ID: 1161846343 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:6713736-6713758 |
| Sequence | CTGGGAGTGGGGAAGGTGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2139 | |||
| Summary | {0: 1, 1: 2, 2: 32, 3: 196, 4: 1908} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1161846343_1161846360 | 13 | Left | 1161846343 | 19:6713736-6713758 | CCCCCCACCTTCCCCACTCCCAG | 0: 1 1: 2 2: 32 3: 196 4: 1908 |
||
| Right | 1161846360 | 19:6713772-6713794 | CCACCCCCCAGCCCCCCACCTGG | 0: 1 1: 3 2: 22 3: 191 4: 1390 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1161846343 | Original CRISPR | CTGGGAGTGGGGAAGGTGGG GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||