ID: 1161846343

View in Genome Browser
Species Human (GRCh38)
Location 19:6713736-6713758
Sequence CTGGGAGTGGGGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2139
Summary {0: 1, 1: 2, 2: 32, 3: 196, 4: 1908}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161846343_1161846360 13 Left 1161846343 19:6713736-6713758 CCCCCCACCTTCCCCACTCCCAG 0: 1
1: 2
2: 32
3: 196
4: 1908
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161846343 Original CRISPR CTGGGAGTGGGGAAGGTGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr