ID: 1161846360

View in Genome Browser
Species Human (GRCh38)
Location 19:6713772-6713794
Sequence CCACCCCCCAGCCCCCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1607
Summary {0: 1, 1: 3, 2: 22, 3: 191, 4: 1390}

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161846352_1161846360 -5 Left 1161846352 19:6713754-6713776 CCCAGCCCCCACCTGACTCCACC 0: 1
1: 0
2: 8
3: 117
4: 769
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846343_1161846360 13 Left 1161846343 19:6713736-6713758 CCCCCCACCTTCCCCACTCCCAG 0: 1
1: 2
2: 32
3: 196
4: 1908
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846339_1161846360 20 Left 1161846339 19:6713729-6713751 CCCCCAGCCCCCCACCTTCCCCA 0: 2
1: 1
2: 27
3: 267
4: 3476
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846340_1161846360 19 Left 1161846340 19:6713730-6713752 CCCCAGCCCCCCACCTTCCCCAC 0: 2
1: 2
2: 19
3: 250
4: 1844
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846338_1161846360 23 Left 1161846338 19:6713726-6713748 CCACCCCCAGCCCCCCACCTTCC 0: 3
1: 23
2: 241
3: 1402
4: 6360
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846342_1161846360 17 Left 1161846342 19:6713732-6713754 CCAGCCCCCCACCTTCCCCACTC 0: 2
1: 1
2: 22
3: 223
4: 2078
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846348_1161846360 6 Left 1161846348 19:6713743-6713765 CCTTCCCCACTCCCAGCCCCCAC 0: 1
1: 3
2: 63
3: 559
4: 3593
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846337_1161846360 24 Left 1161846337 19:6713725-6713747 CCCACCCCCAGCCCCCCACCTTC 0: 2
1: 2
2: 73
3: 648
4: 3829
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846345_1161846360 11 Left 1161846345 19:6713738-6713760 CCCCACCTTCCCCACTCCCAGCC 0: 1
1: 4
2: 20
3: 240
4: 1864
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846351_1161846360 0 Left 1161846351 19:6713749-6713771 CCACTCCCAGCCCCCACCTGACT 0: 1
1: 1
2: 13
3: 152
4: 1113
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846354_1161846360 -10 Left 1161846354 19:6713759-6713781 CCCCCACCTGACTCCACCCCCCA 0: 1
1: 1
2: 7
3: 82
4: 1025
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846346_1161846360 10 Left 1161846346 19:6713739-6713761 CCCACCTTCCCCACTCCCAGCCC 0: 1
1: 2
2: 23
3: 229
4: 1676
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846341_1161846360 18 Left 1161846341 19:6713731-6713753 CCCAGCCCCCCACCTTCCCCACT 0: 1
1: 2
2: 9
3: 107
4: 1046
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846336_1161846360 25 Left 1161846336 19:6713724-6713746 CCCCACCCCCAGCCCCCCACCTT 0: 3
1: 7
2: 44
3: 381
4: 2592
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846335_1161846360 30 Left 1161846335 19:6713719-6713741 CCTGGCCCCACCCCCAGCCCCCC 0: 3
1: 3
2: 76
3: 794
4: 5131
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846344_1161846360 12 Left 1161846344 19:6713737-6713759 CCCCCACCTTCCCCACTCCCAGC 0: 1
1: 14
2: 31
3: 254
4: 1922
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846347_1161846360 9 Left 1161846347 19:6713740-6713762 CCACCTTCCCCACTCCCAGCCCC 0: 1
1: 4
2: 72
3: 533
4: 3413
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846353_1161846360 -6 Left 1161846353 19:6713755-6713777 CCAGCCCCCACCTGACTCCACCC 0: 1
1: 0
2: 13
3: 116
4: 1111
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846350_1161846360 1 Left 1161846350 19:6713748-6713770 CCCACTCCCAGCCCCCACCTGAC 0: 1
1: 0
2: 12
3: 99
4: 829
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390
1161846349_1161846360 2 Left 1161846349 19:6713747-6713769 CCCCACTCCCAGCCCCCACCTGA 0: 1
1: 0
2: 9
3: 137
4: 1030
Right 1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG 0: 1
1: 3
2: 22
3: 191
4: 1390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161846360 Original CRISPR CCACCCCCCAGCCCCCCACC TGG Intronic
900019994 1:181571-181593 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
900095902 1:940024-940046 CCAGGCCCCAGCCGCCCGCCTGG + Intronic
900116034 1:1028327-1028349 CCCCCCCCCCGCCCTGCACCTGG + Intronic
900173466 1:1281642-1281664 CCACCCCCCTCCCCTCCTCCCGG - Intronic
900192749 1:1358420-1358442 CCACCCCCCACCCGCCTCCCAGG + Intronic
900215834 1:1481058-1481080 CCACCCCGCAGAGCCCCAGCAGG - Intronic
900284039 1:1890788-1890810 GCAGCCCCCAGCCCCGGACCCGG - Intronic
900291936 1:1927345-1927367 CCACCCCCCACCCAGCCCCCCGG - Intronic
900360728 1:2287701-2287723 CCACCCCCACGCCCCACACAGGG - Intronic
900412821 1:2520602-2520624 CCACCCCCCTCCCGCCCACTGGG + Intronic
900416049 1:2535149-2535171 CTTGCCCCCAGCCCCCCAGCTGG - Intergenic
900417645 1:2542507-2542529 CCAGACCCCAGCCCCTCACAGGG - Intergenic
900465237 1:2822204-2822226 CCACGCCGGAGCCCCCCTCCAGG + Intergenic
900530519 1:3150859-3150881 CCAGCCCCCCCGCCCCCACCCGG - Intronic
900536291 1:3179354-3179376 CCAGCCCTCAGCCCCTCACTGGG + Intronic
900594509 1:3474611-3474633 CCACCCTGCAGCCCCACACGGGG + Intronic
900604715 1:3518853-3518875 TCATCCCCCAGCTCCCCTCCAGG + Intronic
900616831 1:3569273-3569295 CCACCCCGCCGCCCCTCAGCCGG + Intronic
900732251 1:4269798-4269820 CCTCCCCCCAACCCCACAACAGG - Intergenic
900919589 1:5662045-5662067 CCTCCCACCAGCCCCACTCCTGG - Intergenic
901138851 1:7014821-7014843 CCACCACCCGCTCCCCCACCCGG - Intronic
901535481 1:9880126-9880148 CTTGCCCCCAGCCCCCCAACAGG + Intronic
901641115 1:10693755-10693777 CGACCCTCCCGGCCCCCACCCGG + Intronic
901813360 1:11779949-11779971 CCAGCCGCCAGCCCCGCTCCTGG - Exonic
901911330 1:12460934-12460956 CCACCCCCCATCCCCCCAGCAGG + Intronic
902018738 1:13328619-13328641 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
902240998 1:15089284-15089306 ACACCCCCCACCCACCCACCTGG + Intronic
902361078 1:15942995-15943017 CCTTCCCCCTGCTCCCCACCTGG + Intronic
902372048 1:16013300-16013322 CCCCTCCCACGCCCCCCACCCGG - Intergenic
902392767 1:16115881-16115903 CTGCCCCCCAGTCCCCCACGAGG - Intergenic
902534828 1:17113595-17113617 CCTCCCCTCTGCCCCACACCAGG - Intronic
902836930 1:19053530-19053552 CCAGCCCCCAGCCCTCCTGCCGG + Intergenic
903081682 1:20816311-20816333 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
903139951 1:21333331-21333353 CCACCCCCCCGCCCCCCCCACGG - Intronic
903141960 1:21344562-21344584 CCTCCCAACAGCCCCCCCCCAGG + Intronic
903188136 1:21640865-21640887 ACACTCCCCACCACCCCACCGGG + Intronic
903349585 1:22710169-22710191 CCTCCCCCCAGCCCCACCCCAGG + Intergenic
903637899 1:24833835-24833857 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
903986685 1:27234261-27234283 GCACCTCCCACCCCACCACCGGG - Intergenic
904000123 1:27334085-27334107 CCTCCCCCCTGGTCCCCACCTGG - Intronic
904403599 1:30272638-30272660 CCACCCCACAGCCCTTGACCAGG + Intergenic
904558639 1:31382057-31382079 CCATCCCCAGGCCCCACACCAGG - Intergenic
904568834 1:31445437-31445459 CCGCCCCCCCGCCCCACGCCGGG + Intergenic
904744874 1:32704287-32704309 CCAACCCCCAGCCCAGGACCTGG + Intergenic
904784431 1:32974270-32974292 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
904802008 1:33099618-33099640 CCACTGCCACGCCCCCCACCGGG + Intronic
905166960 1:36088543-36088565 CCACCCCCAAGCCCTCCCACCGG - Intergenic
905268513 1:36771403-36771425 CCACCCCCCACCCCCCAGCTGGG - Intergenic
905797852 1:40825574-40825596 CCTCCCTCCAGCCCCAGACCTGG - Intronic
905870546 1:41401703-41401725 CCACCCCACCACCCCACACCTGG + Intergenic
906238885 1:44229417-44229439 CCCCCACCCAGCCTGCCACCAGG - Intronic
906525388 1:46490490-46490512 CCCCTCCCCAGCCCCCGCCCAGG - Intergenic
906761509 1:48382633-48382655 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
907216605 1:52869965-52869987 CCCCCCCCCACCCCCCTCCCGGG + Intronic
907309460 1:53530951-53530973 CCAACACCCAGCACCACACCTGG - Intronic
907547414 1:55274392-55274414 CCACCCCAAGGTCCCCCACCAGG - Intergenic
907819076 1:57949160-57949182 CATCCCCCCAGCCCCCCCCATGG - Intronic
907898305 1:58713976-58713998 CCACCTCCCTGGCCTCCACCAGG - Intergenic
909003069 1:70242369-70242391 CCACACCCCACACCCCCACCAGG + Intronic
909181100 1:72425125-72425147 CTAGCCCCCAACCCCCCAACAGG + Intergenic
909230379 1:73081784-73081806 CCAGCCCCCATCCCCCCAACAGG + Intergenic
910055568 1:83029529-83029551 CTAGCCCCCCGCTCCCCACCAGG - Intergenic
910427654 1:87132459-87132481 CCGCCCCCCAGCCCGCCTCCAGG - Intronic
910657351 1:89632782-89632804 CCACCCCTGAGACGCCCACCTGG - Intergenic
910861162 1:91743476-91743498 CCACCACCCAGCCCCACTCTAGG + Intronic
911364161 1:96916409-96916431 CCTGCCCCCAACCCCCCAACAGG - Intergenic
911413434 1:97540318-97540340 CCACCCCCCACCCCCCACCCCGG - Intronic
911926511 1:103838775-103838797 CCCTCCCCCAGCCCCCCAACAGG - Intergenic
911945879 1:104108273-104108295 CCACCCCCATGACCTCCACCTGG - Intergenic
912161984 1:106996557-106996579 CCACCCCCCAACCCCACAATAGG + Intergenic
912429345 1:109620892-109620914 CCCCCTCCCCGCCCCCCGCCAGG + Exonic
912574880 1:110659919-110659941 CCAGCCCCCCACCCCCCAACAGG - Intergenic
912608173 1:111014325-111014347 ACCCTCCCCAGCCCCCCAACAGG - Intergenic
913477575 1:119253106-119253128 CCACCCCCCACCCCCACCTCAGG - Intergenic
913505499 1:119513067-119513089 TCTCTCCCCAGCCCTCCACCAGG + Intronic
913511981 1:119570473-119570495 CCTCTCCCCAGTCCTCCACCAGG + Intergenic
913516204 1:119607636-119607658 CCTCTCCCCAGTCCTCCACCAGG + Intergenic
914195642 1:145446734-145446756 CCACCCGCCACCGCCCCACCTGG + Intergenic
914231378 1:145766788-145766810 CCCCCCCCCCCCCCCCCCCCCGG - Intronic
914467998 1:147949366-147949388 CCCCCGCCCAGCCAGCCACCCGG - Intronic
914490242 1:148146971-148146993 CCGCCCCCCGGCCCCCCGCCTGG - Intronic
914673450 1:149889447-149889469 CCACCCCGCCCCCACCCACCCGG + Intronic
914678739 1:149923909-149923931 CCACCGCCCCGACCACCACCTGG - Exonic
914888256 1:151600965-151600987 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
915081805 1:153357721-153357743 CCCCGCCCCAGCCCCCTTCCTGG + Intergenic
915135593 1:153728848-153728870 CCACCCCCCGTCCTCCCACCCGG - Intronic
915460236 1:156066118-156066140 CCACCACCCAGCAGCCCCCCAGG - Intronic
915473645 1:156139884-156139906 CCTCCTCCCAGCACCCCACTTGG - Exonic
915528049 1:156488162-156488184 CCAACCCCCTGCCACCCACAAGG - Intronic
915556766 1:156665153-156665175 GCAACCTCCGGCCCCCCACCCGG + Intergenic
915709143 1:157877375-157877397 CCAGCCCCCCACCCCCCAACAGG - Intronic
915727185 1:158026031-158026053 CCCCCTCCCACCACCCCACCAGG - Intronic
916088532 1:161289059-161289081 CCACCCCCCCAACCCCCACCAGG - Intergenic
916108654 1:161447944-161447966 CCACTCCTCCGCCTCCCACCGGG + Intergenic
916110242 1:161455325-161455347 CCACTCCTCCGCCTCCCACCGGG + Intergenic
916111827 1:161462735-161462757 CCACTCCTCCGCCTCCCACCGGG + Intergenic
916113414 1:161470116-161470138 CCACTCCTCCGCCTCCCACCGGG + Intergenic
916115313 1:161480807-161480829 CTCTCCCCCACCCCCCCACCTGG + Intergenic
916491907 1:165309389-165309411 CTGCCCTCCAGCCCCCCACCAGG - Intronic
916668602 1:166990178-166990200 CCACCCCCCACCCCCCGCCAAGG - Intronic
917009200 1:170451887-170451909 CTAGCCCCCCGCCCCCCAACAGG + Intergenic
917042140 1:170816755-170816777 CTAGCCCCCAACCCCCCAACAGG - Intergenic
917230284 1:172829351-172829373 CTAGCCCCCAACCCCCCAACAGG + Intergenic
917436165 1:175023492-175023514 CCACCTCCCAGCTCCGCCCCAGG - Intergenic
917631614 1:176896501-176896523 CCCTCCTCCAGCCCCTCACCAGG + Intronic
917729541 1:177861079-177861101 CTAGCCCCCAACCCCCCAACAGG - Intergenic
918088505 1:181266120-181266142 CCACCCCCCCACCCCTCAACAGG + Intergenic
918178132 1:182062855-182062877 CCACCCCGCACTCCCCCAACTGG + Intergenic
918215994 1:182392115-182392137 CCGCCCCACGGCCCCCAACCCGG + Exonic
918780219 1:188690462-188690484 CCTCCCCCCACCCCCCCGGCAGG + Intergenic
918988951 1:191672419-191672441 CTACCCCCAACCCCACCACCTGG + Intergenic
919567495 1:199207111-199207133 CCACCCCCCACCCCACGCCCCGG - Intergenic
919609971 1:199733054-199733076 CCATCCCCCCGCCCCACAACAGG - Intergenic
919639437 1:200034596-200034618 CTACCCCCCACCCACCCCCCCGG - Intronic
919852236 1:201680771-201680793 GCACCCTCCAGACCCCCACTGGG - Intronic
919865922 1:201782822-201782844 CCACCCCACAGCCACCAAGCTGG + Exonic
919922161 1:202172255-202172277 CAGTCCCCCAGCCCACCACCTGG - Intergenic
920251408 1:204624746-204624768 TCCCCCCCCACCCCCCCCCCCGG + Intronic
920338462 1:205260229-205260251 CCAGCCACCAGCACCACACCTGG - Intronic
920496206 1:206456721-206456743 CCACCGCTCACCCACCCACCAGG - Intronic
920919731 1:210288596-210288618 CCCCACCCCAGCCACCAACCTGG - Intergenic
921060662 1:211581378-211581400 CCCGCCCCCAACCACCCACCAGG - Intergenic
921140271 1:212299050-212299072 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
921168519 1:212525239-212525261 CCATCCCCCTTCCTCCCACCTGG - Intergenic
921358203 1:214306222-214306244 CCACCCTCCAGCCCCATCCCCGG + Intronic
921390295 1:214608242-214608264 CCGCCCCCCGGCCCCCGGCCTGG + Intronic
921881566 1:220260588-220260610 CCTCCCCCCACCACCCCAACAGG - Intronic
922212493 1:223496618-223496640 CCACACCCCACCCACCTACCAGG + Intergenic
922524542 1:226289833-226289855 CCCCCCCCCACCCCCCCCCCCGG - Intronic
922572740 1:226643478-226643500 CCGCCCGCCTGCCCTCCACCTGG + Intronic
922680130 1:227587980-227588002 CCTCCCCCCAGCCCCCCAACAGG + Intronic
922741627 1:228017266-228017288 CCACCACCCAGCCCCTTACCTGG - Intronic
922776274 1:228215552-228215574 CCGCCCCACAGCCCCCAAGCTGG + Exonic
923291171 1:232547564-232547586 CCCCCACCCAGCCCCCACCCCGG - Intronic
924322760 1:242866022-242866044 TCCTCCCCCAGCCCCACACCTGG + Intergenic
924436577 1:244048636-244048658 CCCGCCCCCGCCCCCCCACCCGG + Intergenic
924864913 1:247968492-247968514 CCAGCCCCCCACCCCCCAACAGG + Intronic
924957628 1:248944755-248944777 CCACCCCCGCGCTCCCCGCCCGG + Intergenic
1062890556 10:1056726-1056748 CCACACCTCCGCCCCACACCCGG - Intronic
1062944876 10:1452644-1452666 CTATCCCCCAACCCCCCAACAGG - Intronic
1063099176 10:2934779-2934801 CTACACTCCAGCCCCCCAACCGG - Intergenic
1063435016 10:6022442-6022464 CCCACCCACAGCCCCCAACCTGG + Intronic
1063449624 10:6142812-6142834 CCAGCTCCCAGCCCCCATCCTGG + Intergenic
1063546156 10:6984034-6984056 CCGTTCCCCAGCCCCCCAACAGG + Intergenic
1063583878 10:7333757-7333779 CCCCACCCCAGCTCCCCACAGGG + Intronic
1063968056 10:11362230-11362252 CCTCCCCCCAGGCCCCTTCCTGG - Intergenic
1064108333 10:12519396-12519418 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1064149885 10:12853856-12853878 CCATCCCCCAACCCCACAACAGG + Intergenic
1064425646 10:15226873-15226895 CCACCCCCCAGCTTCCCACCTGG + Intronic
1064585374 10:16834387-16834409 CCACCCCCCACTCCCACCCCAGG - Intronic
1065198338 10:23288462-23288484 TCACCCCCCAGCCCCCCAACAGG - Intronic
1065443260 10:25773168-25773190 CCACCCCCCCTCCTCACACCCGG - Intergenic
1065610463 10:27466834-27466856 CCACCCCCCCTCCTCACACCCGG + Intergenic
1065730499 10:28705626-28705648 CCAGACCCCACCCCGCCACCAGG - Intergenic
