAGGGAGGTGAGGGAGG - Intergenic
1129510425 15:76117690-76117712 GTGGAGAAGGATTTTGTGAGAGG + Intronic
1129517619 15:76166217-76166239 GAGGGGAAGGATGCTGCGGGGGG + Intronic
1129702327 15:77775031-77775053 GAGGCGATGCATGTTGAGGGTGG + Intronic
1130788848 15:87130234-87130256 GAGGAAAGGGAGATGGAGGGAGG - Intergenic
1130860138 15:87878511-87878533 GAGGTGAAGGTAATGGAGGGTGG - Intronic
1131290375 15:91101594-91101616 GAGGAGGAGGAAATTGATAGTGG + Intronic
1132083290 15:98885393-98885415 GAGGAGAAGGAAAGGGAGAGGGG - Intronic
1132158337 15:99513267-99513289 GGGGAGAAGGATACTGTGGATGG + Intergenic
1133395890 16:5447167-5447189 GAGGGGAAGGTTATTGTAGGTGG - Intergenic
1134978875 16:18591433-18591455 GGTGAGAAGGATACTGAGGAAGG + Intergenic
1135202719 16:20452687-20452709 GAGGAAAAGAATATTAAGGATGG + Intronic
1135216378 16:20575179-20575201 GAGGAAAAGAATATTAAGGATGG - Intronic
1135624879 16:23985775-23985797 GAAAATAAGGATAATGAGGGTGG + Intronic
1136157345 16:28392020-28392042 GAGGAGGAGGACAATGAAGGCGG - Exonic
1136172433 16:28496983-28497005 GAGGAGGAGGAGACTGCGGGAGG + Exonic
1136205741 16:28723261-28723283 GAGGAGGAGGACAATGAAGGCGG + Exonic
1136855816 16:33656352-33656374 GAGGAGAAAGAACTTGAAGGAGG + Intergenic
1137249201 16:46730260-46730282 GAGGAGAAGCTTCTTTAGGGTGG - Intronic
1137386460 16:48047351-48047373 GAGGAGAAGGAGGTGGAGGATGG + Intergenic
1138130597 16:54476343-54476365 CAGGAGAAGGAGGTAGAGGGTGG + Intergenic
1138143430 16:54587671-54587693 GAGGACAAGGATGCTAAGGGTGG + Intergenic
1138165813 16:54800749-54800771 GATGAGAAGGATTTTAAGAGTGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138742049 16:59322321-59322343 GAGGAGACTGAGATTGATGGGGG + Intergenic
1139102944 16:63790072-63790094 GAGGAGAGGGATAAAGAGAGAGG + Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1139780450 16:69347125-69347147 GGGGAGTGGGATTTTGAGGGTGG + Intronic
1140153783 16:72401174-72401196 GAGGAGAGGGAGAGGGAGGGGGG + Intergenic
1141782443 16:86172496-86172518 GAGAAGAAAGAAATGGAGGGAGG - Intergenic
1141861179 16:86717671-86717693 AAGGAGAAAGATACTAAGGGAGG + Intergenic
1142338801 16:89507840-89507862 GAGGAGGAGGGTCGTGAGGGAGG - Intronic
1203117401 16_KI270728v1_random:1504831-1504853 GAGGAGAAAGAACTTGAAGGAGG + Intergenic
1142492990 17:290508-290530 GATAAGAAGGACATTGAGGAAGG - Intronic
1142567407 17:849622-849644 GAGGACAAGGACGTGGAGGGAGG - Intronic
1142714158 17:1738882-1738904 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714168 17:1738927-1738949 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714178 17:1738972-1738994 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714188 17:1739017-1739039 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714198 17:1739062-1739084 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714208 17:1739107-1739129 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714218 17:1739152-1739174 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714228 17:1739197-1739219 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714240 17:1739242-1739264 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714250 17:1739287-1739309 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714260 17:1739332-1739354 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714270 17:1739377-1739399 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714281 17:1739422-1739444 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714301 17:1739510-1739532 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714311 17:1739555-1739577 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714321 17:1739600-1739622 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714331 17:1739645-1739667 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714341 17:1739690-1739712 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714352 17:1739735-1739757 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714362 