ID: 1161846875

View in Genome Browser
Species Human (GRCh38)
Location 19:6716770-6716792
Sequence TCTCATTTGCAGGACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161846875 Original CRISPR TCTCATTTGCAGGACATGGC AGG Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
908785278 1:67729314-67729336 TTTCAGTTCCAGGACCTGGCAGG - Intronic
910436638 1:87212116-87212138 CTTCCCTTGCAGGACATGGCTGG + Intergenic
910492641 1:87789463-87789485 ACTCATTTCCACAACATGGCAGG - Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913327378 1:117638680-117638702 TCTCATTGGCAGGGGATGACTGG + Intergenic
914628611 1:149487320-149487342 ATTTATTTGCAGGACATCGCTGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
923758737 1:236819646-236819668 TTTCATTTGCAGGACATCAGGGG - Intronic
924342601 1:243050977-243050999 GCTCATTCCCAGCACATGGCCGG + Intergenic
1063182719 10:3620100-3620122 TCTTTTTAGCAGGACTTGGCAGG - Intergenic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1070739857 10:78895667-78895689 TCTCATTTGCAGGACAAGAAGGG - Intergenic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG + Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075425574 10:122339379-122339401 TCTCATTGACTGGACATGGCCGG - Intergenic
1075581706 10:123623769-123623791 TCTCACTGGCAGGACATGGATGG - Intergenic
1075839104 10:125483106-125483128 TCTCATTTGCTGGAAATGTGGGG + Intergenic
1077910315 11:6567220-6567242 TCTCAATTGCAGTAGATGGCTGG - Exonic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078860794 11:15244493-15244515 ACTCATTACCTGGACATGGCAGG - Intronic
1078967971 11:16369828-16369850 TCTCATTGGCAGAACCTGACAGG - Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079650764 11:22925986-22926008 TCACATTTGCAGAAAATGGTGGG - Intergenic
1081834320 11:46141804-46141826 GCTCATTTGCCACACATGGCTGG - Intergenic
1083606323 11:63981043-63981065 CCACAAATGCAGGACATGGCAGG - Intronic
1084436130 11:69141546-69141568 TTTGATCTGCAGGACCTGGCAGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1088693691 11:112348744-112348766 TCTCACTCCCAGGACCTGGCAGG - Intergenic
1089440479 11:118512014-118512036 TCTCATTTGCAGGTAATGGCTGG + Exonic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091027360 11:132153793-132153815 TCTCCTCTGCTGGACAGGGCAGG - Intronic
1091313046 11:134588235-134588257 TCGCAGATGCAGCACATGGCAGG - Intergenic
1091313124 11:134588837-134588859 TCGCAGGTGCAGCACATGGCAGG - Intergenic
1091316075 11:134614996-134615018 GTCCATTTGCAGGGCATGGCAGG + Intergenic
1092232895 12:6786998-6787020 TCTCATTTACATTACCTGGCAGG - Intronic
1095715648 12:45343409-45343431 TCTCACTAGCAGGTCATAGCAGG - Intronic
1097065127 12:56315351-56315373 TCTACTTTCCAGGAAATGGCCGG + Intronic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1098249466 12:68553850-68553872 CCTCATTTGCAGGACATCAAGGG + Intergenic
1101867620 12:108532615-108532637 TCACATGTGCGGCACATGGCGGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1106226681 13:27791722-27791744 TGTCATTTGAAGGAAAGGGCTGG + Intergenic
1107673377 13:42769807-42769829 TCTTATTTTCAGGAAAGGGCAGG + Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109600715 13:64624512-64624534 TATCATTTTCAGGAAATGGGAGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115128866 14:30028634-30028656 TCTAATTTTCTGCACATGGCTGG + Intronic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119053929 14:71399283-71399305 TCTCATTTACAGGAAACGGATGG - Intronic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1120767197 14:88339314-88339336 TCTCATTTACAGGAAATGCAGGG - Intergenic
1120900650 14:89572866-89572888 ACTCATTTGCATGGCATGGAAGG - Intronic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1126669639 15:51104477-51104499 GCGCAGATGCAGGACATGGCTGG - Intronic
1130739943 15:86588461-86588483 TCTCCCTTGCAGGACACAGCAGG - Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG + Exonic