1066085393 10:31970038-31970060 CCCCCCCCCGGCCTCCCTCCCGG - Intergenic
1066085406 10:31970050-31970072 CCCCCCCCCCCCCCCCCCCCCGG - Intergenic
1066328221 10:34388076-34388098 CTATCTCCCAGCCCCCCATCAGG - Intronic
1066448168 10:35503083-35503105 GCACGCCCCACCCCCCCAACAGG + Intronic
1066963446 10:42241794-42241816 CCCCCCCCCCCCCCCCCCCCCGG + Intergenic
1066963448 10:42241795-42241817 CCCCCCCCCCCCCCCCCCCCGGG + Intergenic
1067091138 10:43266460-43266482 CCAGCCCCCACCCCCACGCCAGG + Intronic
1067295178 10:44971564-44971586 CGACCCCCATGCCCCCCACCAGG + Intronic
1067437930 10:46291972-46291994 CCCGCCCCCAGCCTCCCAGCAGG - Intronic
1067478235 10:46579772-46579794 CCACACCCCAGCTCCCCTCCTGG + Intronic
1067495129 10:46754823-46754845 CCCACCCCCAGCCCCTCAGCAGG + Intergenic
1067599525 10:47585573-47585595 CCCACCCCCAGCCCCTCAGCAGG - Intergenic
1067616504 10:47762015-47762037 CCACACCCCAGCTCCCCTCCTGG - Intergenic
1067694925 10:48527877-48527899 CCAGCCTCCAGCCCACCACCAGG + Intronic
1067772836 10:49139561-49139583 CCAGGCCCCAGAGCCCCACCTGG + Intergenic
1067815932 10:49476887-49476909 CCACCCCTCTGCCACCTACCTGG + Intronic
1067822297 10:49540694-49540716 CCACTCCCCACCCCCACCCCGGG + Intergenic
1068495871 10:57784822-57784844 CCCTCCCCCAGGCCCCCATCTGG - Intergenic
1068686251 10:59872774-59872796 CCTTCCCCCACCCCCCCATCTGG - Intronic
1069591778 10:69646384-69646406 CCAGCCCCCAGCCCCCAGCACGG - Intergenic
1070007721 10:72441398-72441420 CCAGCCCCCCACCCCCCAACAGG - Intronic
1070319266 10:75342655-75342677 CCTCCCCCCGCCCCACCACCGGG - Intergenic
1070768262 10:79068571-79068593 GCAGCCCCCAGCCCCCCTGCAGG - Intergenic
1070844826 10:79513371-79513393 CCACCCCCTTCTCCCCCACCAGG - Exonic
1070928978 10:80246940-80246962 CCACCCCCTTCTCCCCCACCAGG + Intergenic
1070951645 10:80436040-80436062 CCGCCCCCAACCCCCGCACCAGG - Exonic
1071651055 10:87393455-87393477 CCCACCCCCAGCCCCTCAGCAGG - Intergenic
1071848762 10:89547026-89547048 TCACCTCCCAACCCCCCAACAGG - Intronic
1071876805 10:89851237-89851259 CCCTCCCCTAGCCCCACACCCGG - Intergenic
1072117131 10:92376357-92376379 CCCCCCCCCAACCTCCCTCCCGG - Intergenic
1072486731 10:95863241-95863263 GCATCTCCCAGCCCCCCACAAGG + Intronic
1072602155 10:96941063-96941085 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1072637617 10:97187746-97187768 CCACACCCCTGCCCACCCCCTGG + Intronic
1072640267 10:97206358-97206380 CCACCCCCAAACCCCTCACCTGG - Intronic
1072656732 10:97334882-97334904 CCACGCCCCGGACCCCCTCCTGG - Intergenic
1072862562 10:99022040-99022062 CCTCCCCCCACCCCACAACCTGG + Intronic
1073009180 10:100346836-100346858 CCGCGCCCCAGCCCCAAACCGGG + Intergenic
1073019574 10:100431840-100431862 CCGCCCCCCCCCCCCCCACCCGG + Intergenic
1073125367 10:101145928-101145950 CCACCCCACACCCCACCACAAGG + Intergenic
1073232139 10:101981052-101981074 TCACCCCCCAACCCCCCAACAGG - Intronic
1073288555 10:102402384-102402406 CCTGCCCCCAGCCCCCTTCCCGG + Exonic
1073357583 10:102869621-102869643 CCAGCCCCCAGCCCCTTCCCTGG + Intronic
1073424903 10:103450432-103450454 CCACCCCCAAGCCCTACCCCAGG - Intronic
1074095104 10:110304747-110304769 CCCGCCCCCAGCCCCACACAAGG - Exonic
1074332312 10:112527186-112527208 TCACCCTCCAGCCACCCACCGGG - Intronic
1074890720 10:117734913-117734935 ACACCCCCCACCCCCCCGCACGG - Intergenic
1075074712 10:119343036-119343058 CCCTCCCCCAGCCCCACACTGGG - Intronic
1075600397 10:123763417-123763439 CCACCCTCCTGCCTCCCACTCGG + Intronic
1075615034 10:123884599-123884621 CCAGCCCACAGCCTCCCCCCGGG - Intronic
1075635688 10:124028899-124028921 ACACCCCCCAACCCCCCAGCTGG + Intronic
1075975120 10:126687909-126687931 ACACCCCCCACCCCGCCCCCAGG + Intergenic
1076148584 10:128144823-128144845 CCACTCCCCAACCCCACATCTGG - Intergenic
1076255005 10:129015646-129015668 CCAGCCCCCACCCCCCCGACAGG - Intergenic
1076353179 10:129832575-129832597 CCAGCCCCCAGCCTCCCAGTGGG - Intergenic
1076366291 10:129922748-129922770 TCAGCCCCCAGCCCCACATCAGG - Intronic
1076603863 10:131676999-131677021 CCTCCCCCCGGCCCCGCCCCAGG + Intergenic
1076727222 10:132419473-132419495 CCTCCTCCAGGCCCCCCACCAGG - Intergenic
1076802430 10:132836714-132836736 CCACACCTCAGCCCCACCCCAGG - Intronic
1076805793 10:132858286-132858308 CCACCTCCCTGCCCCCAACCTGG - Intronic
1076805815 10:132858341-132858363 CCACCGCCCTGCCTCCAACCTGG - Intronic
1076805838 10:132858396-132858418 CCACCGCCCTGCCTCCAACCTGG - Intronic
1076829287 10:132986004-132986026 CCACCCCCTGCACCCCCACCTGG - Intergenic
1076829913 10:132988991-132989013 GCACCCCCCCCCCCCCCACCGGG - Intergenic
1076963471 10:133786273-133786295 CCACCCCCGCGCTCCCCGCCCGG + Intergenic
1077155637 11:1089695-1089717 GCACCTCCCAGCCCCCGTCCCGG - Intergenic
1077224693 11:1434908-1434930 CCACACCCCTGAGCCCCACCTGG - Intronic
1077253421 11:1570765-1570787 CCAGGCCCCAGCCCTCCACCAGG - Intronic
1077285633 11:1764053-1764075 CCACCACCCCGCCCCCCGCCCGG - Intergenic
1077327582 11:1970428-1970450 CCAGCCCCCACCCCCACCCCGGG + Intronic
1077384306 11:2261798-2261820 CCAGCTCCCAGCACCCCACCGGG + Intergenic
1077419522 11:2444101-2444123 CCACCCCCCAGCAGCCCTGCCGG + Intergenic
1077459335 11:2700770-2700792 CCACCTCCCATCCCCCATCCGGG + Intronic
1077548696 11:3189393-3189415 CCACCCCCCACCCGCCTCCCTGG - Intergenic
1078166953 11:8895242-8895264 CCACCCCCCTACCCCACAACAGG - Intronic
1078256772 11:9664714-9664736 GCAGCCCACAGCCCCACACCAGG + Intronic
1078341145 11:10498718-10498740 CCACGCCCCAGACCCCAGCCAGG - Intronic
1078474537 11:11620130-11620152 TTACCCCCCACCCCCCCGCCAGG - Intronic
1078519803 11:12053732-12053754 CCACCCCCCACAGCCCCTCCAGG - Intergenic
1078794455 11:14578067-14578089 CTAGCCCCCAACCCCCCAACAGG - Intronic
1078867083 11:15307776-15307798 CCACCCCCCAACTCCACCCCAGG - Intergenic
1078891367 11:15561195-15561217 CCCCCTCCCCGCCCCCCGCCGGG + Intergenic
1079034943 11:17013573-17013595 CAACCCCGCAGGCCCACACCAGG + Intronic
1079070315 11:17339500-17339522 CCTCCCCCCACCCCCACAACAGG + Intronic
1079132673 11:17756733-17756755 ACACACCCCCGCCCCCCAACTGG - Intronic
1079223136 11:18582335-18582357 CCACCACCCACCCCCACTCCCGG + Intronic
1079251977 11:18793167-18793189 CCACCCCCCCGCCCCCGAGACGG + Intergenic
1079424166 11:20324592-20324614 CTAGCCCCCAACCCCCCAACAGG + Intergenic
1079444967 11:20548858-20548880 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1080036507 11:27718352-27718374 CCACCCCCCCCCGCCCCTCCCGG + Intronic
1080200551 11:29664537-29664559 CTAGCCCCCAACCCCCCAACAGG - Intergenic
1080230814 11:30016670-30016692 CCACCCCCCGCCCCCCACCCAGG - Exonic
1080249764 11:30219844-30219866 CTAGCCCCCAACCCCCCAACAGG + Intergenic
1080561458 11:33466962-33466984 CCAACCCCCCACCCCCCAACAGG - Intergenic
1081173919 11:39902425-39902447 CTAGCCCCCAACCCCCCAACAGG - Intergenic
1081305093 11:41502011-41502033 GCTCCCCGCAACCCCCCACCAGG - Intergenic
1081401861 11:42653145-42653167 CGCCCCCCCACCCCACCACCAGG + Intergenic
1081537311 11:44005208-44005230 CCTGCCCCCAGCCCCCTGCCTGG + Intergenic
1081705693 11:45180948-45180970 TCAGCCCCCTGCTCCCCACCGGG - Intronic
1081808859 11:45904254-45904276 CTTCCACTCAGCCCCCCACCTGG - Intronic
1081952718 11:47059186-47059208 TCACCCCCCAGCCCCCCAACAGG - Intronic
1081993944 11:47351944-47351966 CCATCCCCCAGCGCCCTCCCAGG - Intronic
1082786779 11:57321746-57321768 CCACCCCCCTCCCAGCCACCTGG + Intronic
1083173586 11:60936498-60936520 CCTCCCCCCAGCCCCACAACTGG + Exonic
1083212649 11:61198233-61198255 CCACTCCCCAGTCCCAGACCTGG - Intergenic
1083215594 11:61217396-61217418 CCACTCCCCAGTCCCAGACCTGG - Intergenic
1083218478 11:61236225-61236247 CCACTCCCCAGTCCCAGACCTGG - Intergenic
1083615020 11:64021932-64021954 ACACCCCCCCCCCCCCCCCCCGG - Intronic
1083661330 11:64252805-64252827 GCACCCCCCACCCCACCCCCAGG - Intronic
1083684019 11:64365424-64365446 CCCCCTGGCAGCCCCCCACCTGG + Exonic
1083764826 11:64836703-64836725 CCACCCCCCCCCCCCCCCCAGGG - Intronic
1083765125 11:64838040-64838062 GCAACCCCGAGCCTCCCACCAGG + Intronic
1083818433 11:65151207-65151229 CCAGCACCCAGCCCTGCACCTGG - Intergenic
1083896774 11:65624061-65624083 CCACCCCCATCACCCCCACCTGG + Intronic
1083941814 11:65900114-65900136 CCTCGCCCCAGCCCCCAGCCCGG + Intronic
1084208450 11:67609551-67609573 CCATGGCCCGGCCCCCCACCAGG - Exonic
1084332835 11:68439814-68439836 CCCCGCCCCGGCCCCCCATCAGG - Exonic
1084333578 11:68444568-68444590 CCACCCCCCACCCCCCACCCTGG + Intronic
1084412653 11:69013379-69013401 GCCCCCCCCAGAGCCCCACCGGG + Exonic
1084433972 11:69127247-69127269 CCCCCCCCCACCCACCCACCCGG - Intergenic
1084603226 11:70158840-70158862 CCAGCCCCCAGCCCCCACCGAGG - Intronic
1084694147 11:70743987-70744009 CAAGCCCTCAGCCCCACACCTGG + Intronic
1084795439 11:71501884-71501906 CCACGCCCCTGCCCCACACCTGG - Intronic
1085051924 11:73384335-73384357 CCACCCTCCAGATTCCCACCAGG + Intronic
1085266532 11:75240969-75240991 CCCCACCCGTGCCCCCCACCAGG + Exonic
1085453003 11:76648201-76648223 CCACCCCTCATGCCACCACCAGG + Intergenic
1085496181 11:76971898-76971920 CCACCCCCCACCCCTTCATCTGG - Intronic
1086293704 11:85340482-85340504 CCAGCCCCCACCCGCCCAACAGG - Intronic
1086822039 11:91446385-91446407 CCACCCCCCAACTCGTCACCAGG + Intergenic
1086827700 11:91519449-91519471 CCGCCCCCCACCCCCCTGCCAGG - Intergenic
1086860425 11:91918836-91918858 CCTCCCCCCAACCCCACAACAGG - Intergenic
1087180455 11:95136754-95136776 CCAGCCCCCACCCCCACAACAGG + Intergenic
1087311670 11:96551006-96551028 CCAGCCCCCTACCCCCCAACAGG - Intergenic
1087719818 11:101650255-101650277 CCACCCCCCACCCCTCCGACAGG - Intronic
1087780506 11:102296787-102296809 CCACCCCCCAGTCCCCCGACAGG + Intergenic
1088254709 11:107892307-107892329 ACACCCCCCACCCCCACCCCTGG + Intronic
1088410162 11:109525365-109525387 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1088779867 11:113123751-113123773 CCACCCCTCAGCTCCGCTCCTGG + Intronic
1088905922 11:114155457-114155479 CCAACTCCCAACCCCCAACCCGG - Intronic
1089123929 11:116162765-116162787 CCAGCCCCCAGCCCCCAGCCCGG + Intergenic
1089294294 11:117458684-117458706 CTAACCCCCAGCCCCACCCCAGG - Intronic
1089338901 11:117744579-117744601 ACACCCCCCAGCCACAGACCTGG - Intronic
1089346946 11:117796890-117796912 CCTCCCCGCTGCGCCCCACCCGG + Intronic
1089359656 11:117877268-117877290 CATCCCCCCAGCTCCCCACCTGG - Intronic
1089540413 11:119186344-119186366 CCACCACCCAACACCCAACCAGG + Intronic
1089556110 11:119316747-119316769 CCACCCCCCAGCACCCCGAAAGG + Intronic
1089780393 11:120869637-120869659 CCTCCCACCAGGCCCCCAGCTGG - Intronic
1089935130 11:122356872-122356894 CCCTCCCCCCTCCCCCCACCAGG + Intergenic
1090352179 11:126114679-126114701 CCACCCACCACCTCCCCAGCTGG + Intergenic
1090554819 11:127862924-127862946 CCAGCCCCCAACCCCCCAGCAGG + Intergenic
1090656489 11:128849898-128849920 CCGCCCGCCAACCCACCACCTGG + Intronic
1090829113 11:130408691-130408713 CCACACCCCCGCCCCCCGGCAGG - Intronic
1202810564 11_KI270721v1_random:25608-25630 CCAGCCCCCACCCCCACCCCGGG + Intergenic
1091373374 12:11185-11207 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
1091478964 12:807105-807127 CAACCCCCCACCCCGCCACAAGG - Intronic
1091782497 12:3222813-3222835 CCACCCCCCAGGTCCCACCCTGG + Intronic
1091858146 12:3755513-3755535 CCACCCCCCACTCCCACCCCTGG - Intronic
1092046164 12:5432959-5432981 CCTCCCCCCAGCCCACGCCCGGG - Intronic
1092097354 12:5853887-5853909 CCACCCCCCACCCCCCACCCCGG + Intronic
1092135392 12:6143528-6143550 CCCCCCCCCCCCCCCCCAGCTGG + Intergenic
1092286561 12:7132068-7132090 CTTCCCCACAGCCCCTCACCAGG + Intronic
1092317325 12:7431601-7431623 CCAGCCCCCCACCCCCCAACGGG - Intronic
1093402813 12:18766833-18766855 CTAGCCCCCCACCCCCCACCAGG - Intergenic
1094034813 12:26057276-26057298 CCATCCCCCCGCCCCACAACAGG + Intronic
1094317640 12:29149935-29149957 CCAGCCCCCAGCCCCACCCCAGG + Intronic
1094375438 12:29783838-29783860 CCATGCCCGAGCCCCCCTCCGGG - Intronic
1094470091 12:30795455-30795477 CAACCCCCCAGACCACCACCCGG - Intergenic
1095178184 12:39117438-39117460 GCAACCCCCAACCCCCAACCAGG + Intergenic
1095222689 12:39635636-39635658 CCAGCCCCCCGCCCACCAACAGG - Intronic
1095606871 12:44078860-44078882 GCACCCCCCCACCCCCCAACAGG + Intronic
1095784648 12:46096046-46096068 CCACCCCCTGACCCCCCAACAGG - Intergenic
1095884799 12:47177602-47177624 CCACCCCCCACCCCACCACCAGG - Intronic
1096156261 12:49342958-49342980 CCACCCCTCTGCCTCCCGCCGGG - Intergenic
1096191688 12:49623742-49623764 CCCGCCCCCATCCCCCCTCCCGG - Intronic
1096406167 12:51345925-51345947 CCACCCCCCACCCCTACCCCTGG - Intronic
1096558370 12:52418306-52418328 CCAGCCCCCAGCCCCCCTGTTGG + Intergenic
1096660818 12:53122999-53123021 CCCACCTCCAGCCCCCCGCCCGG - Intronic
1096743201 12:53709516-53709538 AAGCCCCCCAACCCCCCACCAGG - Intronic
1096773013 12:53948334-53948356 CCACCCCCCTGCCCCCGACCGGG - Intergenic
1096921804 12:55095293-55095315 CCACCCCCCCACCCCACAACAGG - Intergenic
1097135099 12:56846315-56846337 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1097169441 12:57104707-57104729 GCACCCCAAAGCCCCTCACCAGG + Exonic
1097194224 12:57235000-57235022 ACCCCCTCCAGCCCCACACCTGG - Exonic
1097211078 12:57370395-57370417 CCACCCCGCCCCCCCCCCCCGGG - Intronic
1097221196 12:57452243-57452265 CTATCCCCCAGCCCCCAACCAGG + Intergenic
1097222647 12:57460069-57460091 CCACCCCCACCCCCCCAACCTGG - Intergenic
1097246931 12:57611863-57611885 GCCCCCCCGCGCCCCCCACCCGG - Intronic
1097250821 12:57631609-57631631 CCACCAACCAGGACCCCACCTGG + Intronic
1097265175 12:57740200-57740222 CCCACCCTCAGCCCCCCACCAGG - Intronic
1097679826 12:62637979-62638001 CCCCCCCCCCGCCCCCAACCAGG - Intergenic
1098201292 12:68058666-68058688 CCTCTCCCCAGCCCTCCAGCAGG + Intergenic
1098412687 12:70202112-70202134 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1098413011 12:70202827-70202849 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1099048011 12:77747876-77747898 CCATCCCCCAACCCCACAACAGG - Intergenic
1099100961 12:78439747-78439769 TCACCCTCCATCCCCCCAACAGG - Intergenic
1099409726 12:82310638-82310660 CCAGCCCCCCGCCCCCCAACAGG + Intronic
1099973593 12:89524921-89524943 CCGGCCCCCAGCCCCCGGCCCGG - Intronic
1100076619 12:90792734-90792756 CTAGCCCCCAACCCCCCAACAGG + Intergenic
1100381904 12:94070244-94070266 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1100531690 12:95467336-95467358 CGACCCCCCACCCCCGCCCCTGG - Intergenic
1100570676 12:95841390-95841412 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1101780658 12:107832164-107832186 CCACCCCAGAGCACCCTACCTGG + Intergenic
1102006984 12:109595415-109595437 CCACAGCCCAGCCCTGCACCAGG - Intronic
1102020524 12:109679029-109679051 CCCACCCCTAGTCCCCCACCAGG - Intergenic
1102068701 12:109999781-109999803 CCCCCGCCCCGCCCCTCACCTGG - Exonic
1102253794 12:111405133-111405155 CCACCCCCCTGCCCGCCCCCGGG - Intergenic
1102773559 12:115499500-115499522 CCACCCTCCAGCCTGCCACCTGG - Intergenic