17:1739780-1739802 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714374 17:1739825-1739847 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714384 17:1739870-1739892 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714395 17:1739915-1739937 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714406 17:1739960-1739982 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714417 17:1740005-1740027 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714428 17:1740050-1740072 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714438 17:1740095-1740117 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714449 17:1740140-1740162 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714459 17:1740185-1740207 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714479 17:1740275-1740297 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714489 17:1740320-1740342 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714500 17:1740365-1740387 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714512 17:1740410-1740432 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714522 17:1740455-1740477 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714533 17:1740500-1740522 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714544 17:1740545-1740567 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714555 17:1740590-1740612 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714566 17:1740635-1740657 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714576 17:1740680-1740702 GAGGAGCAGGACAGTCAGGGTGG + Intergenic
1142714587 17:1740725-1740747 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714597 17:1740770-1740792 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714607 17:1740815-1740837 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714617 17:1740860-1740882 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714627 17:1740905-1740927 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714639 17:1740950-1740972 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714651 17:1740995-1741017 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714662 17:1741040-1741062 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714674 17:1741085-1741107 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714686 17:1741130-1741152 GAGGAGCCGGACACTGAGGGTGG + Intergenic
1142714697 17:1741175-1741197 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714709 17:1741220-1741242 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714721 17:1741265-1741287 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714752 17:1741400-1741422 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714761 17:1741445-1741467 GAGGAGCAGGACAGTGAAGGTGG + Intergenic
1142714771 17:1741490-1741512 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714791 17:1741580-1741602 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714801 17:1741625-1741647 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714811 17:1741670-1741692 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714822 17:1741715-1741737 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714834 17:1741760-1741782 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714845 17:1741805-1741827 GAGGCGCAGGACAGTGAGGGTGG + Intergenic
1142714855 17:1741850-1741872 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714866 17:1741895-1741917 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142714887 17:1741983-1742005 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714899 17:1742028-1742050 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714909 17:1742073-1742095 GAGGAGCCGGACAGTGAGGGTGG + Intergenic
1142932603 17:3299588-3299610 AGGGAGTAGGACATTGAGGGAGG - Intergenic
1143679888 17:8468420-8468442 AAGGACCAGGATGTTGAGGGCGG + Intronic
1144283010 17:13745465-13745487 GAAGAGCAGGAGATGGAGGGAGG - Intergenic
1144401933 17:14913012-14913034 AAAGAGAAGGCTAGTGAGGGAGG + Intergenic
1145037959 17:19554295-19554317 GCTAAGAAGGATGTTGAGGGTGG + Intronic
1145408536 17:22633532-22633554 GAGGATACTGATAATGAGGGAGG - Intergenic
1147133842 17:38424194-38424216 GAGGAAAAGTATCTGGAGGGTGG - Intergenic
1147137104 17:38440789-38440811 GAGGAGAGGGATCTAGAGGCCGG + Intronic
1148863971 17:50619048-50619070 CAGGAGAAGGGTGTGGAGGGTGG + Intronic
1149107184 17:52983528-52983550 GAGGAGAAGGATTATGGGGCAGG + Intergenic
1149121776 17:53177045-53177067 GAGGTGGAGGAAATGGAGGGAGG - Intergenic
1150140437 17:62724056-62724078 AAGGAGAAGGATATGGAAGACGG + Intronic
1151430709 17:74060631-74060653 AGGGAGAAGGATAGAGAGGGAGG - Intergenic
1152019478 17:77772915-77772937 GAGGAAAAGGGAAGTGAGGGGGG - Intergenic
1153549131 18:6242386-6242408 GAGGAGAAGGATAATGGCGGTGG - Intronic
1153748390 18:8204150-8204172 GAGCAGAATGAGATTGGGGGTGG + Intronic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1156257434 18:35411121-35411143 GAGGAGGAGGAGATGGAAGGGGG + Intergenic
1156368508 18:36451601-36451623 GAGGAGAAGGAAGAGGAGGGAGG - Intronic
1156713928 18:39983044-39983066 GAGAAGAAGGCTGTTGGGGGAGG + Intergenic
1156956314 18:42968878-42968900 GAGGAGAAGTACATTGGAGGAGG + Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1158426539 18:57345117-57345139 TAGGAGAAAGATACTCAGGGAGG - Intergenic
1159134261 18:64318619-64318641 GAGGAGAAGGAGAGATAGGGAGG - Intergenic
1159977139 18:74727971-74727993 GGGGAGAAGGAGAGTGATGGAGG + Intronic
1160947579 19:1650915-1650937 GGGGGGAGGGAGATTGAGGGTGG - Intronic
1161100528 19:2419001-2419023 GAGGGGAAGGAAAGGGAGGGAGG - Intronic
1161100569 19:2419107-2419129 GAAGAGAAGGAAAGGGAGGGAGG - Intronic
1161256000 19:3310063-3310085 GAGGAGAGAGAGATGGAGGGAGG - Intergenic
1161597463 19:5157913-5157935 GAGGCGAAGGCTCTGGAGGGAGG + Intergenic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1161955213 19:7490152-7490174 AAGGAAAAGGACATTGAGGCCGG - Intronic
1162000944 19:7744803-7744825 GAGGAGAAGGATATGAATGAGGG - Intronic
1162735199 19:12743169-12743191 GAGGAGGAAGATAAAGAGGGAGG + Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163164264 19:15484462-15484484 GAGGAGAAGGAACTTGGGGCAGG + Intronic
1163175995 19:15564342-15564364 AGGGAGCTGGATATTGAGGGTGG + Intergenic
1163390446 19:17027095-17027117 GAGGAGAGGGAGAGTGGGGGCGG - Intergenic
1163751608 19:19081568-19081590 GAGGAGAATGCCACTGAGGGTGG + Intronic
1163767743 19:19172655-19172677 GAGGAGAAGGCTAGGGTGGGAGG + Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164503009 19:28835073-28835095 GAGGAAAAGCATTTTCAGGGTGG + Intergenic
1164720599 19:30429080-30429102 GTGGAGGAGGCTATAGAGGGAGG + Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166664946 19:44673837-44673859 CAGAAGAAGGTGATTGAGGGAGG + Intronic
1166738045 19:45097599-45097621 GAGGAGGGGGATTGTGAGGGAGG + Intronic
1166739466 19:45105230-45105252 GAGGAGGAGGAGCTTTAGGGAGG + Intronic
1168058581 19:53877732-53877754 GAGGAGAATGAAAGTGAAGGAGG + Intergenic
1168652028 19:58097761-58097783 GAGGGGAAGGCTCCTGAGGGGGG - Intronic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925217563 2:2110591-2110613 GGGGAGGAGGAAATAGAGGGAGG - Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926885508 2:17594784-17594806 GAGGAGCAGGATAATGGGAGTGG + Intronic
929097617 2:38278844-38278866 GAGGAGAGGGAGAGTGATGGGGG + Intergenic
929406411 2:41647901-41647923 GAGAAGAATGTTATTGAGTGGGG - Intergenic
929584805 2:43106928-43106950 GCTGAGAAGGATCTTGAGGCTGG + Intergenic
931205340 2:60140843-60140865 GAGGAGAAGGAGGGGGAGGGGGG - Intergenic
933119636 2:78520953-78520975 CAGGAGAATGATATCCAGGGAGG + Intergenic
934144563 2:89078709-89078731 GAGCAGAAGGGAAATGAGGGAGG - Intergenic
934224689 2:90121840-90121862 GAGCAGAAGGGAAATGAGGGAGG + Intergenic
934781279 2:96971254-96971276 GGGGAGAAGGAGAGAGAGGGAGG - Intronic
934934489 2:98454743-98454765 GAGGAGAAGGATGTGGGCGGGGG + Intronic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935674114 2:105579737-105579759 GAAGGGAAGGAGACTGAGGGAGG - Intergenic
937136635 2:119559179-119559201 GATGAAAAGGAAGTTGAGGGTGG - Intronic
938812002 2:134862358-134862380 GACGAGAATGATTTTGAGGTAGG + Intronic
939854210 2:147338104-147338126 GAGGAGGAGGATATTGCAGAGGG - Intergenic
940323733 2:152403321-152403343 GAGGAGTGGGATGTTGAGAGAGG + Intronic
940692925 2:156941834-156941856 GATGAGAAGGAGTTTGAGGAGGG + Intergenic
941228812 2:162883163-162883185 AAGGAGAAGGAAAGTGATGGTGG + Intergenic
942451787 2:176112701-176112723 GAGGACAACGACATTTAGGGAGG - Intronic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
944518655 2:200540550-200540572 GATGAGGAGGATAATGAAGGGGG + Intronic
944638234 2:201695504-201695526 GGGGAGTAGGGTATTGAGGCAGG + Intronic
945253866 2:207787796-207787818 GGTGATAAAGATATTGAGGGTGG + Intergenic
945283019 2:208054818-208054840 GAGGAGAAGGAGGTAGAGGAGGG + Intergenic
945863008 2:215145145-215145167 GAGAAGAAGGAAATGGAAGGGGG - Intergenic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
946970307 2:225083587-225083609 GAGGAGAAGGATGCAGAGGTAGG + Intergenic
947991109 2:234488135-234488157 TTGGAGAAGGATTTTGAGGGGGG + Intergenic
1168841473 20:912601-912623 GAGGAGGAGGAGAGAGAGGGAGG + Intronic
1170680589 20:18522078-18522100 GAGAAGAAGGGAATGGAGGGCGG + Intronic
1172219133 20:33260617-33260639 GAGGAGATGGATATGAAGTGAGG + Intergenic
1172621267 20:36319984-36320006 GAGGAGAGGGACACAGAGGGAGG - Intronic
1172621285 20:36320038-36320060 GAGGAGAGGGACACAGAGGGAGG - Intronic
1173052237 20:39574651-39574673 TAGGAGAAGGCTATTGAGAAGGG - Intergenic
1174081194 20:47971870-47971892 GAGGAGAAGGGGATTCATGGCGG - Intergenic
1174864194 20:54119858-54119880 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
1175400596 20:58697987-58698009 GAGGGGAAGGACACAGAGGGAGG - Intronic
1175460067 20:59145868-59145890 GAGGAGGAGGAGGGTGAGGGTGG - Intergenic
1175657760 20:60786880-60786902 GAGGAGGAGGAGGTTGAGGAGGG - Intergenic
1175717343 20:61263937-61263959 GAAGAGAAGGATGTAGAGAGAGG - Intronic
1176078861 20:63261681-63261703 GAGGAGAGGGAGAGAGAGGGAGG - Intronic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1177184668 21:17780352-17780374 GGGGAGCAGGAGATTGGGGGTGG - Intergenic
1177413747 21:20767920-20767942 GAAGAGAAGGAGAGTGATGGAGG + Intergenic
1177839862 21:26223500-26223522 TATAAGAAGGATATTGAGGAAGG - Intergenic
1178403304 21:32305528-32305550 GAGGAGGAGGAGGTTGGGGGTGG + Intronic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1179236736 21:39554145-39554167 GAGGAGGAGGACATGGAGAGAGG - Intergenic
1179712440 21:43271151-43271173 GCGGAGGAGGATGTGGAGGGCGG + Intergenic
1180795965 22:18605535-18605557 GAGGAGAGGGAGGTTTAGGGAGG + Intergenic
1181225757 22:21389736-21389758 GAGGAGAGGGAGGTTTAGGGAGG - Intergenic
1181252877 22:21545077-21545099 GAGGAGAGGGAGGTTTAGGGAGG + Intergenic
1181272910 22:21670845-21670867 GAGGAGAAGGTTGGTGAGAGAGG + Intronic
1181773688 22:25144804-25144826 CAGGAGAAGGAGGTTCAGGGTGG - Intronic
1181876639 22:25945640-25945662 GAGGGGAAGGACATTGAAGGAGG + Intronic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183236760 22:36624539-36624561 GAGTAGAAAGATATGCAGGGAGG - Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
949219024 3:1607217-1607239 GAGGAGGAGGAGCTGGAGGGAGG + Intergenic
949862474 3:8518786-8518808 GAGAAGAAAGTTATTGAGGAAGG + Intronic
950140297 3:10610722-10610744 GAGGAGAGAGATATGAAGGGAGG - Intronic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952276898 3:31886029-31886051 AAGGAGAAGGAGATGGGGGGTGG + Intronic
952354193 3:32570128-32570150 GAGGAGGAGGAACCTGAGGGAGG + Intronic
952439113 3:33306563-33306585 GAAGAGAAAGATATGGAGAGGGG - Intronic
952500171 3:33954276-33954298 GAGGAGAAAGAGATTGGGGCAGG + Intergenic
952806247 3:37355892-37355914 GAGGAGAAGGGTATTCACGGAGG - Intronic
953383419 3:42490925-42490947 GAGGTGAAGGATTGTGATGGAGG + Intronic
954050805 3:47975470-47975492 GAGGAGAAAAATAGAGAGGGAGG + Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954751861 3:52818324-52818346 GAGGAGTGGGAGGTTGAGGGAGG + Exonic
955516817 3:59733940-59733962 GAGGAGAAAGTTGTTGAGAGGGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957344092 3:78939854-78939876 ATGGAAAAGGATATTGAGTGAGG + Intronic
957523519 3:81351212-81351234 GAGGGGAATGATATAGAGGAAGG - Intergenic
957897724 3:86445537-86445559 GAGGAACAGAATATTGAGGATGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958499548 3:94887866-94887888 ATGGAAATGGATATTGAGGGTGG + Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959725081 3:109533626-109533648 GAGGAGAAGGAAAAGCAGGGAGG - Intergenic
960044873 3:113186902-113186924 GAGGAGCAGGAGGCTGAGGGCGG + Intergenic
960376260 3:116905468-116905490 GAGTAGTAGTATAATGAGGGTGG + Intronic
960999952 3:123367536-123367558 GAGGAGGAGGAAGCTGAGGGTGG - Intronic
961097012 3:124166067-124166089 GAGGAGATGGCATTTGAGGGAGG - Intronic
961366229 3:126401691-126401713 GAGGGGGAGGAGATGGAGGGAGG + Intronic
961428830 3:126865519-126865541 GAGGAGGAGGTTATGGAGGATGG - Intronic
961460290 3:127045673-127045695 GAGGAGAGGGAGAGGGAGGGAGG + Intergenic
961567957 3:127776886-127776908 GATGAGAAGGGTCTTGGGGGAGG + Intronic
962842835 3:139251426-139251448 GAGGAGAAGGAAATGGAGTTGGG - Intronic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
964037317 3:152215164-152215186 GAGGAGAAGGAAATTTTGGGTGG + Intergenic
964310790 3:155389734-155389756 GAAGATAAATATATTGAGGGAGG + Intronic
964407161 3:156361139-156361161 GATGAGAAGAATGATGAGGGCGG - Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
969467180 4:7364579-7364601 GAGGTAAAGGGTCTTGAGGGTGG + Intronic
970437285 4:16047894-16047916 GAGGACAAGGATCTTGAATGCGG + Intronic
971346454 4:25815853-25815875 GAGAGGAGGGATATTGGGGGGGG + Intronic
971562780 4:28102514-28102536 AAGAAGAAAAATATTGAGGGTGG + Intergenic
972347886 4:38208889-38208911 GATGAGAAGGATTTGGGGGGTGG - Intergenic
972775941 4:42240575-42240597 GAGGAGAAAGGTATAGAGGATGG - Intergenic
973138998 4:46742790-46742812 GAGTAAAGGGATATTGAGGTAGG + Intronic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973726867 4:53785800-53785822 GAGGGGAAGGGTTCTGAGGGGGG - Intronic
973801253 4:54481177-54481199 GAAGAGAAGAATATTCAGGCGGG + Intergenic
974596820 4:64024319-64024341 GAGGAGGAGGCTAGTGAGGAGGG + Intergenic
974779933 4:66542027-66542049 GGAGAGCAGTATATTGAGGGAGG - Intergenic
974950145 4:68577322-68577344 GAGGAGAAAGGTTATGAGGGCGG - Intronic
975223634 4:71843478-71843500 GGAGAATAGGATATTGAGGGTGG + Intergenic
976195605 4:82528848-82528870 GAGGACAAGGATACTTTGGGAGG - Intronic
977381505 4:96279907-96279929 GAAAAAAAGGATATTGAAGGAGG - Intergenic
978240851 4:106514631-106514653 GAGGGGTAGAATTTTGAGGGGGG - Intergenic
979018053 4:115459888-115459910 GAGGAAAAGAATATTAAGGATGG - Intergenic
980138311 4:128883267-128883289 GAGGGGAAGAATAGTGTGGGAGG + Intronic
980855696 4:138436664-138436686 GAGGAGAAGCATGTGGAAGGAGG + Intergenic
981659072 4:147145300-147145322 GAGGAGAAGGCCATTGAAGTTGG + Intergenic
981945366 4:150336565-150336587 GGGGAGAAGGAAAATTAGGGAGG + Intronic
984157075 4:176206403-176206425 GAGGAGAATGGGGTTGAGGGAGG + Intergenic
984251025 4:177334825-177334847 GAGGAGAAGGATTTGAAAGGCGG + Intronic
985140939 4:186840376-186840398 GAGGAGAAGGAGGGGGAGGGAGG - Intergenic
986055634 5:4134089-4134111 GGGCAGAAGGACACTGAGGGAGG - Intergenic
986517243 5:8576438-8576460 GAGGGGAAGGTGATTGAGGGAGG - Intergenic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
986857026 5:11881430-11881452 GATGAGAAGGATAGTGGGGAGGG - Intronic
987154698 5:15077529-15077551 GAGGACAAGGATTTTCAGAGAGG + Intergenic
988634049 5:32962303-32962325 GAGGAGAAGGGCATAGAGTGTGG - Intergenic
988842928 5:35100772-35100794 GAGGAGAGAGAAATAGAGGGGGG - Intronic
