ID: 1161845917

View in Genome Browser
Species Human (GRCh38)
Location 19:6711916-6711938
Sequence CCGTGTAAGTGGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161845906_1161845917 20 Left 1161845906 19:6711873-6711895 CCCCCATGGGAGTGGAAAGACTG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 150
1161845905_1161845917 24 Left 1161845905 19:6711869-6711891 CCTTCCCCCATGGGAGTGGAAAG 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 150
1161845909_1161845917 17 Left 1161845909 19:6711876-6711898 CCATGGGAGTGGAAAGACTGTGC No data
Right 1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 150
1161845907_1161845917 19 Left 1161845907 19:6711874-6711896 CCCCATGGGAGTGGAAAGACTGT 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 150
1161845908_1161845917 18 Left 1161845908 19:6711875-6711897 CCCATGGGAGTGGAAAGACTGTG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161845917 Original CRISPR CCGTGTAAGTGGAAGGAGCA GGG Intronic
900500524 1:3002322-3002344 CGGTGTCAGAGGAAGGAGCTGGG - Intergenic
903250871 1:22052614-22052636 CCGCGGAAGTGGGAGGAACAGGG - Exonic
903384303 1:22916587-22916609 TGGTGTAAGTGGAAGGCGCTTGG - Intergenic
911530635 1:99039433-99039455 CCCAGGAAGTGCAAGGAGCATGG + Intergenic
911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG + Intergenic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
917847557 1:179034246-179034268 CCGTGAAAGTGGAAGCTGCCAGG + Intronic
918043940 1:180929850-180929872 ACGTGGCAGTGGAGGGAGCAGGG + Intronic
918562064 1:185880829-185880851 CCATGTAAATGGAAGAAGAAAGG + Intronic
919249229 1:195030896-195030918 CCGAGCAAGTGCCAGGAGCAAGG + Intergenic
919415811 1:197307842-197307864 GCTAGTAAGTGGAAGGACCAGGG - Intronic
921384122 1:214552057-214552079 ACGTGGAAGTGGAGAGAGCAAGG + Intronic
923082310 1:230669913-230669935 CAGTGTACGAGGAAGGTGCAGGG + Intronic
923093284 1:230755409-230755431 GAGTGTAAGTGGATGGAGCATGG + Intronic
1065960669 10:30731904-30731926 TTTTGTAAGTGGAAGGGGCATGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1069748720 10:70732356-70732378 ACGTGTAAGTGGCAGCAGCACGG + Exonic
1070086896 10:73246857-73246879 CCGTTTCGGTGGGAGGAGCAGGG - Intronic
1070586310 10:77769431-77769453 ACTTGTAGCTGGAAGGAGCAAGG - Intergenic
1071121466 10:82283678-82283700 CTGTGTATCTGGAAGGAGCCTGG + Intronic
1072732374 10:97854944-97854966 CCATGAAAGGGGAAAGAGCAGGG + Intronic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073893164 10:108123626-108123648 GAGTGTAAGTACAAGGAGCAAGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1075420956 10:122299895-122299917 CTGTGTGAGTTGAAGGAGCCAGG - Intronic
1075641134 10:124065329-124065351 CAGTGTAAGTGGCATGATCATGG - Intronic
1077121435 11:910731-910753 CCGTGCAAGGAGGAGGAGCAGGG + Intronic
1077809658 11:5624529-5624551 CCATGAAAGTGGTAGGAGAAGGG + Intronic
1080729779 11:34937464-34937486 CGGGGTGGGTGGAAGGAGCAAGG + Intronic
1083234588 11:61343496-61343518 CCTTGTAACTGGAAGGAGCCAGG + Intronic
1083802136 11:65052984-65053006 CCGTGTGCCTGGATGGAGCAAGG - Intronic
1084657434 11:70527626-70527648 CCGTGGTGGTGAAAGGAGCAGGG + Intronic
1086004338 11:82019188-82019210 CCTCGTACGTGGAAGAAGCATGG + Intergenic
1090105254 11:123847659-123847681 CAATTTAAGTGAAAGGAGCAAGG - Intergenic
1090445514 11:126761473-126761495 CCTTGAAAGAGAAAGGAGCAGGG - Intronic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1095257711 12:40059589-40059611 CAATGTATGGGGAAGGAGCACGG + Intronic
1102167016 12:110814838-110814860 CCCAGAAAGTGGAAGGGGCAGGG - Intergenic
1103571644 12:121848913-121848935 CCATGTTAGTGCAAGGACCAGGG + Intronic
1108742367 13:53351189-53351211 CTATGTAAGTGGAGGGGGCAGGG + Intergenic
1108756037 13:53503408-53503430 CGGGGTAGGTGGAAGGAGAAAGG - Intergenic
1110373036 13:74760521-74760543 CCGTCTAACTGCAAGGAGCCTGG + Intergenic
1113166825 13:107452104-107452126 CCATAAAAGTGGAAGGAGGAGGG - Intronic