1102896653 12:116603622-116603644 CCACCCCCCAACCCCTGCCCCGG - Intergenic
1102990362 12:117311387-117311409 CCTCCCCTCAGCTTCCCACCTGG + Intronic
1103149800 12:118627158-118627180 CCACCACCCATCCACCCACCTGG - Intergenic
1103201104 12:119088660-119088682 CCACCCCCACGCCCCCCAAAAGG - Intronic
1103212094 12:119174677-119174699 CCAGCCCCCAGCCCCTCCCCAGG - Intergenic
1103273922 12:119696107-119696129 CCTCTCCCCAGGTCCCCACCTGG - Intronic
1103410699 12:120710015-120710037 CCACCCCTAGGCCCTCCACCTGG + Intergenic
1103592798 12:122004221-122004243 CCCCACCCCAGCCCCACAACAGG - Intergenic
1103595537 12:122022495-122022517 CCGGCCCCGAGCCCCCCTCCCGG - Intronic
1103607623 12:122098834-122098856 CCTCCTCCCAGCCCACCCCCAGG - Intronic
1103720748 12:122974150-122974172 CGGCTCCCCAGCCACCCACCAGG - Intronic
1103729789 12:123019883-123019905 CCACCTCCCAGCTCCCCTGCAGG - Intronic
1103746058 12:123124711-123124733 CCCTCCCCCATCCCCCAACCCGG + Intronic
1103761366 12:123252635-123252657 CCACCCCCCACCCCCACCCAGGG - Intronic
1103764847 12:123272358-123272380 CCACCCCTCACCCCCCTCCCCGG + Intergenic
1103910216 12:124348115-124348137 CCATCCCCCCACCGCCCACCAGG + Intronic
1104406463 12:128521452-128521474 CCAGCCCCCCACCCCCCAACAGG + Intronic
1104656169 12:130575213-130575235 ACACCCCCCACCCCCACCCCCGG + Intronic
1104873135 12:132014909-132014931 CCACACCCCACCCCCCGTCCTGG + Intronic
1104924906 12:132309004-132309026 CCGCCCCTCTGCCCCCAACCAGG + Intronic
1104939853 12:132389999-132390021 CCCCGCCCCCGCCCCCCACCTGG + Intergenic
1104978894 12:132564205-132564227 CTTCACCCCAGCCCCACACCAGG + Intronic
1105506019 13:21010371-21010393 CAAACCCCCAGTCCTCCACCTGG + Intronic
1105520227 13:21124745-21124767 CCCCCCCCCCGCCCCCCGACAGG + Intergenic
1105698617 13:22915879-22915901 CCTGCCCGCAGCCCACCACCAGG + Intergenic
1105845097 13:24287027-24287049 CCACCCCCCGCCCCCCCATCAGG + Intronic
1106349112 13:28910537-28910559 CCTCCCCCCAGCCCCCCAGCAGG + Intronic
1106587536 13:31070255-31070277 CCACTCACCAGCCCCACCCCTGG + Intergenic
1107669160 13:42725916-42725938 CCAGCACCCAGCACCCTACCTGG + Intergenic
1107691192 13:42955263-42955285 CGACCCCCCAGTCCCCACCCTGG - Intronic
1108011262 13:46014351-46014373 TCACCCCCCATCCCCACAACAGG + Intronic
1108188616 13:47913942-47913964 CCAGCCCCCAGCCCCCCAACAGG - Intergenic
1108341755 13:49504465-49504487 ATACTCCCCAGCCCCCCGCCCGG + Intronic
1109301130 13:60591350-60591372 CCACCCCCCACCCACCCCACCGG + Intergenic
1109308317 13:60663885-60663907 CCACCCCACTGCCCTTCACCAGG + Intergenic
1110071823 13:71187120-71187142 CCATCCCCCGACCCCCCAACAGG - Intergenic
1111300291 13:86341087-86341109 CCACCACCCACCACCCCACTGGG + Intergenic
1111615697 13:90659085-90659107 CCACCCCCTAGCCCTGCCCCTGG - Intergenic
1111842043 13:93461658-93461680 CCCCCCCCAACCCCCCCGCCGGG - Intronic
1111842045 13:93461659-93461681 CCCCCCCCCAACCCCCCCGCCGG - Intronic
1112155763 13:96815411-96815433 CCACCCCACTGCCCCATACCTGG - Intronic
1112171042 13:96971881-96971903 GCTCCCCCCAGCCACCCACCAGG - Intergenic
1112357069 13:98682444-98682466 CCACCCCCAACCCCTCCACCTGG - Intergenic
1112523216 13:100117616-100117638 CCATCCCCCAACCCCACAACAGG - Intronic
1113286254 13:108852219-108852241 TCTCCCCCCAGCCCCCCAGTAGG + Intronic
1113479463 13:110610006-110610028 CCCCCCCCCCCCCCCCCCCCCGG + Intergenic
1113849092 13:113407876-113407898 GCACCCACGAGGCCCCCACCCGG + Intergenic
1113884960 13:113653659-113653681 CCACCCCCCACCCCCCACCATGG - Intronic
1113966899 13:114157821-114157843 CCTCCCCCCAACCCCACAACAGG - Intergenic
1113989906 13:114353114-114353136 CCACCCCCGCGCTCCCCGCCCGG + Intergenic
1114215253 14:20653409-20653431 CTACCCCCACGCCCCCTACCCGG - Intergenic
1114318189 14:21525827-21525849 CCACCCCCCTGCCCCATGCCGGG - Intronic
1114396507 14:22367619-22367641 CCAGCCCCCAACCCCCCGACAGG - Intergenic
1114485908 14:23061523-23061545 GCACCCCCCACCCCCACCCCCGG - Exonic
1114620665 14:24094379-24094401 CCACCCCGCAGCCCCTGCCCAGG + Exonic
1114642402 14:24232393-24232415 CCCCCCCCCCCCCCCCCACTGGG + Exonic
1114670649 14:24409094-24409116 TCTCCTCCCAGCCCCCCATCTGG - Exonic
1114683121 14:24503724-24503746 CCCCCCCCCAACCCCACAACAGG - Intronic
1114806784 14:25846881-25846903 CCATTCCCCAGCCCCTCAGCAGG + Intergenic
1115035435 14:28851206-28851228 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1115671893 14:35622357-35622379 CCAGCCCCCAATCCCCCAACAGG - Intronic
1115703398 14:35977070-35977092 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1115703470 14:35977238-35977260 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1115740650 14:36384263-36384285 CCAACTCCCAGCCCCACACTCGG + Intergenic
1115755700 14:36524631-36524653 CCACCCCCCAGCCTGCCCACAGG - Intergenic
1115798216 14:36962491-36962513 CCACCCCATAGCCCCACCCCTGG + Intronic
1115955078 14:38768678-38768700 CCTCCCCCCAACCCCACAACAGG - Intergenic
1116373831 14:44171871-44171893 CCTCCCCCCACCCCCCCGACAGG + Intergenic
1116898712 14:50341443-50341465 CCCCCCCCCAGACCCTCCCCAGG - Intronic
1117980801 14:61340363-61340385 CCACCCCGCCCCCTCCCACCTGG - Intronic
1118329337 14:64803588-64803610 CTACCCCCCAGGAACCCACCTGG + Exonic
1118341171 14:64895695-64895717 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1118569059 14:67174228-67174250 CCACCCCACAACCCCCCGACAGG + Intronic
1119328826 14:73778733-73778755 CCCTCTCCCAGCCCCACACCAGG + Intronic
1119382754 14:74239500-74239522 GCTCCCCCCACCCCCCCGCCGGG - Exonic
1119428532 14:74551252-74551274 CCTCCACCCCGCCCCGCACCTGG + Exonic
1119856828 14:77907436-77907458 CCTCTCCCCATCCCGCCACCAGG - Intronic
1120483131 14:85077500-85077522 CCTCTCCCCATCCCCCCAACAGG + Intergenic
1120797344 14:88649033-88649055 CCACCCCCCACCCCCGAAACAGG + Intronic
1120917685 14:89724013-89724035 CCACCCCCAAGCCCCAAACCAGG + Intergenic
1121524409 14:94609321-94609343 CCAGCCCCCAACCCCCCAACAGG - Intronic
1121538885 14:94710689-94710711 CTACCCCCCACCCGCCCACCAGG + Intergenic
1121818370 14:96945227-96945249 CCACCCTCCAGCCACACCCCGGG + Intergenic
1121863459 14:97340618-97340640 CCACCCCCAAGCCACTCACCTGG - Intergenic
1122112275 14:99510714-99510736 CCCCCGCCCATTCCCCCACCCGG + Exonic
1122112298 14:99510744-99510766 GCCCGCCCCAGCCCCCCAACTGG - Exonic
1122179275 14:99943765-99943787 CCACCCATCAGCCCCCGGCCTGG - Intergenic
1122270521 14:100566883-100566905 CCTGCCCCCAGGCTCCCACCTGG + Intronic
1122289630 14:100673352-100673374 CCAACCCCCAACCCCCGGCCAGG - Intergenic
1122366193 14:101196159-101196181 CCACCCCACTGCCCACCCCCTGG + Intergenic
1122413478 14:101537707-101537729 CCACACCCCAGCCCCACTCAGGG - Intergenic
1122452509 14:101821430-101821452 CCACCCACCCACCCCCCACAGGG - Intronic
1122556634 14:102584068-102584090 CCACCCCCCACCCCCACCCCCGG - Intergenic
1122610337 14:102978028-102978050 CCACCCACTAGCCCGCCCCCAGG + Intronic
1122649904 14:103220585-103220607 CCCCACCCCAGCCCCGCCCCCGG - Intergenic
1122664503 14:103319249-103319271 CCACCCACCTGCCCCCTCCCGGG + Intergenic
1122789182 14:104177190-104177212 CCACCCTCCAGCCCCACACACGG + Exonic
1122900585 14:104780720-104780742 CCGCCCCGCCGCCACCCACCAGG + Intronic
1122922127 14:104884575-104884597 CCACCCCCCCGTTCCCCACGAGG - Intronic
1122922200 14:104884780-104884802 CCACCCCCCCGTTCCCCACGAGG - Intronic
1122922219 14:104884832-104884854 CCACCCCCCCGTTCCCCACGAGG - Intronic
1122959605 14:105088346-105088368 CCCGCCCCCAGCCCTCCGCCCGG - Intergenic
1122979682 14:105185875-105185897 CCACCCCCCGCACCCCCACCTGG - Intergenic
1122985703 14:105210704-105210726 CCAGCCCCCCGCGCCCCGCCAGG + Intronic
1123204026 14:106694765-106694787 CCCCCCCCCCCCCCCCCCCCCGG + Intergenic
1123448353 15:20345333-20345355 CAACCCCCCCCACCCCCACCTGG + Intergenic
1123670105 15:22647881-22647903 CTTCCCCCCAGCCCCCCAGTAGG - Intergenic
1124341076 15:28889380-28889402 GTACCCCACAGCCCCCAACCTGG - Intronic
1124385811 15:29207443-29207465 CACCCCCCCCGCCCCCCAACCGG - Intronic
1124637966 15:31376959-31376981 CCACCCCCCACCCCCCTCCCCGG - Exonic
1124798343 15:32804658-32804680 CCAGCCCCCCACCCCCCAACAGG + Intronic
1125538224 15:40454951-40454973 CCTCCACCCAGCCCCACCCCAGG + Intronic
1125848027 15:42875986-42876008 CCAACCCCCAACCCCCAACCTGG - Intronic
1126237252 15:46400475-46400497 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1126698065 15:51342082-51342104 CACACCCCCAGCCGCCCACCTGG - Intronic
1126994817 15:54428942-54428964 CTTCCCCCCAGCCCCCAATCGGG + Intronic
1127004138 15:54546319-54546341 CCCTCACCCAGCCCTCCACCCGG - Intronic
1127359109 15:58229398-58229420 CCGCCCCCCACCCCCCTCCCTGG - Intronic
1127584328 15:60366790-60366812 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1127686198 15:61347400-61347422 CCAGCCCCCCGCCCGCCAACAGG - Intergenic
1127765044 15:62177413-62177435 CCTCCCCCCACCCCCCCGACAGG - Intergenic
1127927874 15:63564921-63564943 CCACCTCCCTGCCTCACACCTGG - Intronic
1128160811 15:65422009-65422031 CCACCCCCCAGGGACCGACCAGG - Intronic
1128182426 15:65615876-65615898 CCACCCCCCCACCCCCCAACAGG + Intronic
1128404141 15:67317883-67317905 CCACCCCCAAGCCCTACACACGG + Intronic
1128455672 15:67830006-67830028 GCACCCCCCACCCCCGCGCCTGG - Intronic
1128523920 15:68395718-68395740 CCAGCCCCCCACCCCCCAACAGG - Intronic
1128553024 15:68610340-68610362 CCAGCCCCCAGCCCTTCACTAGG - Intronic
1128559571 15:68655779-68655801 CCATCCCCAAGCCCCTCAACAGG + Intronic
1128841180 15:70853215-70853237 CCCCCCCCCCGCCCCCCGCAAGG + Intronic
1128842113 15:70858858-70858880 CCACCACCCAGCCTCCACCCAGG - Intronic
1128934032 15:71730344-71730366 CCACCACCCTGCTCCCCATCAGG + Intronic
1129093247 15:73174363-73174385 CCAGCCCACAGCACCCCAGCAGG - Intronic
1129176582 15:73844550-73844572 ACACCCCCCAGCCCCACCACAGG + Intergenic
1129181623 15:73881622-73881644 CCACCTCCCACCCCCACCCCAGG + Exonic
1129208007 15:74048589-74048611 CCCCCCCCCCCCCCGCCACCCGG + Intergenic
1129321001 15:74774806-74774828 CCACCCCCCTCCCCCCACCCTGG - Intergenic
1129339245 15:74874026-74874048 CCCCGCCCCCGCCCCCCACAGGG + Intergenic
1129393882 15:75234035-75234057 CCACCCCCCAGTCCCCCGGGTGG - Intergenic
1129676553 15:77634898-77634920 CCCCGCCCCCGCCCCCCAGCGGG - Intronic
1129739892 15:77985098-77985120 CCACTCACCTGCCCACCACCTGG - Intronic
1129771962 15:78208307-78208329 CCCCCACCCAGCCTCCCTCCAGG + Intronic
1129845890 15:78767574-78767596 CCACTCACCTGCCCACCACCTGG + Exonic
1130048490 15:80464306-80464328 CCCACCCCCAGCCCCCAATCGGG - Intronic
1130243017 15:82214801-82214823 CCTCCCCCAAGTCCCCCACATGG - Exonic
1130457431 15:84126494-84126516 CCTCCCCCAAGTCCCCCACATGG + Intergenic
1130627077 15:85526696-85526718 ACACCCCCCATCCCCCAGCCTGG + Intronic
1130646999 15:85737302-85737324 CCATCCCCCATCCCACCCCCAGG + Intronic
1131046936 15:89322416-89322438 CCAGCTCCCAGCCCCCAACAGGG + Intronic
1131065181 15:89430141-89430163 TCACACCCCACCTCCCCACCAGG + Intergenic
1131205040 15:90437278-90437300 CCTCTCACCAGGCCCCCACCTGG + Intronic
1131293587 15:91128408-91128430 CCACCCCGCAAACCCTCACCTGG + Intronic
1131514415 15:93067644-93067666 CCACCCCACCACACCCCACCTGG - Intronic
1132150038 15:99452742-99452764 CCACCTCCCACCTCACCACCTGG + Intergenic
1132150226 15:99453719-99453741 ACACTCCCCAGCCCCACTCCAGG + Intergenic
1132243278 15:100276430-100276452 CCCCCTCCCACCCTCCCACCAGG - Intronic
1132372354 15:101307640-101307662 CCAGCCCCCACCCCACCACACGG + Intronic
1132549216 16:547471-547493 CAACCCCCCAGCCACCAGCCAGG + Exonic
1132558907 16:584656-584678 CCTCCCCCCAGCTGCCCACCTGG + Intergenic
1132558993 16:584899-584921 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559013 16:584951-584973 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559033 16:585003-585025 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559053 16:585055-585077 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559073 16:585107-585129 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559093 16:585159-585181 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559113 16:585211-585233 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559133 16:585263-585285 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132559153 16:585315-585337 GCTCCCCCCAGCTGCCCACCGGG + Intergenic
1132579244 16:677572-677594 CCCTCCCCACGCCCCCCACCGGG - Intronic
1132604874 16:789430-789452 CCACCCCCCAGGCCTCATCCAGG - Intronic
1132631503 16:919860-919882 CCACCCCACAGCTCCGCCCCGGG + Intronic
1132671201 16:1102902-1102924 CCCCCCCCCGGCCCCCCTCCCGG + Intergenic
1132696395 16:1204057-1204079 CCCCTGCCCAGCCCCCCAGCGGG + Exonic
1132726765 16:1342280-1342302 CCACCCCACACCCACTCACCCGG - Exonic
1132762899 16:1519634-1519656 CCTCCTCCCACTCCCCCACCAGG + Intronic
1132809395 16:1790360-1790382 CGAGCCCCCAGCCCCCTCCCTGG + Intronic
1132862084 16:2076739-2076761 ACACCCCTCAGCCCCTCAGCAGG + Intronic
1132882398 16:2168206-2168228 CCTCCCCCCATCCTCCCTCCTGG + Intronic
1132887742 16:2189902-2189924 CCTCACCCCAGCCCCACCCCTGG + Intronic
1132926589 16:2432899-2432921 CCACCCAAAAGCCCCACACCTGG - Intronic
1132947088 16:2537816-2537838 CCGCCCGCCAGGCCCCAACCCGG + Intergenic
1132968604 16:2673587-2673609 CCGCCCGCCAGGCCCCAACCCGG - Intergenic
1132973724 16:2701358-2701380 CCACCTCCCAGCACCCCGCAGGG - Intronic
1133009712 16:2904450-2904472 CCACCCGCCTGACCCCCACCCGG + Intergenic
1133014706 16:2933983-2934005 CCAGCTCCCAGCCCACCCCCAGG - Intronic
1133032453 16:3017850-3017872 CCTCCCCCCTCCCCCTCACCTGG - Intronic
1133335821 16:5006119-5006141 CCACCTCCCAGCCCCACTCCGGG - Intronic
1133339182 16:5025706-5025728 CCACCCAGCAGTCCCCCACTTGG - Intronic
1133571478 16:7044849-7044871 CCACCTCCCCTCTCCCCACCCGG + Intronic
1133650190 16:7805504-7805526 CCACCCCCCCGCCCCCCTGAAGG - Intergenic
1133749340 16:8712644-8712666 CCAGCCCCCAGCCCCCAAATCGG - Intronic
1133801825 16:9091311-9091333 CCACCCCCCACCCGCCCCCTTGG + Intergenic
1134015177 16:10883208-10883230 CCACCCCCTACCCCAGCACCAGG + Intronic
1134584115 16:15396216-15396238 CCACCCCCCAGGTCCCCTCCCGG - Intronic
1134773538 16:16831944-16831966 CCCCACCCCACCCCCCCAACAGG + Intergenic
1135751596 16:25062699-25062721 CCACCCCCCACCCCCACCCCCGG - Intergenic
1136219999 16:28822939-28822961 CCCCCCCCCCCCCCCCCCCCCGG + Intergenic
1136220001 16:28822940-28822962 CCCCCCCCCCCCCCCCCCCCGGG + Intergenic
1136403416 16:30030497-30030519 CCACCCCCCCGGCCACCATCGGG + Exonic
1136566533 16:31073750-31073772 CCACCTCCCCGCCCCCCGCTGGG - Intronic
1136642979 16:31583183-31583205 CCTCCCCCCAGCCCCCCAACAGG + Intergenic
1136927689 16:34389314-34389336 CCACCCCGCAGCCTGCCTCCAGG + Intergenic
1136976885 16:35022492-35022514 CCACCCCGCAGCCTGCCTCCAGG - Exonic
1137357798 16:47783339-47783361 CCACTCTCCAGCTCCCCATCTGG + Intergenic
1137447871 16:48543153-48543175 CCAGCCACCAGCCTCCGACCCGG - Exonic
1137731504 16:50693682-50693704 TCTCCCCCCAGCCCACCCCCAGG - Intronic