988890306 5:35609509-35609531 GAGGAGAAGGTAAGAGAGGGAGG - Intergenic
989265674 5:39470873-39470895 GTGGAGGAGGAAATTGATGGTGG - Intergenic
989586036 5:43074479-43074501 GAGGAGAAAGACAATCAGGGTGG + Intronic
989810611 5:45668380-45668402 CAGGAGAGAGAGATTGAGGGAGG - Intronic
989995113 5:50819852-50819874 GAGTAGAAGGAATGTGAGGGTGG + Intronic
990289269 5:54331975-54331997 GAGCACAAGGCTATTGAGGCAGG + Intergenic
991046028 5:62223758-62223780 GAGGAGAAAGAACTTGAAGGAGG - Intergenic
991048779 5:62250475-62250497 AAGGAAAAGGATATTGAGACTGG + Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992112595 5:73510072-73510094 GAGAAGGAGGAAAGTGAGGGAGG + Intergenic
992321224 5:75614907-75614929 GAGGAAAAGAATGGTGAGGGAGG + Intronic
992676943 5:79114447-79114469 GAAGAGAATGAAAATGAGGGAGG + Intronic
992994458 5:82318661-82318683 GAGGAGGAGGAAAGGGAGGGAGG + Exonic
993184867 5:84604451-84604473 AAGTAGAAGGAAATTCAGGGAGG + Intergenic
994217003 5:97149096-97149118 GAGGTCAAAGATACTGAGGGAGG + Intronic
994869502 5:105328262-105328284 TGAGAGAAGGAGATTGAGGGAGG - Intergenic
994926432 5:106122081-106122103 AAGGAGAAGGATATGAAGTGAGG + Intergenic
995214732 5:109582348-109582370 GAGGAGAAGGAAGAGGAGGGGGG + Intergenic
995269955 5:110208719-110208741 GAGGAGCAGAATATTAAGGATGG - Intergenic
995428145 5:112047025-112047047 GAGGAACAGAATATTAAGGGTGG - Intergenic
995962270 5:117856684-117856706 GAGGAGAAAGATATTGAACATGG - Intergenic
996796196 5:127350990-127351012 GATGGGAAGGATAGTGGGGGTGG + Intronic
998053239 5:139053736-139053758 GAGGAGATGGAGGCTGAGGGTGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998835695 5:146201183-146201205 GAGGAGGGGGTTAGTGAGGGAGG + Intergenic
998889941 5:146735326-146735348 GAGTAGAAGGATTGTGGGGGGGG - Intronic
999044842 5:148455924-148455946 GAGGAGGAGGATGAAGAGGGGGG + Intronic
999396567 5:151232998-151233020 GATGAGATGTATATTGGGGGAGG - Intronic
999802814 5:155053556-155053578 GAGGAGAAGAGGATGGAGGGCGG + Intergenic
1001018469 5:168162736-168162758 GATAACAAGGATAATGAGGGAGG + Exonic
1001381851 5:171310769-171310791 GAGGAGAAGGAGAGTGCGAGAGG - Intronic
1001790221 5:174449845-174449867 GAGGAGGAGGAAGTTGAAGGAGG + Intergenic
1001923720 5:175620780-175620802 GATGATAAGGATAATGATGGTGG + Intergenic
1001945655 5:175775392-175775414 GAGGGGAAGGAGAGTGAAGGAGG - Intergenic
1003668840 6:8136662-8136684 GGGGAGAAGGATGATGGGGGAGG - Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003867161 6:10373826-10373848 GATGACAAGTTTATTGAGGGTGG - Intergenic
1004233321 6:13852025-13852047 GAGGAGAGGGAGAGGGAGGGAGG - Intergenic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004297834 6:14430323-14430345 GAGGAGAGGGAAATGGAGAGTGG + Intergenic
1005507014 6:26478177-26478199 GAAGAGAAGGGTCTTGAGTGGGG - Intergenic
1005799399 6:29405161-29405183 GAGGAACAGGACACTGAGGGTGG + Intronic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1007077429 6:39076792-39076814 GTGCAGAAGGCCATTGAGGGCGG + Intronic
1007369882 6:41419747-41419769 GAGGAGGAGGAAATAGATGGAGG + Intergenic
1007825414 6:44596195-44596217 GAGGCTAAGGATATGGAGGGAGG - Intergenic
1007960796 6:45957175-45957197 GAGGATAAGGGAATTGAAGGAGG + Intronic
1009055344 6:58328174-58328196 CAGGAGAAGGATAGAGAGAGGGG - Intergenic
1009235817 6:61122404-61122426 AAGGAGAAGGATAGAGAGAGGGG + Intergenic
1009778210 6:68233702-68233724 GAGGAGAAGGACAGAGAGTGAGG - Intergenic
1010180888 6:73085490-73085512 GGGGAGAAAGTTATTGAGGCTGG + Intronic
1011027137 6:82881404-82881426 GAGGAGGAGGATTATGAGGAGGG + Intergenic
1011083317 6:83512393-83512415 GAGGAGACGGAGAGGGAGGGCGG - Intergenic
1012316660 6:97789761-97789783 TAGGAGAAGGATAGGTAGGGAGG - Intergenic
1012399922 6:98834651-98834673 GAGGAGAAAGAGAGCGAGGGCGG + Exonic
1012564887 6:100636426-100636448 GAGGAGAAGGAAAGAGATGGGGG - Intronic
1012814447 6:104004344-104004366 GGGGAGAAGGATTCTGAGGTTGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013788872 6:113813339-113813361 GAGGAGAAAGATACTGCAGGAGG + Intergenic
1013934102 6:115572233-115572255 GAGGAGAATGAAATTGAAGATGG - Intergenic
1016147703 6:140695967-140695989 GAGGAGCAGAATATTAAGGGTGG - Intergenic
1017472214 6:154750094-154750116 GAGGAGAATGATAATTTGGGGGG + Intronic
1017479777 6:154840902-154840924 GGAGAGAAGGGTTTTGAGGGTGG + Intronic
1017524770 6:155232835-155232857 GAGGAAAAGTATGTTGGGGGAGG - Intronic
1018616075 6:165688154-165688176 GAGGAGGAAGAGATAGAGGGTGG - Intronic
1018978414 6:168582939-168582961 AAGGAGGGGGAGATTGAGGGAGG - Intronic
1019372830 7:671951-671973 GTGGTGAAGGACATTGAGAGAGG - Intronic
1020474262 7:8577356-8577378 GAGGAGAAGGTTAGTGATAGTGG - Intronic
1021484287 7:21149771-21149793 GTGGAGAAGGCTATGGAGGTGGG - Intergenic
1021510568 7:21428273-21428295 GCGGCGAAGGAGACTGAGGGGGG - Intronic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022665902 7:32410346-32410368 GAGGAAAAGGAGGGTGAGGGCGG + Intergenic
1023481564 7:40640689-40640711 GATGAGAAGAATTTTGTGGGGGG - Intronic
1024231067 7:47363953-47363975 GAGGAGACGGATATGGATTGAGG + Intronic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024436793 7:49365884-49365906 GAGAAGAATGAGAGTGAGGGCGG - Intergenic
1025006544 7:55360108-55360130 GAGGAGTAAGATAGTGAAGGGGG + Intergenic
1025047923 7:55708229-55708251 GAGGGGAAGGAGATGCAGGGTGG - Intergenic
1025102144 7:56144261-56144283 GATGTGTAGGATATGGAGGGGGG - Intergenic
1025887779 7:65614542-65614564 GAGGAGGAGGAAATGGAAGGAGG - Intergenic
1026052744 7:66960793-66960815 GAGGAGCAGGATAGAGAGGATGG + Intergenic
1026135845 7:67659976-67659998 GAGGAGAAGGCTATAGAAGATGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026471865 7:70700585-70700607 GGGGAGAAAGAGATTAAGGGGGG + Intronic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026638334 7:72103745-72103767 GAGAAGATGGAAATGGAGGGGGG + Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028213460 7:88102910-88102932 GAGGAATTGGATATTCAGGGAGG + Intronic
1028265936 7:88725657-88725679 GAGGAGAATGTGATTGAGGTTGG + Intergenic
1029649550 7:101881786-101881808 AAGGTGGAGGTTATTGAGGGAGG + Intronic
1030128660 7:106178643-106178665 GAGGAGATGCATGTGGAGGGGGG + Intergenic
1030385456 7:108863163-108863185 GAGAAGAAGTTTATTGAGTGAGG - Intergenic
1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG + Intronic
1030921717 7:115397696-115397718 GAGAAAAAGGAGATTGAGGTTGG - Intergenic
1031555972 7:123176794-123176816 GAAGAAAAGGTTATTGAGGTAGG - Intronic
1031936816 7:127743509-127743531 GAAGAGAAGGAGAGAGAGGGTGG - Intronic
1032266260 7:130372055-130372077 GTGAGGAAGGATATTGAAGGGGG - Intergenic
1032280184 7:130493563-130493585 GAGGAGGAGGGTGTGGAGGGGGG + Intronic
1032923815 7:136578963-136578985 GAGGAGCAGAATATTAAGGAAGG - Intergenic
1033185507 7:139224420-139224442 GAAGAGAAGGACAGGGAGGGAGG + Intergenic
1034087795 7:148335967-148335989 GAAGGGAAGGAGAATGAGGGAGG - Intronic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034544247 7:151779446-151779468 CAGGAGAATGATGTAGAGGGAGG + Intronic
1036151410 8:6302547-6302569 GAGGAGAAGGATTTATAGAGGGG + Intergenic
1036546186 8:9771787-9771809 GAGGAGAAGGGAAGTGGGGGAGG + Intronic
1036811291 8:11868730-11868752 GAGGAGAAGGACCTTGGGGGCGG + Intronic
1038242374 8:25821800-25821822 GAGGAGGAGGCCACTGAGGGAGG + Intergenic
1038650100 8:29394713-29394735 GAGTAGAAAGACACTGAGGGAGG + Intergenic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039929974 8:41977213-41977235 CAGAAGAAGGATATTTAGAGCGG - Exonic
1041163222 8:55065936-55065958 GATGAGAAGAATATTGAAGCTGG - Intergenic
1041330051 8:56714457-56714479 GTGGGGAAGGACAGTGAGGGAGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042767283 8:72337337-72337359 GAGGAGAAGGAAAATCAGTGAGG - Intergenic
1042848532 8:73192306-73192328 GAGGGGAAGGAGATAAAGGGAGG - Intergenic
1043217969 8:77620315-77620337 GAAGAGAAAGATAGTGAAGGGGG + Intergenic
1043280488 8:78459670-78459692 AAGGAGAAGGATATGGGGAGAGG + Intergenic