1114228300 14:20758450-20758472 CCGTATATGTGGAATAAGCAGGG + Intergenic
1116334442 14:43639371-43639393 CCTTGTAAGTGGATGGGGAAGGG + Intergenic
1117850138 14:59958869-59958891 CCCAGGAAGTGCAAGGAGCAGGG - Intronic
1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG + Intronic
1121513883 14:94536063-94536085 ACGTGTAGGTGGAGAGAGCAGGG + Intergenic
1121666852 14:95679057-95679079 CAGTGTAACTGAAAGGAACAAGG - Intergenic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1137232031 16:46575190-46575212 CTGTGGAAGTGTATGGAGCAAGG + Intergenic
1140115752 16:72039993-72040015 GAGTGTAGGTGGAAGGAGTATGG - Intergenic
1141754583 16:85982795-85982817 CCGTGTAAGTGGAGCAGGCAGGG - Intergenic
1141821399 16:86448636-86448658 CAGAGTAAGTGGCAGAAGCAGGG - Intergenic
1142071235 16:88092194-88092216 CCGGGGAAGAGGAAGGAGCTGGG - Intronic
1144908001 17:18653504-18653526 CCGTTTCAGTAGAAAGAGCATGG + Intronic
1146427994 17:32762206-32762228 CCCTGTGACTGGAAGGAGAAAGG + Intronic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1148202422 17:45758115-45758137 CCGTGGAAGTGGAATGTGCAGGG + Intergenic
1148835326 17:50462941-50462963 CCATGTAAGTGGCATGAGAACGG + Intronic
1149556904 17:57579913-57579935 GGTTGTAAGTGGAAGGAGCCTGG - Intronic
1151365020 17:73611564-73611586 CATGGTAAGTGGAATGAGCACGG + Intronic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1152485515 17:80589210-80589232 CCCTGCAAGTGAAAGGAGCTGGG - Intronic
1157483297 18:48069688-48069710 CCCTGGAATTGGAAGGAACAGGG - Intronic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159302334 18:66590849-66590871 CCTTGTAAGATGAAGGAGCATGG + Intronic
1160005638 18:75067249-75067271 CAGTGGATGTGGAAGAAGCAGGG + Intergenic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1162298881 19:9832627-9832649 CCCTCTAAGTGGATAGAGCAAGG - Intergenic
1162617465 19:11813924-11813946 CCGTGCAGAAGGAAGGAGCAGGG + Intergenic
1162646412 19:12053245-12053267 CCGTGTAGGATGAAGGGGCAGGG - Intergenic
1164821411 19:31254207-31254229 TCATGCAAGTGGATGGAGCAGGG - Intergenic
1164926879 19:32137623-32137645 CCCAGAAAGTGGAAGGAGAAAGG + Intergenic
1165403276 19:35615210-35615232 CCGTGTCTGTGGGAGGAACAGGG - Exonic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167872521 19:52384127-52384149 CCGTGTGAATGTAATGAGCATGG + Exonic
925391447 2:3497127-3497149 CAGTGTAAGTGTAGGGATCAGGG + Intergenic
926383580 2:12314794-12314816 ATGAGTTAGTGGAAGGAGCATGG - Intergenic
926880837 2:17541838-17541860 ATGTGTACGTGGAAGGAGCGAGG + Intronic
930774540 2:55159273-55159295 CAGTGGAAGTGGAGGGGGCAAGG - Intergenic
932331167 2:70899284-70899306 CCGTGAAAGTGGCTGTAGCATGG - Intergenic
935924844 2:108056196-108056218 ACTTGAAAGTGAAAGGAGCAAGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
942180801 2:173378738-173378760 ACTTGTAAGTGGAAGGATTATGG - Intergenic
942572291 2:177326595-177326617 CCATGTGAGTGTAATGAGCAAGG - Intronic
943094812 2:183416499-183416521 CCTGGGAAGTGCAAGGAGCAGGG + Intergenic
943904043 2:193475209-193475231 CCTTGTAAAAGGCAGGAGCATGG + Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947872378 2:233446632-233446654 CCGTGAAAGCGGACGGCGCAGGG + Intronic
948572425 2:238926082-238926104 CTGTGTACCTGGGAGGAGCATGG - Intergenic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
948949593 2:241240372-241240394 GCTTGTAAGTGGCAGGACCAGGG - Intronic
1171094561 20:22318982-22319004 CCGTCTAAGTGGACAGAGCTGGG - Intergenic
1172300542 20:33846658-33846680 GGGTGTGAGTAGAAGGAGCATGG + Intronic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1178373901 21:32050607-32050629 CCTCGTGAGAGGAAGGAGCAGGG - Intergenic
1184730789 22:46369909-46369931 CCTTCTCAGAGGAAGGAGCAAGG + Intronic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
949480376 3:4488631-4488653 CCTTGTGAGTGGAGGGAACATGG - Intergenic
951147202 3:19242038-19242060 CCTTGAAAGTGGAAAGAGCTGGG + Intronic
951299794 3:20981777-20981799 CTGTGTAAGAGGTTGGAGCAGGG + Intergenic