1137971041 16:52985401-52985423 TCAGCCCCCTACCCCCCACCTGG + Intergenic
1137983713 16:53090770-53090792 CCACCCCCCTGCCCCCAAGTGGG - Intronic
1139291975 16:65867595-65867617 CCAGCCCCCACCCCCACACCCGG + Intergenic
1139353162 16:66350645-66350667 GCCCTCCCCAGCCCCACACCTGG + Intergenic
1139361733 16:66403719-66403741 CCACTCCCCAACCCCTCTCCAGG + Exonic
1139701336 16:68709932-68709954 CCAGCCACCAGCACCCCAACTGG + Intronic
1139864642 16:70052146-70052168 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1140125890 16:72118751-72118773 CTGCCCCCCCGCCCACCACCGGG - Intronic
1140165809 16:72549528-72549550 CCCTCTCCTAGCCCCCCACCCGG - Intergenic
1140927447 16:79598433-79598455 ACACCCCCCCGCCCCACCCCCGG - Intronic
1140963990 16:79946016-79946038 CTACCTCCCAGCCCATCACCAGG - Intergenic
1141048399 16:80738016-80738038 CTAGCCCCCAGCCCCCCGACAGG + Intronic
1141132329 16:81444888-81444910 CCACCCCGCCGCCCCCACCCCGG + Intergenic
1141167136 16:81668416-81668438 CAAGCCCCAAGCCCCCCACTGGG + Intronic
1141287961 16:82690200-82690222 CCCCACCCCAGCCACCCACCCGG - Intronic
1141386004 16:83623173-83623195 CCACCTCTCAGCCCCTCAACCGG - Intronic
1141463316 16:84191304-84191326 TCAGCCCCCAGCCCCGCCCCTGG + Exonic
1141631474 16:85290311-85290333 TCACCCCCAGGCCCCCAACCTGG + Intergenic
1141634115 16:85304589-85304611 CCACCCCCCCGCCCCCGGCTTGG - Intergenic
1141744041 16:85913971-85913993 CCACCTCCCAGACTCCCACAGGG - Intronic
1141845369 16:86604667-86604689 ACAGCCCCCAGGCCCCCTCCTGG - Intergenic
1141884267 16:86880966-86880988 CCACCCCCCAACCAGCCACACGG - Intergenic
1142253723 16:89003876-89003898 CACCCCCCCACCCCCCAACCCGG + Intergenic
1142286354 16:89173100-89173122 CCACCCCCGACTCCCCCATCTGG + Intronic
1142286380 16:89173177-89173199 CCACCCCTCAGCCCTCTGCCGGG + Intronic
1142286814 16:89174852-89174874 CCAGCCCACAGCCCTGCACCTGG - Intronic
1142474126 17:179908-179930 AGACCCCCCATCGCCCCACCTGG - Intronic
1142813585 17:2408298-2408320 ATACCCCCCAGCCCCGCCCCAGG - Intronic
1142818865 17:2448064-2448086 CCACCCCCCCGCCTCCCTCCCGG - Intronic
1143118710 17:4594650-4594672 CCTCCCCCCAGCCAGCCAGCGGG + Intronic
1143270842 17:5673370-5673392 GCAGCCCCCTGGCCCCCACCTGG - Intergenic
1143495814 17:7312067-7312089 CCACCCCCTTCTCCCCCACCAGG - Exonic
1143519205 17:7436132-7436154 CCACGCCCCCGCCCCCGCCCCGG + Intronic
1143579601 17:7817853-7817875 TGACCCCCCAGCCTCACACCTGG - Exonic
1143581614 17:7830890-7830912 CCACCCCTGATCCCACCACCTGG - Intronic
1143870857 17:9956572-9956594 CCACCTGCCAGCCCCACACCAGG + Intronic
1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG + Intergenic
1144286848 17:13785366-13785388 CCACCCCCCAGCCCCAGGCCTGG - Intergenic
1144503208 17:15807408-15807430 CCAGGCCCCAGGCCCCCACCAGG - Intergenic
1144504994 17:15822080-15822102 CTAGACCCCAGCCACCCACCTGG + Intergenic
1144528508 17:16012471-16012493 CCACCCCCCAGCCCCAAGACAGG - Intronic
1144573677 17:16416024-16416046 CCAGCCCCCACCCCACCTCCTGG - Intronic
1144634089 17:16893017-16893039 CCCCCACCCAGCGCCCCTCCTGG - Intergenic
1144762956 17:17717658-17717680 CCAGCCTCCTGCCCCCCACCTGG + Intronic
1144943819 17:18959685-18959707 CCAAGGCCCAGCCCCCCAGCTGG - Intronic
1144950167 17:18989643-18989665 CCCCGCCCCAGCCCCCCGTCGGG - Intronic
1145165390 17:20610123-20610145 CCAGGCCCCAGGCCCCCACCAGG - Intergenic
1145169167 17:20639963-20639985 CTAGACCCCAGCCACCCACCTGG + Intergenic
1145190833 17:20841574-20841596 CCGCCCCCCGGCCCCCGGCCTGG - Intronic
1145196509 17:20898913-20898935 CCTCCCCCCCGCCCCCCGCAGGG - Intergenic
1145786527 17:27597385-27597407 ACGCCCCCCAACCCCTCACCTGG + Exonic
1145846304 17:28041877-28041899 CTCCCCCCCTCCCCCCCACCCGG - Intronic
1146121978 17:30203735-30203757 CCTCTCCGCAGCCCCCCGCCAGG + Intronic
1146173619 17:30650926-30650948 CCACCTCCCCGGCCCTCACCTGG + Intergenic
1146215976 17:30979535-30979557 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1146305690 17:31728371-31728393 CCAGCCCCGAGCCACCCACTTGG + Intergenic
1146347072 17:32066947-32066969 CCACCTCCCCGGCCCTCACCTGG + Intergenic
1146444135 17:32922206-32922228 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1146444436 17:32922875-32922897 CCACCCCCCCGCCTCCCTCCCGG + Intergenic
1146447352 17:32943011-32943033 CCACCCTGCAGACCCACACCAGG - Exonic
1146467016 17:33094315-33094337 TCTCCCTCCAGCCCCCAACCCGG - Intronic
1146474933 17:33155172-33155194 CCAGCGCCCAACCCCACACCTGG + Intronic
1146492704 17:33293439-33293461 CCACACCCCACCCCCGCACCCGG - Intronic
1146547558 17:33751932-33751954 CCACCCCTCACCCCCACCCCCGG - Intronic
1147192592 17:38746803-38746825 CAATCCCCCAACCCCCAACCAGG + Intronic
1147253542 17:39167616-39167638 CCACCCCCCAGCCCCAGACTTGG - Intergenic
1147265287 17:39231097-39231119 CCTCCCCCCACCAGCCCACCTGG + Intergenic
1147312454 17:39603600-39603622 CCACCCCCCATACACCCACTGGG - Intronic
1147430281 17:40366676-40366698 GCACCCACCAGCCCCACACAAGG - Intergenic
1147460879 17:40568356-40568378 CCCCCTCCCCTCCCCCCACCAGG + Intergenic
1147465619 17:40608589-40608611 CCACCCCCCACCCCAACCCCTGG + Intergenic
1147512871 17:41086896-41086918 CCTCCCCCCACCCCCACAACAGG - Intronic
1147517732 17:41138051-41138073 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1147587551 17:41661036-41661058 CCACCCCCCACCCCCACTCCAGG + Intergenic
1147612712 17:41811284-41811306 CCACCCCCTACCCCCCGACCAGG - Exonic
1147614077 17:41818275-41818297 CTCCCCTCCAGCCCCTCACCTGG - Exonic
1147689444 17:42306457-42306479 CCAGCTGCCAGCCGCCCACCAGG + Intronic
1147793606 17:43027717-43027739 CCACCCTCCCCTCCCCCACCTGG - Intronic
1147995767 17:44359707-44359729 CCACCCCCTACCCCCCAGCCAGG + Intronic
1148021666 17:44557629-44557651 CCCCGCCCCCGCCCCCAACCCGG - Exonic
1148023524 17:44569054-44569076 CCCCCCCCCCCCCCCCCCCCCGG - Intergenic
1148115207 17:45171400-45171422 GCACCCCACAGCACCCCACAGGG - Intergenic
1148180778 17:45603166-45603188 CCACCCCCCAACCTCCCAGGAGG + Intergenic
1148203633 17:45766038-45766060 CCACCCCACAGCCCCGCCCCAGG - Intergenic
1148205319 17:45776094-45776116 GCACCCCACAGCCCCCTCCCTGG + Intergenic
1148252355 17:46094752-46094774 CCACTCCCCACCCCCCAATCTGG - Intronic
1148268125 17:46242760-46242782 CCACCCCCCAACCTCCCAGGAGG - Intergenic
1148331327 17:46815541-46815563 CCCCAACCCAGCCCCCCGCCTGG - Intronic
1148457439 17:47818547-47818569 CCACCGCCTAGCCCACCGCCTGG - Exonic
1148549410 17:48541805-48541827 CCCCCCCCCGGCCCGCCGCCCGG + Intronic
1148645452 17:49217586-49217608 CCCGCCCCCCGCCCCCCACCAGG - Intronic
1148646012 17:49219969-49219991 CCACCCCCCACCCACCCACGTGG - Intronic
1148755312 17:49970003-49970025 GGCCCCCCCAACCCCCCACCTGG + Intronic
1148778413 17:50108685-50108707 CCACCCCCCAGCCTGGCACCGGG + Exonic
1148819866 17:50354150-50354172 CCACCCCCCTGCCCCCGCCTGGG - Intronic
1148862695 17:50612828-50612850 CCACCTCCCTGCCTCCCACCAGG - Intronic
1149614806 17:57988422-57988444 CCCCACCCCAGCCCCCCCGCGGG - Intergenic
1149630396 17:58117053-58117075 CCACTCCCCACCCCACCACTGGG - Intergenic
1150096267 17:62378759-62378781 CCACCCCCCTACCCCCCAACAGG - Intronic
1150211900 17:63446340-63446362 ACACCGCCCAGCCCGCCGCCCGG - Intronic
1150249935 17:63699784-63699806 CCGCCCCTCGGCCCCCGACCTGG + Intronic
1150876335 17:68975001-68975023 CTAGCCCCCATCCCCCCAACAGG + Exonic
1150995449 17:70312146-70312168 CCAGCCCCCGACCCCCCAACAGG + Intergenic
1151164162 17:72189897-72189919 GCAACCCCCATCTCCCCACCTGG - Intergenic
1151224736 17:72640049-72640071 ACACACCCCAGCCCAGCACCTGG - Intergenic
1151265868 17:72954483-72954505 CCACCCGCCAGCCCCTTCCCTGG - Intronic
1151325763 17:73379110-73379132 TCACTCCCCAGCCTCCGACCTGG + Intronic
1151368417 17:73631627-73631649 CATCCACCCAGTCCCCCACCAGG - Intronic
1151460205 17:74249805-74249827 GCCCCTCCCACCCCCCCACCTGG - Intronic
1151551152 17:74823191-74823213 CCAACCCCGAGCTCCCCACTTGG - Intronic
1151584600 17:75001497-75001519 CCGCCCCCCAGCCCTCAGCCGGG - Intronic
1151843527 17:76634638-76634660 CCACCCCCCACCCCCACCCCCGG - Intronic
1151875740 17:76867461-76867483 CCACCTCCCGGCCCCCTTCCTGG - Intergenic
1151963573 17:77419859-77419881 CATCCCCCAAGGCCCCCACCAGG + Intronic
1152033340 17:77857088-77857110 CCCCTCCCCAGCCCCCAACAAGG - Intergenic
1152067896 17:78121537-78121559 GCTCCCCCCATCCCCGCACCTGG + Exonic
1152095107 17:78268119-78268141 CCACCCGCCCGCCCCCCACCTGG - Intergenic
1152111569 17:78360002-78360024 CCAGCCGCCAGCCGCCCGCCCGG - Exonic
1152231176 17:79114808-79114830 CCACCCCCCAGAGCCCCAGCCGG - Intronic
1152301490 17:79497646-79497668 CCTCTTCCCAGCCCCCCAGCTGG + Intronic
1152446716 17:80349090-80349112 CCACCCCCCATCCCCCCACTGGG - Intronic
1152566056 17:81100915-81100937 CCACCACCCAAGGCCCCACCTGG - Intronic
1152568286 17:81109930-81109952 CCGCACCCACGCCCCCCACCTGG + Intronic
1152782631 17:82232906-82232928 CCCCCCCCCCGCCGCCCCCCAGG - Intronic
1152800372 17:82328031-82328053 CCGTCCACCAGCCCCCCTCCCGG + Intronic
1152809878 17:82376367-82376389 CCCCCCTCCAGCCCCCAGCCCGG + Intergenic
1152815382 17:82404625-82404647 CCCCCCTCGAGCCCCCCACATGG - Intronic
1152817710 17:82418295-82418317 CCCCCCCCCACCCCCCCACCCGG + Intronic
1152911932 17:83010038-83010060 AGCCCCCCCAGCCCCCCGCCGGG - Intronic
1152932968 17:83119917-83119939 CCCCGCCCCAGCCCCTCCCCAGG - Intergenic
1153524136 18:5979006-5979028 CCACCCCCCGGCACAGCACCTGG + Intronic
1153786169 18:8537336-8537358 CCCACCTCCAGCCCCCTACCTGG + Intergenic
1153858357 18:9173603-9173625 CCCCCCCCCACCACCCCACCGGG - Intronic
1154040689 18:10852842-10852864 GCACCCCCCACCCACCAACCGGG + Intronic
1154044918 18:10895511-10895533 CCACACCAGAGCCCCCCAGCTGG + Intronic
1154948437 18:21184816-21184838 CCGCTCCCCAGCCCCCTTCCAGG - Intergenic
1155053678 18:22168256-22168278 CCACCCCCTACCCCCCGCCCAGG - Intergenic
1155095109 18:22548089-22548111 CCCACCCCCACCCCCCCCCCAGG - Intergenic
1155479645 18:26271779-26271801 CCGCCCCCCACCACACCACCCGG - Intronic
1155509483 18:26562421-26562443 CCACCCCCCCACCCCCCACCGGG - Intronic
1155932663 18:31723957-31723979 CCACCCCACCCCACCCCACCAGG + Intergenic
1156114815 18:33775051-33775073 CCCTCCCCCAGCCCCACAACAGG - Intergenic
1156474124 18:37394942-37394964 CCCGCCCCCCACCCCCCACCCGG + Intronic
1156478247 18:37420048-37420070 CCACCCCCAAGCCTCCCAGCAGG - Intronic
1156583387 18:38405491-38405513 CCCACCCCCAGCCCTCCACTGGG + Intergenic
1156886476 18:42141259-42141281 TCCTCCCCCAGCCCCACACCGGG - Intergenic
1157247888 18:46070391-46070413 CCACCCCTCAGCCCCATGCCAGG - Intronic
1157300313 18:46474360-46474382 CCCACCCCCTGCCCCCTACCTGG - Intergenic
1157502698 18:48202469-48202491 GCCACCCCCCGCCCCCCACCTGG - Intronic
1157863562 18:51162097-51162119 CCTCCTCCCACCCTCCCACCTGG - Intergenic
1157916601 18:51669705-51669727 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1158295813 18:55995880-55995902 CCACCACTCAGTCCCACACCTGG + Intergenic
1158554022 18:58460399-58460421 CCCCCCCCCCCCCCCCCAGCCGG + Intergenic
1158680869 18:59565499-59565521 CTACAGCCCAGCCCCACACCTGG + Intronic
1159798183 18:72868054-72868076 CCGCCCCCCGGCCCCCCCCCCGG - Intronic
1160386742 18:78501509-78501531 CCACCCCCAAGTGCCTCACCAGG + Intergenic
1160395088 18:78564827-78564849 CCACCCCCCACCCCCGCCACTGG + Intergenic
1160396628 18:78577091-78577113 CCATCCCCCACCTCCCCACTAGG + Intergenic
1160442951 18:78906291-78906313 TCACCCTCCCGCTCCCCACCAGG + Intergenic
1160446993 18:78935645-78935667 CCAGCCCCCAGTCTCCCGCCCGG - Intergenic
1160682390 19:417813-417835 CCTCCACCCAGCCCCCAGCCAGG - Intronic
1160686323 19:438628-438650 CCCGCCCCCAGCACCCCACCTGG + Intronic
1160729093 19:632599-632621 CCCCTCCCCAGAACCCCACCAGG - Intronic
1160740165 19:681883-681905 CCACCCACCAGCCGGCCCCCAGG - Exonic
1160756275 19:758515-758537 CCACCTCCCAGCCCCAGACATGG - Exonic
1160768960 19:821896-821918 CAGCCCCACAGCCCCTCACCTGG + Exonic
1160787803 19:909385-909407 GCAGTCCCCAACCCCCCACCAGG + Intronic
1160809881 19:1008779-1008801 CCGCCCACCCGCTCCCCACCTGG - Exonic
1160879034 19:1311232-1311254 GCCCCCCCCCCCCCCCCACCAGG + Intergenic
1160901408 19:1430412-1430434 CCATCACCCCGCCCACCACCTGG - Intronic
1160907437 19:1458087-1458109 CCATCCTCCAGCCCCCGAACAGG + Intronic
1160995370 19:1879849-1879871 CCGCCCCCCGGCCCCCCGCCTGG + Intronic
1161026580 19:2039950-2039972 CCCCCTCCCAGCCCCCACCCTGG + Intronic
1161082769 19:2319739-2319761 CCAGCCTCCAGCCTCGCACCGGG - Intronic
1161104687 19:2437347-2437369 CCACCGTCCAGCCTCCCACAGGG - Intronic
1161215816 19:3094592-3094614 CCGCCCCCCGGCCCCCGGCCCGG - Exonic
1161260558 19:3335546-3335568 CAACCCCCCAGCTCCCAGCCTGG - Intergenic
1161331310 19:3688938-3688960 CCACCCCCCAGCCCCATCCCGGG - Intronic
1161393248 19:4032075-4032097 CCCCCACCCAGACCCCCAGCCGG - Intronic
1161424921 19:4198253-4198275 CCAGCCCCCAGCCCCCTACCTGG + Intronic
1161494732 19:4580912-4580934 CCTGCCCCGAACCCCCCACCTGG + Intergenic
1161549642 19:4904738-4904760 CCACCCCCCACACCCACTCCTGG - Intronic
1161560732 19:4971226-4971248 CCACCGCACAGCACCCCGCCTGG + Intronic
1161590135 19:5125772-5125794 CCACCCCCCGCCCCCCGCCCTGG + Intronic
1161627675 19:5336771-5336793 CCACCCTCCAACCGCTCACCAGG - Intronic
1161637574 19:5398667-5398689 CCACCCCACTGACCCCCACGAGG + Intergenic
1161653597 19:5499412-5499434 CCACCCCCCAGCCCCATTGCTGG - Intergenic
1161667755 19:5587331-5587353 CCACCTTCCAGTCCGCCACCTGG + Exonic
1161668472 19:5590896-5590918 CCACCTCCCACCTCTCCACCAGG + Intronic
1161698442 19:5782928-5782950 CCATCCCCAAGGCCCCCACGTGG + Intergenic
1161714434 19:5867309-5867331 CCAACCTCCCGCCCCCCACCAGG - Exonic
1161719391 19:5894762-5894784 ACACCTCCCAGCCCTCCAGCCGG + Intronic
1161752851 19:6110310-6110332 CCGCCCCCCGGCCCCCGAACGGG + Intronic
1161759812 19:6162864-6162886 CCGCCCACCCTCCCCCCACCAGG - Intronic
1161846295 19:6713630-6713652 CCCACCTCCAGCCCCTCACCTGG + Intronic
1161846328 19:6713701-6713723 CCCACCTCCAGCCCCTCACCTGG + Intronic
1161846360 19:6713772-6713794 CCACCCCCCAGCCCCCCACCTGG + Intronic
1161846408 19:6713867-6713889 TCCACCCCCAGCCCCCCACCTGG + Intronic
1161846429 19:6713915-6713937 TCCACCCCCAGTCCCCCACCTGG + Intronic
1161846450 19:6713973-6713995 CCCACCCCCAGTCCCTCACCTGG + Exonic
1161850799 19:6737185-6737207 ACACCCCCCTTCCCCCCAACTGG - Intronic
1162056176 19:8065566-8065588 CCAACCCCCTGCCCCCCGCCAGG + Exonic
1162079466 19:8209610-8209632 CCAGCCCCCATCACCCCGCCGGG + Intronic
1162104596 19:8362822-8362844 CCCCCCCCCCTCCCACCACCCGG + Intronic
1162110364 19:8396708-8396730 CCTCCCTCCCGCCCCCCCCCCGG - Intronic
1162113279 19:8413069-8413091 CCCCGCCCCAGCCCCGCCCCAGG - Intronic
1162140895 19:8585138-8585160 CCACTCGCCAGCCACCCAGCGGG + Exonic
1162155682 19:8676818-8676840 CCTGCCCCGAGCCCCCCACAAGG - Intergenic
1162334404 19:10051604-10051626 CCGCCCCCCCCCCCCCCCCCCGG + Intergenic
1162341339 19:10093168-10093190 GGACTCCCCATCCCCCCACCAGG + Exonic
1162797854 19:13095829-13095851 CCGCCTCCCCGCCCCCCACGTGG + Exonic
1162937059 19:13986556-13986578 CCACCCCCCACTTCCCCTCCTGG - Intronic
1162940497 19:14006190-14006212 CCACCCCCCAGGCCCGGCCCGGG - Exonic
1163123750 19:15233141-15233163 CCACCCCACCGCCCCCTCCCCGG - Intronic
1163226125 19:15962817-15962839 CCAGCCCCCAACCCCACTCCAGG + Intergenic
1163347585 19:16753555-16753577 ACGCCCCCCATCCCCCCACAGGG + Intronic
1163463826 19:17455079-17455101 CCCCCCCCCAACCCTCCGCCGGG + Intronic
1163505639 19:17704409-17704431 CCCGCCCCCCACCCCCCACCCGG - Intergenic
1163548104 19:17951070-17951092 CCCCTCCCCAGCCCCCCGGCGGG - Intergenic
1163580776 19:18137377-18137399 GCACCCCCCGCCCCCCCTCCAGG - Intronic
1163641643 19:18465642-18465664 CAAGCCCCCAGCCCACCACCTGG + Intronic
1163675882 19:18655075-18655097 CCACCTCCCTGATCCCCACCTGG - Intronic
1163764131 19:19153036-19153058 CCACCCCCCAGGGACCCATCAGG - Intronic
1163779862 19:19240463-19240485 CCCCCACCCAGCCCACCTCCAGG + Intronic
1164066519 19:21721330-21721352 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1164156970 19:22602914-22602936 CCTCCCCGCAGCCCCCCGCCGGG - Intergenic
1165038253 19:33050015-33050037 ACACACCCCTGCCCCCCACCAGG - Intronic
1165096955 19:33414586-33414608 CCACCCGCCCACCCCCGACCAGG + Intronic
1165403784 19:35618085-35618107 CCACCCCCCAGGCCACGTCCTGG + Exonic
1165495837 19:36151650-36151672 ACCCCCCCCGACCCCCCACCTGG + Exonic
1165827319 19:38712767-38712789 CCAGCCCCCTGCCCACCACATGG + Intronic
1165922362 19:39307258-39307280 CCCTCCCCCAGCCCGTCACCCGG - Exonic
1166162607 19:40965439-40965461 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1166205305 19:41265203-41265225 CCACCCCCCAGCCCACACGCTGG - Intronic
1166299947 19:41907791-41907813 CCCGCCCCCAGCCCCCACCCAGG - Intronic
1166303048 19:41922869-41922891 CCTGTCCCCAGCCCCACACCGGG + Intronic
1166345296 19:42161830-42161852 CTTCCCCCCAGCCCCCGCCCTGG + Intronic
1166384143 19:42370842-42370864 CCCCCCCCCCCCCCCCCCCCCGG - Intronic
1166419454 19:42625283-42625305 ACACACCCCAGCCCCACCCCAGG + Intronic
1166425699 19:42676423-42676445 TCACCCCCCCGCCTCCCTCCCGG + Intronic
1166523168 19:43495002-43495024 CCAGCCCCCAGCCCCTCCTCAGG - Intronic
1166529698 19:43535018-43535040 CTGTCCCCCAGCTCCCCACCAGG + Exonic
1166565925 19:43765491-43765513 CCTCCCCTCAGGCCCCCAGCCGG - Intergenic
1166667955 19:44692473-44692495 CAACCCCCCAACCGCCCCCCCGG - Intergenic
1166745575 19:45140411-45140433 CCAACCTCCCACCCCCCACCAGG - Intronic
1166781520 19:45345811-45345833 CCTTCCCCCAGCTCCCCACCTGG - Intronic
1166862715 19:45819182-45819204 CTTTGCCCCAGCCCCCCACCTGG + Intronic
1166884960 19:45954559-45954581 CCACCCCTCAGCCCTCCATCTGG - Intronic
1167266526 19:48485577-48485599 CCGCCCCCCAGCCCCCCAGATGG - Exonic
1167289163 19:48615080-48615102 CCACCCGCCATCCCAGCACCAGG + Intergenic
1167368087 19:49065073-49065095 CCCCGCCCCCGCCCCCGACCCGG - Intronic
1167466884 19:49654782-49654804 CGACCCCCCCCACCCCCACCGGG + Exonic
1167970672 19:53186926-53186948 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1167970971 19:53187594-53187616 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1167997076 19:53414490-53414512 CCCCCCCCCCCCCCCCCCCCGGG + Intronic
1168354873 19:55694843-55694865 CAACTCCCACGCCCCCCACCCGG + Exonic
1168523173 19:57068805-57068827 CCACTGCCCAGCCCACCTCCTGG - Intergenic
925290949 2:2748426-2748448 CCAGCACCCACCCACCCACCGGG - Intergenic
925738976 2:6988582-6988604 CCACACCCCTCACCCCCACCAGG - Intronic
925869123 2:8253956-8253978 CCACCCCCCACCCCCAGGCCTGG + Intergenic
925891021 2:8434655-8434677 CTAACCCCCAACCCCCCAACAGG + Intergenic
925969570 2:9096930-9096952 CCACCCTCCCGCTCCACACCCGG - Intergenic
926043049 2:9690221-9690243 CCTCCCCACTGCCCTCCACCAGG - Intergenic
926057279 2:9781325-9781347 ACACCTCCCAGCCGCCAACCAGG - Intergenic
926106347 2:10154399-10154421 CCCCCACCCAACCACCCACCAGG - Intronic
926175832 2:10591363-10591385 GCACCCCCCAGGGCCCCTCCTGG - Intronic
926622047 2:15055495-15055517 CCAGCCCCCCGCCCCCCAGCTGG - Intergenic
926683088 2:15678657-15678679 CAGCCCCCCAGCCCCCCAGCAGG - Intergenic
926704263 2:15825738-15825760 CCAGCCCCCAGCCCCTCTCCAGG - Intergenic
926718761 2:15943195-15943217 CAACCCCCTAAACCCCCACCCGG - Intronic
926730840 2:16034371-16034393 CCACCCCCCAGGACCACACCTGG - Intergenic
926848213 2:17165618-17165640 CTAGCCCCCAACCCCCCAACAGG + Intergenic
926890819 2:17637535-17637557 CCAGCCCCCAACCCCACCCCAGG + Intronic
927200586 2:20575758-20575780 CCACCCCCCCCCCCCCCTTCAGG + Intronic
927385224 2:22524687-22524709 CCAACCCCCATCCCCCCATAGGG - Intergenic
927403000 2:22735125-22735147 CCACCCAGCAGCCACCCACTGGG + Intergenic
927564653 2:24101106-24101128 CCAGCCCCCAACCCCCCAACAGG - Intronic
927671738 2:25074137-25074159 CGACCAACCAGCCCCACACCAGG - Intronic
927900625 2:26815771-26815793 CCGCCCCGGCGCCCCCCACCCGG - Intergenic
928005234 2:27557640-27557662 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
928016947 2:27666363-27666385 CCCCCCCCCACCCCGCCCCCCGG + Intronic
928164995 2:28964636-28964658 CCCCCACCCAACCCCCCAGCAGG + Intronic
928946892 2:36779623-36779645 CCACCTCCCAACCCTCCAACAGG + Intronic
929067524 2:37993757-37993779 TCTCCCCCCCACCCCCCACCAGG - Intronic
929109241 2:38392433-38392455 CCACCCCCCCCCCGCCCCCCCGG - Intergenic
929533948 2:42768871-42768893 CCACCCCCAAGCCCCGCCTCTGG + Intronic
929668618 2:43852483-43852505 CTGCCCCCCAGGCCCTCACCTGG - Exonic
929920447 2:46167736-46167758 GCACCCCCCACCCCGCCCCCCGG + Intronic
930079094 2:47433050-47433072 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
930851408 2:55965240-55965262 CCACCACCCACCCCCCAAACTGG + Intergenic
930870099 2:56161950-56161972 CCACTCCCCAACCCCACAACAGG + Intergenic
931056127 2:58473513-58473535 TCAGCCCCCAGTCCCTCACCAGG + Intergenic
931216216 2:60247462-60247484 CCACGGCCCAGCCGCCCTCCTGG + Intergenic
931430996 2:62208946-62208968 CCACCCCACTGCCCCCACCCAGG - Intronic
931517844 2:63059985-63060007 CCAACCCCCACCCCCACCCCCGG + Intergenic
931586233 2:63832416-63832438 CCCCCCCCCACCCCAACACCTGG - Intergenic
931702164 2:64918075-64918097 CCTGCCCCCAGCCCTCCATCAGG - Intergenic
932052351 2:68411161-68411183 CTAGCCCCCAACCCCCCAACAGG - Intergenic
932495862 2:72145407-72145429 CCGCGGCCCAGCCCCCCTCCTGG - Intronic
933061983 2:77749233-77749255 CCATCCCCCTGCCCCCCAACAGG - Intergenic
933723068 2:85410406-85410428 CCACCCACCAGCCCCACCCCTGG + Exonic
934567470 2:95348446-95348468 CCACCCCCCACGCCCACCCCAGG - Intronic
934573141 2:95384568-95384590 TCTCCCCCCTGCCCCCCAGCTGG - Exonic
934856728 2:97734473-97734495 CCACACCCCTGCCCCTGACCTGG + Intronic
935130334 2:100256746-100256768 CCACCACCCTGCCCACCTCCTGG + Intergenic
935335271 2:102009835-102009857 CCCCTCCCCAGCCCCGCACAGGG - Intronic
935361626 2:102250792-102250814 CCCCCGCCCAGCCACCCACGCGG - Intergenic
935569680 2:104645930-104645952 CCATCCCCCAACCCCACAACAGG - Intergenic
936437926 2:112523942-112523964 CCATCCCCCAACCCCACAACAGG + Intronic
936569897 2:113603977-113603999 CCACCCCCGCGCTCCCCGCCCGG - Intergenic
937113376 2:119384862-119384884 CCTCCACCCTGCCACCCACCAGG + Intergenic
937156610 2:119724426-119724448 TAACCTCCCAGCTCCCCACCAGG - Intergenic
937851415 2:126639508-126639530 CCTCACCCAAGGCCCCCACCTGG + Intergenic
938069379 2:128300419-128300441 CCTGCCCCCAGCCCTGCACCTGG + Intronic
938074645 2:128325240-128325262 CTAGCCCCCAGCCCCCAGCCCGG + Intergenic
938534186 2:132222031-132222053 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
938878213 2:135556014-135556036 CCTCCCCCCATCCCCCCACTTGG - Intronic
939705087 2:145442595-145442617 CCTCCCCCCACCCCCACAACAGG - Intergenic
940047371 2:149423764-149423786 ACACCCCCCACCCCCCGCCCCGG - Intronic
940260939 2:151779081-151779103 CCAGCCCCCCACCCCCCAACAGG - Intergenic
940457123 2:153914901-153914923 GCACCCTCCTGTCCCCCACCAGG - Intronic
940517616 2:154699599-154699621 CCAACCCCCAACCCCCCAAAAGG - Intronic
940615473 2:156044026-156044048 CATCCCCCTAGCCCCCCAACAGG + Intergenic
940809722 2:158228801-158228823 CCTCCCCCCAACCCCACAACAGG - Intronic
941229818 2:162897914-162897936 GCACCACCCAGCCCCCATCCAGG + Intergenic
941678933 2:168374687-168374709 CCAACCCCCCACCCCCCAACAGG - Intergenic
941681701 2:168406895-168406917 CTACCCCCCAACCCCCCGACAGG + Intergenic
941691890 2:168508703-168508725 CTACCCCCCACCCCCCGACAGGG - Intronic
941806624 2:169716824-169716846 CCACCCCCCCACCCCGCCCCAGG + Intronic
941818044 2:169817758-169817780 CCAGCCCCCCACCCCCCAACAGG - Intronic
941868038 2:170354943-170354965 CCACCCCCCACCCCACCCCCAGG - Intronic
941911707 2:170770855-170770877 CCGCCTCCCAGCCCCGCCCCGGG + Intergenic
942213285 2:173693051-173693073 CAACCCCTGAGCCCCCAACCAGG + Intergenic
942227548 2:173830519-173830541 CCTAGCCCCAGCCCACCACCAGG + Intergenic
942342495 2:174962661-174962683 CCCCCCCCCCCCCCCCCCCCGGG - Intronic
942532173 2:176922915-176922937 CCAGCCCCCCACCCCCCAACAGG - Intergenic
942901796 2:181129067-181129089 CCAGCCCCCCACCCCCCAACAGG - Intergenic
943361628 2:186925692-186925714 CCACCCCCCACCCCCACACTTGG - Intergenic
944132042 2:196357313-196357335 CCCCGCCCAAGCCCCCCACCAGG - Intronic
944283266 2:197922651-197922673 CCACCCCCCCACCTCCCTCCCGG + Intronic
944416369 2:199483700-199483722 TCACCCGCCACCCCCACACCCGG + Intergenic
944773123 2:202933568-202933590 CCACCACCCAATCCCCCAACTGG - Intronic
944775837 2:202963529-202963551 CCATCCCCCATCCCCCATCCTGG - Intronic
944924111 2:204446007-204446029 CCTGCCCCCAGTCCCCCAACAGG + Intergenic
945062948 2:205924598-205924620 CCTCCCCACAGCCCCCCAGGTGG - Intergenic
945233158 2:207611082-207611104 CCCCCCCCCCGCCTCCCTCCCGG - Exonic
945835612 2:214835095-214835117 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
945970362 2:216226569-216226591 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
946020573 2:216637193-216637215 CCACCTCCCCTCCCCCCATCTGG + Intronic
946045816 2:216820052-216820074 CCACCCCACACCCCCACTCCTGG - Intergenic
946087353 2:217187365-217187387 CCACCCCCCACCCCAGCACCAGG - Intergenic
946195234 2:218028758-218028780 CCACCCCCAAGACCCCAGCCTGG - Intergenic
946200411 2:218068080-218068102 CCAGCCCCCTGCCCTCCTCCAGG - Intronic
946231885 2:218296524-218296546 CCACCCTCCAGCCCAGCCCCAGG + Intronic
946332750 2:219019473-219019495 CCAGCCCCCACCCCCACTCCAGG + Intronic
946370633 2:219279463-219279485 CCCCGCCCCTGCCCCCCGCCGGG - Exonic
946389803 2:219408589-219408611 CCAGCCCCCAGACCCTCTCCTGG - Intergenic
946733630 2:222732903-222732925 CCCCCTCCCATCCCCCCAGCTGG + Intergenic
946864627 2:224031750-224031772 CCACCCCCCACCCCCCCCGCCGG + Intronic
947119529 2:226800163-226800185 CCTCCCCCCGGCCTCCCACTCGG - Intergenic
947220273 2:227785044-227785066 CCAGCCCCCCACCCCCCAACAGG - Intergenic
947498957 2:230658626-230658648 CCAGCCACCAGCCCCCCACTGGG + Intergenic
947534101 2:230930049-230930071 GGACCCCCCCGCCTCCCACCTGG + Intronic
947637975 2:231689718-231689740 CCAACCCCCCGCCCCCCTGCTGG + Intergenic
947865964 2:233397914-233397936 CCACCCCACAGCCCCTCTTCTGG - Intronic
947940425 2:234049692-234049714 CCAGCCCCCCACCCCCCAACAGG - Intergenic
948106016 2:235414375-235414397 CCACCCCCCAACCCCATCCCAGG - Intergenic
948121956 2:235537291-235537313 GCACCCACCATCTCCCCACCTGG - Intronic
948135437 2:235632814-235632836 CCACACACCAGCACACCACCAGG - Intronic
948149131 2:235730968-235730990 CCAACCCCCAGCCCCTAGCCCGG + Intronic
948172375 2:235915051-235915073 CCAGCTCACAGCCCCCCACACGG + Intronic
948196826 2:236103006-236103028 CCACCCCCCACCCCCAGGCCTGG + Intronic
948537573 2:238657694-238657716 CCAGCCCACAGCCTCCCACCTGG - Intergenic
948644291 2:239393975-239393997 CCACCCCCAACCCCACCACCAGG + Intronic
948645221 2:239400431-239400453 CCACCCCCGCGCCCCCGCCCCGG + Exonic
948669243 2:239556590-239556612 CCTCCCCCCACCTCCCCAACAGG + Intergenic
948815351 2:240507541-240507563 CCAGCCTCCTGCCCCTCACCAGG + Exonic
948878978 2:240846188-240846210 ACACCTCCCCTCCCCCCACCTGG - Intergenic
948892970 2:240916090-240916112 CCACTCCCCAGGCCCCTCCCAGG - Intergenic
948942783 2:241204420-241204442 CCACCACCCAACCCCCACCCTGG - Intronic
948953913 2:241272677-241272699 CCACCCCCCACCCCCCCGCCCGG + Intronic
949041543 2:241852077-241852099 CCTCCCCCCATCTCCCCGCCAGG - Intronic
949048722 2:241885401-241885423 CCACCTGCCACCTCCCCACCTGG - Intergenic
949056866 2:241932513-241932535 CCACCCCCAAACCCCGCCCCAGG - Intergenic
949088867 2:242182364-242182386 CCACCCCCGCGCTCCCCGCCCGG + Intergenic
1169268793 20:4183397-4183419 CAACCCCCCACCCCACCTCCAGG - Intronic
1169910866 20:10646567-10646589 CCACCCCCCGACCCCCAACTTGG - Intronic
1169940611 20:10933307-10933329 CCACCCCCCCACCCCGCCCCTGG - Intergenic
1169988051 20:11469202-11469224 CCACAACCCAGCTCACCACCTGG - Intergenic
1170962583 20:21038423-21038445 CCAGCCCCCAACCCCTCAACAGG - Intergenic
1171097313 20:22343992-22344014 CCACCCCCAATGCCCCCACCCGG - Intergenic
1171287229 20:23951274-23951296 ACACACCCCACCCCCCGACCTGG - Intergenic
1171405235 20:24908335-24908357 CCACCTCCCACCCCTCCAACAGG - Intergenic
1171447751 20:25216808-25216830 CCACCCCGCAGCACCTCAGCAGG - Intronic
1171454440 20:25259600-25259622 CCACACCCCACCCCACCTCCGGG + Intronic
1172012082 20:31851425-31851447 CCACCCCCATGCACCCCATCGGG - Intronic
1172113772 20:32562245-32562267 CCACCCCCCACCCGCCCATCAGG + Intronic
1172127881 20:32636035-32636057 CCAGCCCCCAGGCCCCCCTCAGG + Intergenic
1172232527 20:33346735-33346757 CCCCCCCCCCCCCCCCCACAAGG - Intergenic
1172487109 20:35304966-35304988 CCACCCCTCTGCCCACCTCCTGG + Intronic
1172931481 20:38589292-38589314 ACCTCCCCCAGCACCCCACCTGG - Intergenic
1173447582 20:43133871-43133893 CCAGTTCCCAGGCCCCCACCAGG - Intronic
1173571048 20:44076322-44076344 CCCCCCCCCCGCCACCTACCAGG + Intergenic
1173591546 20:44228842-44228864 CCACCCCCCACCCCCCCACCCGG + Intergenic
1173681771 20:44886691-44886713 CCGCTCCCCACCCCCCGACCAGG - Intronic
1173747433 20:45448656-45448678 CCACCCCCCACCCCCCCACTGGG + Intergenic
1173874899 20:46364235-46364257 CCACGCCCCTGCCCCTCCCCGGG - Intronic
1174017814 20:47502472-47502494 CCCCACCCCAGCCTCCCAGCCGG + Intronic
1174180107 20:48669151-48669173 CCACCCGCCTGCCCACCCCCAGG + Intronic
1174189878 20:48732864-48732886 CCTCCCTCCACCCCACCACCTGG + Intronic
1174199447 20:48797334-48797356 GCTCCCCCCAGACCCCCCCCAGG + Intronic
1174287333 20:49482710-49482732 CCGCCCCCCACCTCTCCACCAGG + Intergenic
1174498583 20:50967361-50967383 CCATCCCCCACCCCACCCCCCGG + Intergenic
1174548126 20:51341854-51341876 CCACCCCCCTGCTCCCACCCCGG + Intergenic
1175178884 20:57130940-57130962 CCACCCCCCACCACCCGAACTGG + Intergenic
1175225740 20:57442871-57442893 ACACCCCCCAGCCCCCAACCTGG + Intergenic
1175264432 20:57694013-57694035 CCACCTCCCAGCCCTGCAGCAGG + Intronic
1175413414 20:58786109-58786131 CCCCCCCCCCCCCCCCCCCCGGG + Intergenic
1175448483 20:59042804-59042826 CCCGCCCCCAGCACCCCAGCCGG + Exonic
1175463771 20:59175220-59175242 CCACCCCCACCCCCACCACCAGG - Intergenic
1175521236 20:59604056-59604078 CCGCCCCCCCGCCCCCCGGCAGG + Intronic
1175647390 20:60686131-60686153 TCACCCCCCACCCTCTCACCAGG + Intergenic
1175777285 20:61661247-61661269 GCACCCCCCAGGCTCTCACCAGG + Intronic
1175782360 20:61690702-61690724 CCACCCCCCACCCACCGACCAGG + Intronic
1175793508 20:61757235-61757257 CCCCCCCCCAGCCCCCTCCAGGG + Intronic
1175814570 20:61876832-61876854 AGACCTCCCAGCCCTCCACCCGG - Intronic
1175846946 20:62064614-62064636 CCGCCCCCGGGACCCCCACCGGG - Exonic
1175860507 20:62147840-62147862 CCATGCCCCACCCCCGCACCTGG - Intronic
1175930533 20:62491857-62491879 CCACCCACCCCACCCCCACCAGG + Intergenic
1175940505 20:62535519-62535541 CCACCCCTCAGCCACCCTCTTGG - Intergenic
1175949396 20:62575218-62575240 GCACCCCCCAGCCCCCCACCTGG - Intergenic
1175990290 20:62785324-62785346 CCACCCTCCATCTCCCCACCCGG - Intergenic
1176032977 20:63022675-63022697 CCACACCCCATCTGCCCACCTGG - Intergenic
1176080740 20:63272198-63272220 CAACCCCGCCGCCTCCCACCAGG + Intronic
1176090297 20:63315584-63315606 CCACCGCCCAGCCAGCCACAGGG - Intronic
1176123405 20:63464374-63464396 ACCCACCCCAGCCCCTCACCTGG + Intronic
1176172151 20:63700937-63700959 CCACCCCCCATCCCCTCCCTGGG + Intronic
1176728486 21:10465534-10465556 CTACCCCACTGCCCCCAACCCGG - Intergenic
1176882588 21:14215985-14216007 CCACCGCCCAGCCCTACGCCAGG + Intergenic
1176882711 21:14216428-14216450 TCACTCCCCAGCCGCTCACCTGG - Intronic
1177278421 21:18947245-18947267 ACTCCACCCACCCCCCCACCAGG + Intergenic
1177783022 21:25639937-25639959 CCACCCTCCAGCCCCCCACGGGG + Intronic
1177818561 21:26004800-26004822 CAACCCCCCACCCCCCCAACAGG + Intronic
1178618416 21:34153691-34153713 GCACCCTCCAGCCCCGCTCCGGG + Intergenic
1179311746 21:40202170-40202192 CCACCCCCCAGCTCCCACACAGG - Intronic
1179430410 21:41317246-41317268 CCGCACCCCCACCCCCCACCCGG + Intronic
1179562118 21:42222091-42222113 CCTTCCCCCACCCCCGCACCGGG - Intronic
1180040564 21:45277222-45277244 CCACCACCCACCCCCGCAGCTGG + Intronic
1180043316 21:45291688-45291710 GCAGCCCCCCACCCCCCACCGGG + Intergenic
1180089403 21:45526079-45526101 GCACGCACAAGCCCCCCACCAGG + Intronic
1180156014 21:45977717-45977739 CCACCCCCAAGCCCCCATCCAGG - Intergenic
1180157820 21:45986599-45986621 GCATCCTCCAGCCCCCCACAGGG - Exonic
1180163224 21:46007161-46007183 CCACCACGCAGACCCCCACGGGG + Intergenic
1180264090 21:46698646-46698668 CCACCCCCGCGCTCCCCGCCCGG + Intergenic
1180675505 22:17583448-17583470 GCACATCCCAGCCCCACACCCGG - Exonic
1180721354 22:17911008-17911030 TCCTCCCCCAGCCCCCAACCCGG - Intronic
1180733506 22:17999651-17999673 CCTCCCCCCAAACCCCCACCTGG - Intronic
1180843598 22:18970352-18970374 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843612 22:18970378-18970400 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1181018793 22:20087412-20087434 CCTCCACCCAGCCCACTACCTGG - Intronic
1181042987 22:20201614-20201636 CTCTCCCCCAGCCCCCCAGCAGG - Intergenic
1181055566 22:20259087-20259109 CCAACCCCGAGCTGCCCACCAGG - Intronic
1181067354 22:20313216-20313238 GCACCCCCCCGCCCCCGCCCAGG + Intergenic
1181545020 22:23597786-23597808 CCCAGCCCCAGCCCCCCACCAGG - Intergenic
1181769785 22:25117134-25117156 CCCCCTCCCAGCCCCCATCCAGG + Intronic
1181811095 22:25404609-25404631 CACCCCCCCCGCCCCCCTCCGGG + Intronic
1181815291 22:25432096-25432118 CCCAGCCCCAGCCCCCCACCAGG + Intergenic
1181823493 22:25494272-25494294 CCACTCCCCAGCCTCTCCCCAGG + Intergenic
1181905457 22:26191578-26191600 CCACCCCCCAACCCTCCAACAGG - Intronic
1182024680 22:27108869-27108891 CCCCCCCCCCGCCCCCACCCTGG + Intergenic
1182085319 22:27557237-27557259 CCAGCCCCCTGCCTCGCACCAGG + Intergenic
1182353503 22:29711618-29711640 CCACAAACCTGCCCCCCACCTGG + Intergenic
1182973187 22:34596851-34596873 CTCTCCCCCAGCCCCCCAACAGG + Intergenic
1183099594 22:35575620-35575642 CCAAACCCCAGCCACCCACAAGG - Intergenic
1183278030 22:36913692-36913714 CCACCCCTCAGCCCTGCTCCTGG - Intronic
1183282083 22:36937501-36937523 CAGCCCCCCAGCCCCCAGCCAGG + Exonic
1183311691 22:37113235-37113257 CCTCCCCTCATCCCCTCACCAGG - Intergenic
1183418741 22:37697768-37697790 CCACCCCCCACCCTCCCCCTGGG + Intronic
1183433734 22:37781664-37781686 GCACCACCCAGACCCCCAGCAGG + Intergenic
1183466831 22:37984244-37984266 CCCCGCCCTTGCCCCCCACCTGG - Intronic
1183479871 22:38057596-38057618 CACCTACCCAGCCCCCCACCCGG + Intronic
1183577976 22:38704378-38704400 CCGCCCCCCCCCCCCCCCCCCGG + Intergenic
1183605531 22:38865221-38865243 CCACCCCCCTGCCCTCCTCAGGG - Exonic
1183743337 22:39680036-39680058 CCACACCACAGGCCCACACCTGG - Intronic
1183829524 22:40410426-40410448 CCACCCCTCAGCCCCACCGCAGG + Exonic
1183831319 22:40419650-40419672 CCAGCCCCCAGCCCCCAGCATGG + Intronic
1183951505 22:41355448-41355470 CCCCTCCCCATCCCCCCACAGGG + Exonic
1184112849 22:42405402-42405424 CCACGCCCCAGCTCCTCCCCTGG + Intronic
1184117738 22:42431909-42431931 CCTCCCCCCTGCCCCGCCCCTGG + Intronic
1184149715 22:42631057-42631079 CCACTCCCCTGCACCCCACCCGG + Intronic
1184171758 22:42764287-42764309 CCGTCCCCCACCCCCACACCTGG + Intergenic
1184171974 22:42765253-42765275 CCATGCCCCAGCCCCCGGCCTGG + Intergenic
1184176388 22:42791880-42791902 CCAGCCCCCGGCCCCCAGCCTGG - Intergenic
1184245668 22:43234694-43234716 CCACCCCACCGCCCCACACCAGG + Intronic
1184247374 22:43242475-43242497 CCACCCCCAACCTCCCCACCGGG - Intronic
1184275502 22:43407398-43407420 CAGCTCCCCTGCCCCCCACCTGG - Intergenic
1184276347 22:43411605-43411627 CCCGCCCCCAGCCCCGGACCGGG - Intronic
1184301270 22:43562578-43562600 CCTCCCTCCAACCCCCCACCGGG - Intronic
1184301336 22:43562736-43562758 CCTCCCTCCAACCCCCCACCGGG - Intronic
1184370299 22:44077626-44077648 CCACCTCCCCGGCACCCACCTGG - Intronic
1184439251 22:44498433-44498455 CCCCCCCCCACCCCCCAACTCGG + Intergenic
1184455331 22:44606865-44606887 CCACCTCCAAGCCCACCACCAGG + Intergenic
1184500437 22:44868299-44868321 CCGTCCCCCTGCCCCCCACCTGG - Intergenic
1184557147 22:45239763-45239785 CCACCCCCCACCCCACCCCCAGG - Intronic
1184583289 22:45431090-45431112 CCTCCACCCGGTCCCCCACCTGG - Intronic
1184606178 22:45576032-45576054 CCTCCCCCCACCCCCCCGCATGG - Intronic
1184659682 22:45960135-45960157 CCACCTCCCAGCCCCAGCCCAGG + Intronic
1184689370 22:46110494-46110516 CCACCCCACAGCCTCCCCCAAGG + Intronic
1184849766 22:47113410-47113432 CCACCCCACCTCCCACCACCAGG - Intronic
1184870889 22:47237886-47237908 CCACCACCCGGTTCCCCACCTGG - Intergenic
1185335339 22:50268775-50268797 CCACCCCCCATGCCCACACAAGG + Intronic
1185343519 22:50301714-50301736 CCACCCCCCAACGCCCACCCCGG - Intronic
1185365374 22:50434454-50434476 CCATCCCCCGGCCCTCCTCCAGG - Intronic
1185397633 22:50600929-50600951 GCACCCCCCCGACCCCGACCCGG + Intronic
1185430328 22:50807027-50807049 CCACCCCCGCGCTCCCCGCCCGG + Intergenic
949303763 3:2616144-2616166 TAACCCCCCATCCCCCCAACAGG + Intronic
949427517 3:3935353-3935375 CCCTCCCCCAGTCCCCCACCCGG + Intronic
949639691 3:6022041-6022063 CCATCCCCCAACCCCACAACAGG + Intergenic
949882322 3:8671797-8671819 TCACCCCCCCTCTCCCCACCTGG + Intronic
950026531 3:9824052-9824074 CCATCCCCAAGCACCACACCTGG - Intronic
950124759 3:10504568-10504590 CCAACCCCCAACCCCCAACCTGG + Intronic
950183863 3:10933275-10933297 CCACACCCCAGCTGCCCACCAGG + Intronic
950439647 3:13001981-13002003 CCACCCCCCACCCTGCCTCCGGG - Intronic
950481610 3:13247775-13247797 ACACCCCCCAGCCACCTCCCAGG + Intergenic
950612910 3:14137518-14137540 CCAGCCCCCACCCCCACACAAGG + Intronic
950641196 3:14349579-14349601 CCACCTCGCACCCCCACACCAGG - Intergenic
950652131 3:14413703-14413725 CCTTCCCCCAGCCCCACCCCCGG - Intronic
950795330 3:15505938-15505960 GCACCCCCCATCCCACCTCCAGG + Intronic
951291205 3:20874064-20874086 CCTCCCCCCAACCCCACAACAGG + Intergenic
951431384 3:22611298-22611320 CTAGCCCCCAACCCCCCAACAGG - Intergenic
951479109 3:23140933-23140955 CCAGCCCCCACCTCCCCAACAGG - Intergenic
951868878 3:27338085-27338107 CCCTCTCCCAGCCCCCCAACAGG + Intronic
951902154 3:27667343-27667365 CCATCCCCCCCCCCCCCACAGGG + Intergenic
952048697 3:29357196-29357218 CCAGCCCCCAACCCCACAACAGG + Intronic
952078565 3:29729139-29729161 CCACCCCCCAACCCCCTGACAGG + Intronic
953331843 3:42060328-42060350 CCACCCCCCACCCCCCACCGTGG - Intronic
953864847 3:46575408-46575430 CCACCCCCCATCCCAAAACCTGG + Intronic
953925790 3:46981859-46981881 CCACCCCCCATCCCCTCAGGAGG + Intronic
954144561 3:48628119-48628141 CCACCCACCTGCCCAGCACCAGG - Intronic
954295825 3:49674132-49674154 CCACGGCCCCGCCCCCCACTTGG + Exonic
954329323 3:49881120-49881142 CCACCCCACAGCCCTCAGCCTGG - Intergenic
954373669 3:50183330-50183352 CCTCCCCACAGCTCGCCACCGGG - Intronic
954374948 3:50189133-50189155 TCCCTTCCCAGCCCCCCACCTGG - Intergenic
954439986 3:50516564-50516586 CCACTCCCCAGGCCCACCCCTGG + Intergenic
954523819 3:51251017-51251039 CCATCCCCCAACCCCACAACAGG + Intronic
954620683 3:51993691-51993713 CGACCCCCCACCCCCGCCCCTGG - Exonic
954841318 3:53514373-53514395 CCACCCCCCACGCCCCCAAAAGG - Intronic
955404709 3:58618767-58618789 CCACCCTCCAGGTGCCCACCAGG - Intronic
955636059 3:61030814-61030836 CTACCCCCCTGCCCCCATCCCGG - Intronic
955950126 3:64235519-64235541 CCACCACCCTGCCCCCCTTCTGG + Intronic
955950652 3:64239235-64239257 CCAGCCCCCCGCCCCCCAGCAGG - Intronic
956396037 3:68827033-68827055 CCAGCCCCCCACCCCCCAACAGG + Intronic
956522735 3:70123598-70123620 TCACTCCCCAGCCCCTGACCAGG + Intergenic
956609926 3:71112105-71112127 CCACCCCCCCACCCACCACCAGG - Intronic
956939024 3:74135930-74135952 GCACTCCCCAGACCCCCGCCCGG - Intergenic
957327990 3:78720937-78720959 CCCCCCCCCAACCCCACAACAGG - Intronic
958259687 3:91366264-91366286 CCAGCCCCCCACCCCCCAACAGG + Intergenic
958580122 3:96007581-96007603 CCACACCCCAGCCCTCCTCCTGG + Intergenic
958731190 3:97962357-97962379 CCCCCCCCCCCCCCCCCACATGG + Intronic
959215836 3:103448903-103448925 CCAGCCCCCCACCCCCCAACAGG + Intergenic
959333474 3:105035589-105035611 CGACCCCCTAACCCCCAACCAGG - Intergenic
959415152 3:106073617-106073639 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
960780552 3:121313608-121313630 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
960997397 3:123349110-123349132 CCAGCCTCCAGCTGCCCACCTGG + Intronic
961356495 3:126343159-126343181 CCCCCCCCCCCCCCCCCCCCCGG + Exonic
961452500 3:127008736-127008758 TCAGCCCCCAGCCCCCAGCCTGG - Intronic
961485596 3:127213584-127213606 CCACCCTCCCCACCCCCACCGGG + Intergenic
961660004 3:128463560-128463582 CCCGCCCCCAGCTCCTCACCAGG + Exonic
961735436 3:128999444-128999466 CCACCCCCCATCCCTGCAGCTGG - Intronic
962127372 3:132634898-132634920 CCACCCCCCCACCCCACAACAGG - Intronic
962640370 3:137379268-137379290 CCACCCCCCCACCCGCCAACAGG - Intergenic
962727989 3:138252746-138252768 GCCCCCCCCCCCCCCCCACCCGG + Intronic
963594432 3:147307498-147307520 CTACTCCCCTGCCCCCCAACAGG + Intergenic
963907419 3:150784037-150784059 CCACTCCCCATCCCCCAGCCAGG - Intergenic
963911231 3:150820201-150820223 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
963929278 3:150985238-150985260 CCAGCCCCCTACCCCCCAACAGG - Intergenic
964413263 3:156421679-156421701 CCACCTTCCAGCCCACCCCCAGG - Intronic
964507956 3:157420172-157420194 CCTCCCCCCAGCCCCCCAACAGG - Intronic
964648526 3:158985744-158985766 CCAGCCCCCAACCCCCCAACAGG + Intronic
965530198 3:169764007-169764029 CCACCCCCAACCCTCCCAGCCGG - Intergenic
965600218 3:170447029-170447051 CCCTCCCCCAACCCCCCAACAGG - Intronic
965668310 3:171119790-171119812 CCTCCCCCCAACCCCACAACAGG - Intronic
965714820 3:171591602-171591624 CCTCCCCCCATCCCCCAGCCCGG + Intergenic
966283536 3:178265136-178265158 CCTCACCCCTGCCCCCCAACAGG + Intergenic
966539096 3:181069486-181069508 TCATCCCCCACCCCCCCAACAGG + Intergenic
966818220 3:183906156-183906178 CCACCTCCCAGGACCCCACCAGG - Intergenic
966874956 3:184316215-184316237 CCTCCCCACAGCCCCTCACCTGG - Exonic
967050805 3:185782811-185782833 CCACCTCCCAGTCCCCACCCTGG - Intronic
967171200 3:186824937-186824959 CCAACCCCCAGCCTCCCAGTGGG + Intergenic
967917270 3:194588016-194588038 CCACCCCCCAGTCACCCACTTGG - Exonic
968041883 3:195595848-195595870 CCACTCCCCAACACCCCCCCAGG + Intergenic
968110510 3:196042629-196042651 CCACTTCCCAGCCCCACAGCAGG - Intronic
968474330 4:795859-795881 CCACCGCCCACCCCACCTCCCGG + Intronic
968479218 4:826311-826333 CCACCCCCCGCCCCCGCCCCGGG - Intergenic
968479258 4:826373-826395 CCACCCCCCGCCCCCGCCCCGGG - Intergenic
968515928 4:1015589-1015611 GCACCCCCCTGCCCCACACAGGG - Intronic
968518958 4:1027208-1027230 CCACTCCCCAGCCCCTCCTCAGG + Intergenic
968649013 4:1753094-1753116 GGACCCCAGAGCCCCCCACCTGG - Intergenic
968704670 4:2072351-2072373 CCACCTCCCAGACCCCAAGCAGG + Intronic
968908677 4:3465927-3465949 CCACCCCCAGCCCCCGCACCTGG - Intronic
968972571 4:3803661-3803683 TCCTCCCCCAGCCCCCCACCCGG + Intergenic
968975782 4:3821436-3821458 CCATCCCCCAGACCCCACCCTGG - Intergenic
969228581 4:5814701-5814723 CCACACCCCTGCCCCCCACTGGG + Intronic
969271456 4:6106061-6106083 CCACGCCCAAGACACCCACCTGG + Intronic
969272518 4:6112609-6112631 CCCCCCCTCGGCCCCCCTCCTGG + Intronic
969314215 4:6371885-6371907 CCGCCCACCAGCCCCCCGGCAGG + Intronic
969344936 4:6564331-6564353 CCCACCCCCGCCCCCCCACCGGG + Intergenic
969358641 4:6647171-6647193 ACAGCCACCAGCCCCACACCTGG - Intergenic
969478532 4:7434736-7434758 GTACCCCACAGCCCCGCACCTGG + Exonic
969497598 4:7534987-7535009 CCACCCCACAGCCACCCAGATGG + Intronic
969517704 4:7656751-7656773 CCACCCCCATGCCCTGCACCAGG - Intronic
969715469 4:8866125-8866147 CCAAGCCCCAGCCCCCGCCCCGG - Intronic
971756626 4:30717033-30717055 CCCCCCCCCCCCCCCCCCCCCGG - Intergenic
971904640 4:32710680-32710702 CCCTCCCCCAACCCCCCAACAGG - Intergenic
972208119 4:36802657-36802679 CCTCCCTCCACCCCCCCAACAGG + Intergenic
972248814 4:37276977-37276999 CCATCCCCCAACCCCACAACAGG - Intronic
972320244 4:37966761-37966783 CCAGCCCCCTACCCCCCAACAGG + Intronic
972681977 4:41315062-41315084 TCAGCCCCCACCCCCCCAACAGG - Intergenic
972816605 4:42653157-42653179 CCTTCCCCCAGATCCCCACCAGG + Intronic
973806128 4:54527706-54527728 CCACCCCCTATCCCCCCAAGAGG - Intergenic
973984543 4:56337645-56337667 TCTCCCCCCGGCCCCCCAGCTGG + Intergenic
974731934 4:65878127-65878149 CCTCCCCCCACCCCACAACCTGG - Intergenic
975508383 4:75165116-75165138 CCAGCCCCCAACCCCCCAACAGG + Intergenic
975608835 4:76183716-76183738 CCACCCCCCAACCTCCCAGGAGG - Intronic
975686116 4:76918059-76918081 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
975765761 4:77666213-77666235 CCACCCTCCCGCCCCTCAACAGG - Intergenic
976265639 4:83185404-83185426 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
977390101 4:96398004-96398026 TCACCCCCCAACCCCTCAACAGG + Intergenic