1043362548 8:79492338-79492360 GAGAAGCAAGATAGTGAGGGGGG + Intergenic
1043722676 8:83565597-83565619 GATGGGAAGGATAGTGCGGGTGG - Intergenic
1044286460 8:90416297-90416319 GAGGAAAAGAATTTTGAGGATGG - Intergenic
1046983569 8:120362797-120362819 GAGTAGGAGGAGATGGAGGGAGG + Intronic
1047480223 8:125275162-125275184 CAGGAAAAGGATATGGAAGGGGG - Intronic
1047508260 8:125496779-125496801 TGGGAGAAGGAGATTGGGGGTGG + Intergenic
1047673365 8:127172734-127172756 GAGGAAAAGTAAATGGAGGGTGG + Intergenic
1047688685 8:127328662-127328684 GAGGAGGAGTATAATGAGAGAGG - Intergenic
1047743068 8:127822723-127822745 GATAAGAAGGACATTGTGGGCGG + Intergenic
1048019607 8:130526319-130526341 GATCAGAAGGCTATTGAGAGAGG - Intergenic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048766363 8:137848630-137848652 AAAGAGAAGGATATTGGGGCCGG + Intergenic
1048899719 8:139025666-139025688 GATGAGAAGGACATTGAAGAAGG - Intergenic
1049609048 8:143544382-143544404 GAGGAGGAGGATGAGGAGGGAGG - Intergenic
1049857043 8:144868860-144868882 GAGGAAGAGGATATTAAGGATGG + Intergenic
1050009261 9:1169588-1169610 GAAGAGAAGGATATTCCAGGAGG + Intergenic
1050264669 9:3877789-3877811 AAGGAGAAGAATATTGCAGGAGG - Intronic
1050527208 9:6556319-6556341 GTAGAGAAGGACATGGAGGGAGG + Intronic
1050867370 9:10519888-10519910 GAGGAGAGGGAAATTGATGGGGG - Intronic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053473703 9:38365732-38365754 GGGGAGAAGGATGTCGATGGAGG - Intergenic
1053511642 9:38692942-38692964 GAGGAGCAGGAGATAGGGGGTGG - Intergenic
1055150677 9:72995258-72995280 GAGGAGAAGGAGAGAGATGGGGG - Intronic
1056407525 9:86289477-86289499 GAGAAGAAGGATATGGTGTGAGG - Intronic
1056454952 9:86751161-86751183 GAGGAGGAGGATACAGAGGCTGG + Intergenic
1056959624 9:91111585-91111607 GAGGAGAAGGAAAGAGATGGGGG + Intergenic
1057133344 9:92669828-92669850 GAGGAAACGGATAATGGGGGCGG + Intronic
1057420824 9:94910770-94910792 GCAGAGAAGGATCTTGGGGGAGG + Intronic
1057456292 9:95215361-95215383 GAGGAGAGGGAGATGGAGAGAGG + Intronic
1059318865 9:113450667-113450689 GAGGGAAAGAATATTGAGGAGGG + Intronic
1060018061 9:120104424-120104446 GAGGAGAAGGATTGGGATGGTGG + Intergenic
1060527196 9:124327306-124327328 GAGGAGAAGGAGATTGGTGTGGG - Intronic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1061282020 9:129602885-129602907 GAGGAGGGGGAGAATGAGGGAGG + Intergenic
1061981706 9:134108489-134108511 GAGGAGGGGGATATAGAGAGGGG + Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186506693 X:10099269-10099291 GAGGAGAAGAATATTGAAAACGG - Intronic
1186539125 X:10382343-10382365 GAGGAGATGATTATTGAGAGGGG - Intergenic
1186576759 X:10775088-10775110 GAGGAGAATGAAAAAGAGGGAGG + Intronic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188607239 X:32046326-32046348 GAGGAGAAGGGTAATGAATGTGG - Intronic
1191871149 X:65746688-65746710 GAGGTGAGGAAGATTGAGGGAGG - Intergenic
1192012647 X:67291546-67291568 GTAGGGAAGAATATTGAGGGTGG + Intergenic
1192033977 X:67544425-67544447 GGGGAGAAGGGTGGTGAGGGGGG - Intronic
1193546463 X:82836436-82836458 GAGGAGAAGGGTATGAAGAGAGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194966505 X:100294445-100294467 AGGGAGAAGGGTTTTGAGGGAGG - Exonic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196237175 X:113296249-113296271 CAAGAGAAGGAATTTGAGGGAGG - Intergenic
1196918156 X:120560765-120560787 GACGAGAAGGAAAGTGAAGGGGG + Intronic
1197436505 X:126434832-126434854 GAGGAGGAGGAGATAGAGGAGGG + Intergenic
1197756229 X:129996999-129997021 GAAGAGAAGGACATTAAAGGAGG - Intronic
1197888480 X:131242397-131242419 GAGGCTAAGGATATTGTGGGGGG + Intergenic
1198156054 X:133961893-133961915 GTGGAGAAGGGTATAGAGGCAGG - Intronic
1198714144 X:139538353-139538375 CAGCAGTAGGATTTTGAGGGAGG + Intronic
1199249582 X:145644626-145644648 GAGGGGAAGGAGAGAGAGGGAGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1202100047 Y:21298076-21298098 GAGGAAAAGAATATTAAGGATGG + Intergenic