951317338 3:21203640-21203662 CAGTCTCAGTGGAAGCAGCATGG + Intergenic
955380689 3:58435461-58435483 CAGTGTAAGTGCCAGGAGCTGGG + Intergenic
962698066 3:137970580-137970602 CATTGAAAGTGGAAGGAACAGGG - Intergenic
964898789 3:161631651-161631673 CTGTGTAATTGGATGGAGCAAGG - Intergenic
966373122 3:179268887-179268909 CAGTGTGAGTTGCAGGAGCATGG + Intergenic
967009822 3:185422256-185422278 CCATGCTAGTGGAAGGAGCTGGG + Intronic
967036417 3:185651727-185651749 AGGTGTAAGGGGAAGTAGCATGG - Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
971074134 4:23128574-23128596 TGGTGTCAGTGGAAGGAGCCAGG + Intergenic
973650680 4:52994333-52994355 GCGGGGAAGTGGAAAGAGCACGG + Intronic
973650965 4:52996797-52996819 CCTTGTGTGAGGAAGGAGCAAGG + Intronic
975479271 4:74859747-74859769 CCTGGGAAGTGCAAGGAGCAAGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
983169659 4:164521269-164521291 CCGGGGAAGTGCACGGAGCAGGG - Intergenic
986600428 5:9467465-9467487 CCATGGAAGTGGAAGGTGCCTGG - Intronic
988658746 5:33241123-33241145 CCATTTCAGTGGAAGTAGCATGG + Intergenic
990010743 5:50994646-50994668 TGGTGAAAGTGGAAGGAGAAGGG - Intergenic
991110813 5:62897093-62897115 CCCGGGAAGTGCAAGGAGCAGGG - Intergenic
993126150 5:83838188-83838210 CGGGGAAAGTGGAAAGAGCACGG - Intergenic
993740380 5:91531342-91531364 CCCTGTAACTGAAAGGAGCTTGG + Intergenic
996792872 5:127312093-127312115 CAGTGAGAGAGGAAGGAGCAAGG - Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
999705567 5:154269717-154269739 CAGTGTCAGTGGAGGGAGCCTGG + Intronic
1011076279 6:83442761-83442783 CAGTGGAGGTGGAACGAGCAGGG - Intergenic
1011221077 6:85055052-85055074 CCCTGTCAGCTGAAGGAGCAAGG - Intergenic
1011643332 6:89434363-89434385 CAGTGTAAGTGGAAAGAACTTGG + Intronic
1013235600 6:108195412-108195434 CGCTGCATGTGGAAGGAGCATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014584529 6:123182335-123182357 CCCTGGAAGTGCAAGGAGCGAGG + Intergenic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1020646611 7:10821771-10821793 CAATGAAATTGGAAGGAGCACGG + Intergenic
1022131974 7:27413033-27413055 GTGTGTAAGTCGAAGGAGCCTGG + Intergenic
1023035351 7:36126786-36126808 TCGGGTGAGTGGACGGAGCATGG - Intergenic
1023844081 7:44111431-44111453 CCCTGGAAGTGGAAGGGGCATGG + Intronic
1023857032 7:44190169-44190191 CCCAGTGAGTGGATGGAGCAGGG + Intronic
1023894238 7:44418806-44418828 CCTGGGAAGTGCAAGGAGCAGGG + Intronic
1028956787 7:96702279-96702301 CCCTCTAAGTGGAAGGAACTAGG - Intronic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1038205795 8:25463833-25463855 CCCTGTGAGTGGAAGGAGATGGG - Intronic
1047789175 8:128185206-128185228 CCGTGTACGTGGAGGGGGGAGGG - Intergenic
1048606126 8:135970716-135970738 CCTTGTAAGTGAAAGGGGGAAGG + Intergenic
1048638522 8:136326597-136326619 CCATGTGGTTGGAAGGAGCAGGG - Intergenic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1051298194 9:15618767-15618789 CCCTGGAAGTGCAAGGAGCTAGG - Intronic
1056219022 9:84433033-84433055 CCATGTGAGTGGAAGGTGAAAGG + Intergenic
1056938865 9:90938034-90938056 CCCTGAGAGTGGAAGGAACATGG - Intergenic
1057516781 9:95728926-95728948 CCGTGTGCGGTGAAGGAGCAGGG + Intergenic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060824743 9:126681549-126681571 CCGGGTTAGAGGGAGGAGCAGGG - Intronic
1203746968 Un_GL000218v1:45267-45289 AGGTGAAGGTGGAAGGAGCAGGG - Intergenic
1186658357 X:11640988-11641010 CTGTGTAAGTGACAGGGGCATGG + Intronic
1187449711 X:19385880-19385902 CCATGTAACTGGAAGGTACAGGG + Intronic
1187534959 X:20133069-20133091 CCCTGTAAGTAGGAGGGGCACGG + Intronic
1189130194 X:38490426-38490448 CCCTGTAAATGGAAGTAGCAAGG - Intronic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1189727051 X:43977735-43977757 TCATGGAAGTGGAAGGAGCTTGG - Intergenic
1189917412 X:45869931-45869953 CCCTGTAAGTGGGGGGAGGAAGG + Intergenic
1192759265 X:74078311-74078333 CCCAGGAAGTGCAAGGAGCAGGG - Intergenic