978204761 4:106068299-106068321 CCATCCCCCCACCCCACACCAGG + Intronic
978459421 4:108934327-108934349 CAGCCCCCCATCCCCCCAACAGG - Intronic
978717700 4:111866093-111866115 CCAGCCCCCAACCCCCCAACAGG + Intergenic
979624112 4:122827040-122827062 CGGCCCCCCAGCCTCCCGCCCGG - Exonic
979963268 4:127046897-127046919 TCACCCCCCATCCCCCAACAAGG + Intergenic
980625886 4:135374322-135374344 TCACCCCCCCACCCCCCAACTGG + Intergenic
981127524 4:141123699-141123721 CCACCGCCCAACCCCACAACAGG + Intronic
982280702 4:153681236-153681258 CCAGCCCCCAGCCCCACTTCTGG + Intergenic
983843696 4:172488832-172488854 CCACCCCCCACCCCCACCCCAGG - Intronic
984329625 4:178298065-178298087 CTGCCCCCCCGCCCCACACCAGG - Intergenic
984422760 4:179546323-179546345 CCCCCCACCACACCCCCACCAGG + Intergenic
984780000 4:183516808-183516830 CCGCCCCCCTGCCCCCCACTTGG + Intergenic
984803763 4:183735895-183735917 CGACCCCCCCACCCCCCTCCCGG + Intergenic
984804105 4:183736675-183736697 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
984923410 4:184785594-184785616 CCCCCCCCCCGCCCCCGCCCAGG - Intronic
985324914 4:188756000-188756022 CCTCCCCCCACCCTGCCACCAGG - Intergenic
985466696 4:190203571-190203593 CCACCCCCGCGCTCCCCGCCCGG + Intergenic
985512851 5:321887-321909 CCGTCCCTCAGCCCCACACCCGG - Intronic
985562966 5:601203-601225 ACACCCTCCAGCCCCCTCCCAGG - Intergenic
985578061 5:682790-682812 CCACCCCACAGCCATCCACATGG - Intronic
985634233 5:1028132-1028154 CCAGCACCCAGCCCCCGTCCTGG - Intronic
985789184 5:1916166-1916188 CCACCCCAGAACCCCACACCTGG - Intergenic
985950414 5:3218260-3218282 CCATCGCCCGGCCCCTCACCTGG - Intergenic
986144156 5:5061522-5061544 CCATCCCCCAACCCCACAACAGG + Intergenic
986447696 5:7836877-7836899 CCACCCCCTACCCCCACCCCTGG - Intronic
986621341 5:9678774-9678796 CCTCCCCCAAACCCCCCAACAGG - Intronic
986710626 5:10485854-10485876 CCCCCCCCCACCCCGCGACCTGG - Intergenic
987129889 5:14850549-14850571 TCACACCTCAGCCCCCCTCCGGG + Intronic
987132424 5:14871881-14871903 CCCCTCCCCAGCCCGCCCCCGGG - Intergenic
987301767 5:16603852-16603874 CCACCCCCCACCCGCCACCCTGG + Intronic
987427004 5:17785002-17785024 CCAGCCCCCCACCCCCCAACAGG - Intergenic
987647672 5:20696427-20696449 CCCCCGCCCACCCCCCGACCTGG + Intergenic
988055448 5:26088420-26088442 CCAGCCCCCCACCCCCCAACAGG - Intergenic
988506139 5:31825073-31825095 CCACCTCCTGGCCACCCACCAGG + Intronic
988724699 5:33914849-33914871 CCAGCCCCCCACCCCCCAACAGG + Intergenic
988796583 5:34657233-34657255 CCCACCCCCCACCCCCCACCAGG - Intronic
989390986 5:40900285-40900307 CCATCCCCCTACCCCCCAACAGG - Intergenic
989774087 5:45181982-45182004 CCAGCCCCCACCTTCCCACCAGG + Intergenic
990141835 5:52713719-52713741 CCAGCCCCCTACCCCCCAACAGG - Intergenic
990195036 5:53305318-53305340 CTAGCCCCCACCCCCCCAACAGG + Intergenic
990307561 5:54507918-54507940 CCACTCCCTACCCCTCCACCAGG + Intergenic
991078185 5:62565777-62565799 TCACCCCCTACCCCCCCAACTGG + Intronic
991224573 5:64255347-64255369 CCTCGCCCCAGCCCCACAACAGG + Intronic
992054696 5:72976778-72976800 CCAGCCCCCAACCCCCAAACAGG + Intronic
992105420 5:73446725-73446747 CAGCCCCCCAACCCCCGACCTGG - Exonic
992288470 5:75260307-75260329 CTAGCCCCCAACCCCCCAACAGG - Intergenic
992340914 5:75822609-75822631 CTAGCCCCCAACCCCCCAACAGG - Intergenic
993282202 5:85939009-85939031 CATCCCCCCACCCCCCAACCCGG - Intergenic
993345039 5:86772466-86772488 CCAGCCCCCCACCCCCCAACAGG + Intergenic
993459697 5:88168183-88168205 CCTTCCCCTAGCCCCCCAACAGG + Intergenic
994284595 5:97949497-97949519 CAATCCCCCAACCCCCCAACAGG + Intergenic
994379707 5:99056821-99056843 TCACACCCCTGCCCCCGACCTGG - Intergenic
994388839 5:99165384-99165406 CCATCCCCCCACCCCCCAGCAGG + Intergenic
994670372 5:102755495-102755517 CCATCCCCCCACCCCCGACCCGG - Intronic
994702989 5:103161107-103161129 CCAACCCCCACCCCCACAACAGG + Intronic
994830970 5:104783611-104783633 CCAGCCCCCCACCCCCCAACAGG - Intergenic
995363328 5:111324997-111325019 CCTTCCCCCAACCCCCCAACAGG + Intronic
996393570 5:122989518-122989540 CCTGCCCCCGCCCCCCCACCCGG - Intronic
996649619 5:125858423-125858445 TCTCTCCCCAACCCCCCACCAGG + Intergenic
996900818 5:128539094-128539116 CCTACCCCCACCGCCCCACCGGG + Intronic
997294994 5:132763586-132763608 CCACCCACAAGCCCCCGACCAGG + Intronic
997302000 5:132813389-132813411 CCCACCCCCAGCGCCCCGCCGGG - Intergenic
997470171 5:134113251-134113273 CCACCCCCCAGCCCCAGCCTGGG + Intergenic
998142777 5:139709511-139709533 CCTCCCCTCAGCGCCCCGCCGGG - Intergenic
998172084 5:139878396-139878418 CCCCATCCCAGCCCACCACCCGG - Intronic
998431622 5:142075286-142075308 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
998530674 5:142881415-142881437 CCACCCCCCAGCCGCCGCCCCGG - Intronic
999044006 5:148448277-148448299 CCACTCCCCAGCCCCTCCCTAGG + Intergenic
999465878 5:151803990-151804012 CCACCACCCAGCCCACCTCGAGG - Exonic
1000023539 5:157339283-157339305 CCACTCCCCCAACCCCCACCCGG - Intronic
1000294420 5:159900724-159900746 CCACCCCCCAACCTGCCAGCTGG - Intergenic
1000858653 5:166430594-166430616 CCTCCCCCCTCCCCCCAACCCGG + Intergenic
1001139734 5:169134593-169134615 CCAGCCCCCAGCCCTCCGACAGG - Intronic
1001450500 5:171820805-171820827 CCACCCCCCTCCCCCACTCCTGG - Intergenic
1001596341 5:172901236-172901258 CCTCCCCCTCACCCCCCACCAGG - Intronic
1001664449 5:173421062-173421084 CCAGCCCCCAGCCCCCCACCTGG - Intergenic
1001980685 5:176035488-176035510 CCCCAAACCAGCCCCCCACCAGG + Intergenic
1002067256 5:176658032-176658054 CCACCCCTCAGACCCTCTCCTGG - Exonic
1002131825 5:177086797-177086819 ACGCCCCCCCCCCCCCCACCCGG - Intergenic
1002175491 5:177399115-177399137 CCCACCCCCTGACCCCCACCTGG + Intergenic
1002194425 5:177494551-177494573 CCGCCCCCCACCCCCTCTCCAGG - Intronic
1002236776 5:177808577-177808599 CCCCAAACCAGCCCCCCACCAGG - Intergenic
1002355696 5:178627218-178627240 CCCCCCCCCCCCCGCCCACCCGG + Intronic
1002711416 5:181197437-181197459 CCCCACCCCAGGCCCCTACCTGG - Intronic
1002909188 6:1475839-1475861 CCTCACCCCAACCCCCCAACAGG - Intergenic
1003337486 6:5187597-5187619 CCAGCCCCCAACCCCCCGACAGG - Intronic
1003739569 6:8920598-8920620 CTAACCCCCAACCCCCCAACAGG - Intergenic
1003764556 6:9220447-9220469 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1004012395 6:11702287-11702309 CCACGCCCCAGACCACCATCTGG + Intergenic
1004620320 6:17325644-17325666 CCAACCCACAGACCCCGACCGGG - Intergenic
1005291136 6:24380033-24380055 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1005608569 6:27500482-27500504 TCACCCGCCAGCCACCAACCTGG - Intergenic
1005837284 6:29718879-29718901 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1005990116 6:30897292-30897314 CCACCCCCCTGCCCCACCTCAGG - Intronic
1006132933 6:31879621-31879643 CCACCTCCCTGCCCCGCACTGGG + Intergenic
1006271405 6:32969390-32969412 CCACTCCTCAGCCCACCGCCAGG - Intronic
1006333954 6:33410957-33410979 CCACCACCCTCCCCCCCAACCGG + Exonic
1006367080 6:33621989-33622011 CCACCCACCTGCCCGCCCCCGGG - Intronic
1006492687 6:34398490-34398512 CGACCCCCCAACCTCCCTCCCGG - Intronic
1006521886 6:34575568-34575590 CCACCCCTCCGCCCCCCTCTGGG + Intergenic
1006950925 6:37820176-37820198 CCCACCCCCAGCTCCCCACCCGG - Intronic
1007152038 6:39703073-39703095 CAACCCCCCACCCCCACTCCCGG + Intronic
1007302229 6:40876038-40876060 CCCACCCCCAGCCCTCCCCCAGG - Intergenic
1007419843 6:41712881-41712903 GCACCACCCACTCCCCCACCCGG + Intronic
1007924095 6:45637431-45637453 CCAACCCCTGGCACCCCACCTGG + Intronic
1007965716 6:46001999-46002021 CCACCCCCACCCCCCACACCAGG + Intronic
1008659484 6:53651777-53651799 CCTCGTTCCAGCCCCCCACCAGG + Exonic
1009366394 6:62860911-62860933 CCACCCACCAACCCGCCACATGG + Intergenic
1009689990 6:67018277-67018299 CCACCCCCCCACCCCACAACAGG + Intergenic
1009751582 6:67883979-67884001 CCACACCCCAGGAACCCACCAGG - Intergenic
1009794479 6:68450137-68450159 CCAGCCCCCAACCCCCCAACAGG + Intergenic
1009964841 6:70567134-70567156 CTCCCGCCCAGCCGCCCACCCGG + Intronic
1010030246 6:71266040-71266062 TGACCCCCCCGCCCCCCTCCTGG + Intergenic
1010269374 6:73903423-73903445 CCATGCCCGAGCCCCCCCCCCGG + Intergenic
1011405005 6:87009692-87009714 CGACCCCCCAACCTCCCTCCCGG + Intronic
1012009889 6:93770260-93770282 CCTCCCCCCACCCCACCACAAGG + Intergenic
1012399405 6:98832062-98832084 CCACACCCCCGCCCTCCTCCCGG - Intergenic
1012958223 6:105593471-105593493 CCCCTCCCCACCCCCTCACCCGG - Intergenic
1013272888 6:108559722-108559744 CCGCCGCCCAGCCCTCCCCCTGG + Intergenic
1013594684 6:111649890-111649912 CCACCCCCATGCCCACCACCAGG - Intergenic
1013876474 6:114836686-114836708 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1014116896 6:117676092-117676114 CCACCCCCCACCACCGCACCGGG - Intronic
1014146088 6:117999484-117999506 CGACCCCCCACCCCCACCCCTGG + Intronic
1014764162 6:125389141-125389163 CCCCCCCCCGGCCTCCCTCCCGG + Intergenic
1015199939 6:130568140-130568162 CCACCTCCCACCCATCCACCCGG + Intergenic
1015706988 6:136098923-136098945 CCAGCCCCCCACCCCCCAACAGG + Intronic
1015731389 6:136351931-136351953 CCTCCCCCCAGCACCCCCACTGG + Intronic
1015919843 6:138255721-138255743 CTACCCCCCACCCCAGCACCGGG + Exonic
1016138742 6:140581986-140582008 CATCCCCCCAACCCCCCAACAGG - Intergenic
1016955501 6:149622755-149622777 CCACCCCCCGCCCCCCTGCCAGG - Intronic
1017756201 6:157531590-157531612 CCACCCCCCAACCCCCACACTGG + Intronic
1017801159 6:157897655-157897677 CCACCGCCCACCGCCACACCCGG + Intronic
1018211232 6:161484017-161484039 CCTCCCCACAACCCCCCAGCAGG - Intronic
1018650571 6:165988495-165988517 CCGCACCCCAGCCTCCCTCCAGG - Intergenic
1018816570 6:167336983-167337005 CCACACCCCAGCCCTCACCCTGG + Intronic
1019178846 6:170175133-170175155 CTACCCCCCAGCCTCCCTCGAGG + Intergenic
1019278712 7:189181-189203 CCACCCCGCAGGCCTCCACGGGG + Intergenic
1019328367 7:450790-450812 CCACCCCCCAACCCACCCACAGG + Intergenic
1019337811 7:493657-493679 CCACCCCCCAGCCCTGCCGCGGG - Intergenic
1019458828 7:1146458-1146480 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1019459052 7:1146976-1146998 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1019556470 7:1633928-1633950 GCACCCCCAAGTCCCCCACCAGG - Intergenic
1019611981 7:1941286-1941308 CCAGCCCCCAGCCCCCAGCCAGG + Intronic
1019707821 7:2504912-2504934 ACACCCCCCCCCCCCCCCCCCGG + Intergenic
1019781019 7:2939730-2939752 CCCGCCCCCAGGCCCTCACCTGG + Exonic
1019917787 7:4144541-4144563 CCCCTCCCCAGCCCGCCATCTGG - Intronic
1020088670 7:5325057-5325079 GCCCCCCACAGCCCCCAACCAGG + Intronic
1020106354 7:5423938-5423960 CCCCCCCCCAGCCCGGCCCCCGG + Intronic
1020476187 7:8597702-8597724 CTGCCCCCCCGCCCCCCACCCGG - Intronic
1020773559 7:12426198-12426220 CCAGCCCCCAATCCCCCAACAGG + Intergenic
1021221073 7:17975809-17975831 CCTCCCCCCACCCCCACCCCGGG - Intergenic
1021240285 7:18192112-18192134 ACACCCCCCCGCCCCCCGGCCGG - Intronic
1021615553 7:22499875-22499897 GCTCCCCCCAGCCCCCGGCCCGG + Intronic
1021672368 7:23046331-23046353 CCCCCCCCCAACCTCCCTCCCGG + Intergenic
1021672576 7:23047013-23047035 CCACCTCCCAGCCGCCTGCCTGG - Intergenic
1021677988 7:23100120-23100142 CCAGACCCCTGCCCACCACCTGG + Intergenic
1022016533 7:26354424-26354446 CAACCTCCCACCCACCCACCAGG + Intronic
1022020886 7:26398552-26398574 CCACCCCCCAGCCGCCGAGCCGG - Intergenic
1022204204 7:28147772-28147794 CCTCCCCCCAGCCCACTCCCAGG - Intronic
1022507498 7:30915930-30915952 CCAGCCCCCAGCCCCTCCCTGGG - Intronic
1023190049 7:37570555-37570577 CCTCCTCCCCACCCCCCACCAGG - Intergenic
1023290813 7:38667205-38667227 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1023727500 7:43159331-43159353 CCAGCCCCCAACCCCCCGACAGG + Intronic
1023888372 7:44376295-44376317 CCACCCCCAACCCCCCCCCGAGG + Intergenic
1023922107 7:44637733-44637755 CCACCCCCCAACCCCCATCCCGG - Intronic
1024540548 7:50472225-50472247 CCAGCCCCAAGCCCAGCACCTGG + Intronic
1024559109 7:50628559-50628581 CCACCCCCACCACCCCCACCTGG - Intronic
1025205642 7:56992057-56992079 GCCCCCCACAGCCCCCCACCAGG - Intergenic
1025666298 7:63584881-63584903 GCCCCCCACAGCCCCCCACCAGG + Intergenic
1025852930 7:65258414-65258436 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1025853339 7:65259307-65259329 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1025994137 7:66517562-66517584 ACAAACCCCAGCCCCCCAACAGG + Intergenic
1025996048 7:66528202-66528224 GCAACCCCAGGCCCCCCACCAGG - Intergenic
1026033853 7:66817132-66817154 ACAAACCCCAGCCCCCCAACAGG - Intergenic
1026057546 7:66997631-66997653 CCACCCCCCCGCCCCCGAGATGG + Intronic
1026562512 7:71462149-71462171 GCACCCCACAGTGCCCCACCAGG - Intronic
1026641488 7:72130057-72130079 ACACTCCCCCACCCCCCACCAGG + Intronic
1026891760 7:73986431-73986453 CCACCCGCCTGCCCGCCAACAGG - Intergenic
1026943544 7:74302458-74302480 ACACACCTCAGCCTCCCACCAGG + Intronic
1027189403 7:75988718-75988740 TTCCCCTCCAGCCCCCCACCCGG - Intronic
1027189415 7:75988743-75988765 TTCCCCTCCAGCCCCCCACCTGG - Intronic
1027189428 7:75988771-75988793 TTCCCCTCCAGCCCCCCACCCGG - Intronic
1027353427 7:77334416-77334438 CCTTCCCCCAACCCCCCAACAGG - Intronic
1027373730 7:77533530-77533552 CGACCCCCCCACCTCCCACCCGG + Intergenic
1027876354 7:83774256-83774278 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1028326076 7:89526075-89526097 CCCTCCCCCCTCCCCCCACCCGG - Intergenic
1028606389 7:92660778-92660800 TCATCCCGCAGCCCCCCAGCTGG - Intronic
1028683606 7:93567698-93567720 CCAGCCCCCTGCCCCCCAACAGG + Intronic
1029053314 7:97712566-97712588 CCAGCCCCCAATCCCCCAACAGG - Intergenic
1029419788 7:100466708-100466730 CCAACCCCCACCCTCCCTCCTGG - Exonic
1029422333 7:100477925-100477947 CTACCCCACAGCCCCCAACCGGG - Exonic
1029429947 7:100523379-100523401 CCACCCCCCCGCCTCCTTCCCGG + Intergenic
1029482118 7:100819677-100819699 CCACCACCCAGGGCTCCACCAGG + Exonic
1029716303 7:102328996-102329018 CCACCTCCCAGCCCCCACCAGGG + Intergenic
1029722938 7:102382202-102382224 CCACCTCCCAGCCCCCACCAGGG + Intronic
1029738660 7:102479090-102479112 CCACCCCGCACCCCGCCCCCCGG + Intergenic
1030217052 7:107054960-107054982 CCATCCCCCAACCCCACAACAGG + Intronic
1030481775 7:110113619-110113641 CCACCCCCCCCCCCCCCACCAGG + Intergenic
1031069197 7:117143075-117143097 CCTCCCACCAGGACCCCACCAGG - Intronic
1032087556 7:128891751-128891773 CCACCCCCGAGACCCCTGCCAGG - Exonic
1032562366 7:132905441-132905463 CCTCCCGACAGCCCCCCAGCAGG - Intronic
1032703072 7:134398940-134398962 CCACCCCCCAGCCACCAAGACGG + Intergenic
1032842758 7:135727169-135727191 CCAACCCCATGGCCCCCACCGGG - Intronic
1033324007 7:140362889-140362911 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1034268342 7:149791703-149791725 CACCACCCCAGCCCCTCACCTGG - Intergenic
1034456615 7:151174294-151174316 CTGCCCTCCAGGCCCCCACCAGG - Intronic
1034478270 7:151301321-151301343 CCACCTCCTAGCCTCCCACTAGG - Intergenic
1034601606 7:152262426-152262448 CTACCCCACTGCCCCCAACCCGG + Intronic
1034638471 7:152585581-152585603 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1035020408 7:155797244-155797266 GCTCCCCCCAGCCCCCGACCCGG + Intergenic
1035024138 7:155815368-155815390 CCAGCCCCCAGGCTCCCTCCTGG + Intergenic
1035287001 7:157813129-157813151 CCTCCCCCAAGCCAACCACCCGG + Intronic
1035369106 7:158367486-158367508 CCACCGCCCAGCCTCCCAGTTGG - Intronic
1035611444 8:968255-968277 CCTGCCCCCAACCCCCCAGCTGG + Intergenic
1036396771 8:8377196-8377218 CCAGCCCCCGGCCCACCCCCGGG - Exonic
1036640328 8:10579596-10579618 CCCCCACCCGGCCCCCCACTGGG + Intergenic
1036642489 8:10593022-10593044 CCAGCCCCCAGCACCTCCCCTGG + Intergenic
1036701240 8:11015473-11015495 CCACCCCCCACCCCCACCTCGGG + Intronic
1037064990 8:14566880-14566902 CGAGCCCACAGCCGCCCACCTGG - Intronic
1037169751 8:15877223-15877245 CCACCCGCCACCACCCCACATGG + Intergenic
1037281374 8:17246523-17246545 CCAGCCCCCAACCCGCCGCCAGG + Intronic
1037804063 8:22049573-22049595 CCCCCCCCCGCCACCCCACCAGG + Intronic
1037994013 8:23339861-23339883 CCAGCCCCCAGCCCCTCACATGG - Intronic
1038195158 8:25360418-25360440 CCACCCCCCACCCCCCATACTGG - Intronic
1038311691 8:26449973-26449995 CCACCCCGCCGCCCCGCCCCTGG - Intronic
1038582752 8:28764332-28764354 CCATCCCCCCGCCCCCTCCCCGG + Intergenic
1038872773 8:31514285-31514307 CCAGCCCCCAGCCCCCCAACAGG + Intergenic
1039042582 8:33422397-33422419 GCACCCCCCACCACCACACCCGG - Intronic
1039362403 8:36892488-36892510 CCCACCCCCCACCCCCCACCAGG + Intronic
1039542198 8:38381862-38381884 CCGCACCCCAGCCCCACTCCGGG - Exonic
1039669313 8:39578874-39578896 GCAGCCCCCCTCCCCCCACCAGG - Intergenic
1039881172 8:41626445-41626467 CCCCCCCCCAACCTCCCTCCCGG + Intergenic
1040447215 8:47507533-47507555 CCTTCCCTCAGCCCCCCACCAGG - Intronic
1040897843 8:52387954-52387976 CCACCCCCCCGCCCCACGCCGGG + Intronic
1041345811 8:56896765-56896787 CCTCCCCCCACCCCGCCAACAGG - Intergenic
1041364646 8:57089134-57089156 CCTCCCCCCACCCCTCCAACAGG + Intergenic
1041547892 8:59067112-59067134 CAACCCCCCGGCCCCCCTTCTGG - Intronic
1041552839 8:59119802-59119824 CCGCCCCGCAGCCCCGCCCCCGG + Intergenic
1041644513 8:60237855-60237877 CTTCCCCCCAGCCCACCAACAGG + Intronic
1042555860 8:70033315-70033337 CCACCCCCCATCCCCGACCCCGG + Intergenic
1043226176 8:77733969-77733991 CCACGCCCCAGCCCCACCCCCGG + Intergenic
1043243844 8:77973324-77973346 CTAGCCCCCAACCCCCCAACAGG - Intergenic
1044580279 8:93819489-93819511 CCACTCCCCAGCCCCTCAGAAGG + Intergenic
1044967474 8:97586918-97586940 CCACCCCCAACCCCCCGCCCTGG - Intergenic
1045112877 8:98949986-98950008 CCACCCCCCACCCTCCACCCAGG + Intronic
1045155000 8:99458065-99458087 CCTCCCCCCAACCCCACAACAGG + Intronic
1045202281 8:99996104-99996126 CCAGCCCCCCACCCCCCAACAGG - Intronic
1045495922 8:102708530-102708552 CCAGCCCCCAACCCCCCAATAGG + Intergenic
1045507242 8:102787467-102787489 CCCCCCCCCCCCCCCCCCCCAGG - Intergenic
1046395948 8:113639719-113639741 CCAGCCCCCAACCCCACAACAGG + Intergenic
1046636821 8:116680023-116680045 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1047219872 8:122910729-122910751 CCACCCCCCACCCCCCAGCAGGG - Intronic
1047731860 8:127735151-127735173 CCACCCCCACGCCTCCCACACGG - Intergenic
1048189441 8:132274755-132274777 CCACTTCCCAGCACCCCACTGGG - Intronic
1048381704 8:133871202-133871224 CCTCCCGCCACCCCGCCACCAGG + Intergenic
1048669972 8:136707566-136707588 CCATCCCCCCGCCCCACAACAGG + Intergenic
1048695795 8:137026385-137026407 CCTCCCCCCAACCCCACAACAGG - Intergenic
1048851303 8:138647677-138647699 CGAACCCCCACCCTCCCACCTGG - Intronic
1048981379 8:139704652-139704674 CCACCCCCCACCTAGCCACCCGG + Intergenic
1049222476 8:141434309-141434331 CCCCTCCCCAGGCCCCCATCAGG - Intergenic
1049360912 8:142212250-142212272 CCAGCCCCGAGCACCCCTCCTGG - Exonic
1049404730 8:142447327-142447349 CCAGCCCTCAGCCCCTCCCCAGG - Intergenic
1049422782 8:142524324-142524346 CCACTCCCCACGACCCCACCTGG + Intronic
1049447001 8:142635784-142635806 ACACCCCACAGCCCACCACCTGG + Intergenic
1049496877 8:142939726-142939748 CCACCCCACATCCCACCATCCGG + Intergenic
1049496893 8:142939781-142939803 CCACCCCACATCCCACCATCCGG + Intergenic
1049496909 8:142939836-142939858 CCACCCCACATCCCACCATCCGG + Intergenic
1049496920 8:142939873-142939895 CCACCCCACACCCCACCATCCGG + Intergenic
1049605377 8:143526821-143526843 CCACTCCCCAGTCCCTCAACAGG + Intronic
1049621039 8:143598480-143598502 CCAGCCCCGAGCCCCGCGCCCGG + Exonic
1049756998 8:144315243-144315265 CCCACACCCATCCCCCCACCAGG + Exonic
1049783435 8:144439351-144439373 CCTCCCCCCAGCAACCAACCTGG + Intronic
1049799278 8:144510290-144510312 CCACCTCCCTTCTCCCCACCTGG - Intronic
1049811221 8:144573449-144573471 CCAGCCCCCCACCCCCCAACAGG - Intronic
1049883082 9:11159-11181 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
1051021020 9:12542874-12542896 CCAGCCCCCAACCCCCCAACGGG + Intergenic
1051374384 9:16388907-16388929 CCACCACCCTGCCCTCCTCCAGG + Intergenic
1051481828 9:17569977-17569999 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1051619429 9:19036098-19036120 CCAGCCCCCTACCCCCCGCCAGG - Intronic
1052355429 9:27500207-27500229 CCACCCCCCAACCCAGCACAGGG - Intronic
1052997624 9:34559613-34559635 CCGCCCCCCACCCCACCCCCAGG - Intronic
1053160389 9:35809963-35809985 CCACCACCCAGCCTTCCTCCGGG + Intronic
1053530159 9:38873143-38873165 CCCCCCCTCCGCCCCCCACCAGG - Intergenic
1053697384 9:40650682-40650704 CACCCCCCCACCCCCCCCCCCGG - Intergenic
1053787429 9:41662809-41662831 CCACCTCCCAGCCCCTCCACAGG + Intergenic
1054157697 9:61651958-61651980 CCACCTCCCAGCCCCTCCACAGG - Intergenic
1054175705 9:61874148-61874170 CCACCTCCCAGCCCCTCCACAGG + Intergenic
1054202385 9:62097570-62097592 CTCCCCCCCCGCCCCCCACCAGG - Intergenic
1054407342 9:64773775-64773797 CCCCCCCCCACCCCCCTCCCCGG - Intergenic
1054477471 9:65582963-65582985 CCACCTCCCAGCCCCTCCACAGG - Intergenic
1054635974 9:67490790-67490812 CCCCCCCTCCGCCCCCCACCAGG + Intergenic
1054661834 9:67706662-67706684 CCACCTCCCAGCCCCTCCACAGG - Intergenic
1054690416 9:68317888-68317910 CCACCCCCTTCCCCCCCCCCCGG - Intergenic
1055130430 9:72768316-72768338 CTAGCCCCCAACCCCCCAACAGG - Intronic
1055180299 9:73379153-73379175 CCAACACCCAACCTCCCACCAGG - Intergenic
1055481877 9:76716808-76716830 TCGCCCCCCAACCCCCCAACAGG + Intronic
1055520424 9:77075170-77075192 TCACCCACCAGCCCCTCCCCAGG - Intergenic
1056487707 9:87075739-87075761 CTGCCCCCCAGCTCCCCACAGGG + Intergenic
1056810187 9:89757920-89757942 CCCCACCCCAGCCACCCACGAGG + Intergenic
1057048261 9:91902483-91902505 CGACCACCCAGCTCCCCATCGGG - Intronic
1057738818 9:97692855-97692877 CCACCCCCCAACCCCACCCTGGG + Intronic
1057742691 9:97726011-97726033 CTAGCCCCCAGCCCCTGACCAGG - Intergenic
1058225090 9:102350391-102350413 GCGCCCCCCAGCCCCCGACAGGG - Intergenic
1058346642 9:103971531-103971553 TCACCCCCCCATCCCCCACCAGG + Intergenic
1059176611 9:112174830-112174852 CCAGCCCCCACCCCGCCTCCTGG + Intronic
1059455650 9:114398503-114398525 CCACCGCCCCGCCCCGCGCCCGG - Intergenic
1060029660 9:120203407-120203429 CAACCCCACAGTCCCCCACCAGG + Intergenic
1060295625 9:122341108-122341130 CCGCCCCCCACCTCCCAACCCGG + Intergenic
1060337277 9:122737349-122737371 CCCTCCCCCAGCCCTCCACCCGG + Intergenic
1060401910 9:123354386-123354408 GCTCCCCCCAGCCCCCCATTGGG + Intergenic
1060530426 9:124344427-124344449 CCACCACAAAGCCCCGCACCTGG + Intronic
1060823846 9:126676393-126676415 CCAGCACCCAGCACCGCACCTGG + Intronic
1060824439 9:126679929-126679951 CCACCACTCTGCCCTCCACCCGG + Intronic
1061015448 9:127978594-127978616 CCACCCCGCACCCCGCCCCCTGG - Intronic
1061063238 9:128261286-128261308 CCAGCCACCAGCCCCTCTCCAGG - Intronic
1061262946 9:129490028-129490050 TCACCCCCTACCCCTCCACCTGG + Intergenic
1061366066 9:130172887-130172909 CCGCGCCCCTGCCCCCCGCCCGG + Intronic
1061608943 9:131733353-131733375 CCCCCCCCCCGCCCCCGCCCCGG - Intronic
1061793535 9:133071172-133071194 CCACCCCTGTGCCCCCCACAGGG + Exonic
1061814858 9:133188578-133188600 CCAGCCGCCAGGCCCCCAGCAGG - Intergenic
1061826544 9:133261558-133261580 CCACCCTCCTGCCCACCTCCCGG - Intronic
1061881694 9:133572180-133572202 CCACCCCCCACCCCGCCCCAGGG + Intronic
1061912419 9:133732245-133732267 CCCCACCCCAGCCCCCCGCAGGG + Intronic
1062017387 9:134297662-134297684 CCAGCCCCCAGCCCCTCAGAGGG + Intergenic
1062174576 9:135153821-135153843 CCACCCCTCTGCACCCCAGCAGG + Intergenic
1062176230 9:135164488-135164510 CCACCCCCCAGCCCCCTCATCGG - Intergenic
1062192784 9:135256344-135256366 CTGCCCCCCTGCTCCCCACCTGG + Intergenic
1062200603 9:135300781-135300803 CCAGCCCCAAGCCCTCCATCTGG - Intergenic
1062327210 9:136018011-136018033 GCTGCCCCCCGCCCCCCACCGGG - Intronic
1062339937 9:136089477-136089499 TCACCCCCCACAACCCCACCTGG + Intronic
1062344873 9:136109972-136109994 ACACCCCCCACCCCACCGCCTGG - Intergenic
1062436184 9:136547554-136547576 CCACCCCACCCCCACCCACCAGG - Intergenic
1062460421 9:136660455-136660477 CCTGCCCCCAGCCCCTCCCCAGG - Intronic
1062479533 9:136744933-136744955 CCACCACACAGCTCCCCACATGG + Intronic
1062532898 9:137009487-137009509 CCACCCCACAGCACCCCTTCCGG - Intronic
1062562530 9:137147987-137148009 CCGGCCCCCAGCCCCGCCCCGGG + Intronic
1062612247 9:137380447-137380469 CCGCACCCCAACCCCCCTCCGGG + Intronic
1062622336 9:137428662-137428684 CCTCTCCCAATCCCCCCACCCGG - Intronic
1062622383 9:137428760-137428782 CCTCCCCCAGTCCCCCCACCTGG - Intronic
1062633585 9:137478399-137478421 CCACTCTCTGGCCCCCCACCCGG - Intronic
1062699024 9:137889616-137889638 CCACCCGCCACCGCCCCACCTGG - Intronic
1062714260 9:137998099-137998121 GCAACCCCCACCCCACCACCAGG - Intronic
1062723010 9:138054200-138054222 CCCCTCCCCAGCACCACACCAGG + Intronic
1203780291 EBV:96841-96863 CCACCGCGCAGGCCCCCTCCAGG + Intergenic
1185467217 X:362145-362167 ACACGCCTCAGCCCCTCACCCGG + Intronic
1185660096 X:1720507-1720529 CCACATCCCAGCCACCCACATGG - Intergenic
1186033001 X:5390700-5390722 CAGCCCCCCCGCCCCACACCGGG - Intergenic
1186443499 X:9606094-9606116 TGACCCCCCAGCCCCACACGAGG - Intronic
1186539903 X:10389716-10389738 CCACCCCCCCCCCCCCCACAAGG - Intergenic
1186586038 X:10874035-10874057 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1186950115 X:14615185-14615207 CCACCCCTCAGCACAACACCTGG + Intronic
1187268063 X:17755488-17755510 CCAACCCCTACCCCCACACCAGG + Intergenic
1188298698 X:28482124-28482146 CCAGCCCCCACCCCCACAACAGG + Intergenic
1188367675 X:29333800-29333822 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1188463892 X:30456419-30456441 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1188928940 X:36080773-36080795 CCATCCCCCAACCCCACAACAGG - Intronic
1188950713 X:36370248-36370270 CCAGCCCCCCACCCCCCAGCAGG + Intronic
1189324457 X:40104615-40104637 CCCACCCCCTGCCCCCGACCGGG + Intronic
1189461086 X:41243532-41243554 CCCCCCCCCCGCCCCCCGCTCGG - Intergenic
1189480594 X:41389653-41389675 CCCCCCCCCACCCCCCAACCTGG + Intergenic
1189843374 X:45106269-45106291 CCACCTCCCCACCCACCACCAGG + Intronic
1190024673 X:46912553-46912575 CCTCGCCCCCGCCCCCCGCCGGG - Exonic
1190708141 X:53047988-53048010 CAACCCCCCAGCCAACCTCCAGG + Intergenic
1190779293 X:53579017-53579039 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1191072600 X:56418116-56418138 CCACCCCCCACCCAACCCCCAGG + Intergenic
1191210117 X:57875930-57875952 CCACCCCCCAGCCCCCAGAGAGG + Intergenic
1191253374 X:58269687-58269709 CCACCCCCCGCCCCCACCCCGGG + Intergenic
1192180065 X:68910807-68910829 CCAGCCCCCAGCCCCAGCCCAGG - Intergenic
1192305591 X:69956485-69956507 GCACCCCCCACCACCACACCCGG + Intronic
1192343140 X:70280579-70280601 CCACCCCACAGTCTCTCACCTGG - Exonic
1192567900 X:72179172-72179194 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1192788635 X:74358009-74358031 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1193191246 X:78573365-78573387 ACACCACCCACCCCCCGACCTGG - Intergenic
1193615276 X:83680167-83680189 CCCTCCCCCAGCCCCCCAACAGG + Intergenic
1193777629 X:85663185-85663207 CCACCCCCCCACCCCCCAACAGG - Intergenic
1193926129 X:87487677-87487699 CCACCCGCCACCCCCCCCCCCGG - Intergenic
1194029578 X:88795507-88795529 CCAACCCCCCACCCCCCAACAGG + Intergenic
1194039849 X:88927410-88927432 CTACTCCCCAACCCCCCAACAGG + Intergenic
1194913532 X:99676513-99676535 CTTCCCCCCAGCCCCACAACAGG - Intergenic
1194989759 X:100534513-100534535 CCAGCCCCCCACCCCCCAACAGG - Intergenic
1194990014 X:100537275-100537297 CCAGCCCCCCACCCCCCAACAGG + Intergenic
1195105907 X:101601156-101601178 CCCCCACCCCGCCCCCCTCCAGG + Intergenic
1195106976 X:101612611-101612633 CCCCCACCCCGCCCCCCTCCAGG - Intergenic
1195200582 X:102546864-102546886 CCCCCGCACCGCCCCCCACCAGG - Intergenic
1195405296 X:104506122-104506144 CCTCCCCCCAACCCCACAACAGG + Intergenic
1195671201 X:107471448-107471470 CCACCCGCCATCCCCCCAACAGG + Intergenic
1195678116 X:107522913-107522935 CCACCCCCCGCCACCCCACGAGG - Intronic
1195947993 X:110235806-110235828 CCAGCCCCCAACCCCACAACAGG - Intronic
1196011398 X:110891708-110891730 CCAGCCCCCGACCCCCCAACAGG - Intergenic
1196132561 X:112172999-112173021 CCTCCCCCGACCCCCCCAACAGG - Intergenic
1196166950 X:112545954-112545976 CCAGCCCCCAACCCCCAAACAGG + Intergenic
1196393534 X:115234167-115234189 CCTCCTCCCAGCCCGCCCCCTGG - Intergenic
1196592352 X:117501085-117501107 CCCTCCCCCAGCCCCCCAACAGG - Intergenic
1196854524 X:119970373-119970395 CCCGCCCCCCGCCCCCCCCCCGG - Intergenic
1197404003 X:126027900-126027922 CCACCCCCCAGCCACCCTGCTGG - Intergenic
1198757697 X:139998189-139998211 CTTTCCCCCAGCCCCCCAACAGG + Intergenic
1198771218 X:140132123-140132145 CTAGCCCCCAACCCCCCAACAGG - Intergenic
1198780968 X:140235304-140235326 CCATCCCCCAACCCCACAACAGG + Intergenic
1198806763 X:140501816-140501838 CCCCTCCCCACCCCCCCACCAGG + Intergenic
1200014274 X:153147043-153147065 CCACGCCCCCCCCCCCCACTGGG - Intergenic
1200045860 X:153400836-153400858 CCGACCCCCAGCCCCACAGCCGG + Intergenic
1200045948 X:153401097-153401119 CCGCCCCCCAGCTCCGCAGCCGG + Intergenic
1200075619 X:153549193-153549215 CCACCCCACCACCCCACACCTGG - Intronic
1200213854 X:154358809-154358831 CCTCCTCCAAGTCCCCCACCTGG + Intronic
1200252941 X:154563505-154563527 CCACAAGCCAGCCACCCACCAGG - Intronic
1200256095 X:154584317-154584339 TCACCTCCCAGCTCCCTACCAGG + Intergenic
1200261674 X:154620086-154620108 TCACCTCCCAGCTCCCTACCAGG - Intergenic
1200264826 X:154640910-154640932 CCACAAGCCAGCCACCCACCAGG + Intergenic
1200267656 X:154654383-154654405 TCACCTCCCAGCTCCCTACCAGG - Intergenic
1200277904 X:154751282-154751304 CCCCCCCACACCCCCCCCCCGGG - Intronic
1200402721 X:156028982-156029004 GCACCCCCCCGCCCCCAGCCCGG + Intergenic
1200603867 Y:5239418-5239440 CCACTCCCCCGACCCCCAACAGG - Intronic
1201387886 Y:13463014-13463036 CCTCCCCCCAACCCCACAACAGG + Intronic