1135146854 16:19970141-19970163 TCTCATTCGCAGCACATAGTAGG + Intergenic
1136061594 16:27730423-27730445 TCTCATTTGCAGTACTTGTCTGG + Intronic
1138614863 16:58157291-58157313 TCTCATTTGAAGGAGAGGCCAGG + Intergenic
1140613223 16:76626359-76626381 GCCCTTTTGCAGGTCATGGCTGG - Intronic
1141441850 16:84034260-84034282 TCTCATTTGCCACACATTGCTGG + Intronic
1141448531 16:84080519-84080541 TCTCCTCTGCAGGACACTGCTGG + Intronic
1141557861 16:84847751-84847773 GCTCCTTTGCAGCACCTGGCTGG + Intronic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1144249547 17:13401724-13401746 TCTCATTTGCAGCACACTACAGG + Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1147745327 17:42691253-42691275 TCACAGTTGCAGTACAAGGCAGG - Exonic
1149040602 17:52184003-52184025 TCTATTTAGCTGGACATGGCAGG - Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1153222230 18:2871692-2871714 TGTCATTTGGAGGTTATGGCAGG + Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153665595 18:7365227-7365249 ACTCATCAGCAGGACATGGGTGG - Intergenic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1157098979 18:44712316-44712338 TCTTATTGGCAAGACATGGTGGG - Intronic
1159630717 18:70746401-70746423 TCTCCTTGGCAGGCCAAGGCTGG + Intergenic
1159986654 18:74849689-74849711 TCTCTTTCTCAGGACATCGCTGG - Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161655245 19:5510421-5510443 TCTCCGTTGCAGGACACGACAGG + Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1164937221 19:32224128-32224150 TCTCATTTCCAGAACAGGGGCGG - Intergenic
1166774384 19:45303395-45303417 ACTCATTTGCAGGTGAGGGCAGG - Exonic
925715267 2:6779249-6779271 TTTCATTTGCAAGAAATGCCAGG + Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
931553678 2:63475800-63475822 TCTCATTTGGAGGACAGGAGAGG - Intronic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
934627946 2:95879136-95879158 TCTCATTCACATGACATGGATGG + Intronic
934781621 2:96972784-96972806 TCTCATTTCAAGGACATGATGGG + Intronic
936153187 2:110032749-110032771 CCTCACCTGCAGGACATGGCGGG + Intergenic
936191494 2:110338666-110338688 CCTCACCTGCAGGACATGGCGGG - Intergenic
937420835 2:121753941-121753963 TTTAATTTGCAGGCCCTGGCTGG - Intronic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937691778 2:124763965-124763987 TCTCATTTGCAGGACGCTTCTGG + Exonic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
939043320 2:137219168-137219190 TCAATTTTGCAGAACATGGCAGG - Intronic
942583054 2:177442429-177442451 TCTCATCTGCAGGACACATCAGG - Exonic
942609427 2:177727603-177727625 TCTCATTCGTAGGAACTGGCAGG - Intronic
943979913 2:194536123-194536145 TCTCATTGGGAGGAGATGGTTGG + Intergenic
945300108 2:208208145-208208167 TTTCATTTGCAGGACATAAAGGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
949073650 2:242041383-242041405 GCTCCTCTGCAGCACATGGCAGG - Intergenic
1172900790 20:38333112-38333134 TCTCATTTGGTAGAAATGGCTGG - Intronic
1173045485 20:39505394-39505416 TCTCATGTGCAGGACAGACCAGG - Intergenic
1173213756 20:41059586-41059608 TCTCTTTTGCAGGGAAAGGCAGG - Intronic
1173531217 20:43771063-43771085 TCTCATTTGATGGTCATGGTCGG + Intergenic
1173681834 20:44887336-44887358 TCTCATTGGAAGGACAGGCCAGG - Intronic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1174521132 20:51131635-51131657 TTTCATTTGCAGGACATCAAGGG + Intergenic
1179045914 21:37844910-37844932 CCTCATCTGGAGGTCATGGCTGG + Intronic
1181171409 22:21012248-21012270 TCCCATGTGCAGGGCAGGGCAGG + Intronic
1181286829 22:21758569-21758591 TATCATTGTCCGGACATGGCGGG + Exonic
1182698193 22:32210285-32210307 ACCCATTTCCAGGACATGACAGG + Intergenic
1183485253 22:38084851-38084873 TCTTATTTGGGGGACAGGGCAGG - Intergenic
1185024732 22:48402430-48402452 TGTCATTTCCAGGACAAGCCGGG + Intergenic
949778944 3:7664222-7664244 CCTCAATTGCTGGACATGCCTGG + Intronic
949822095 3:8126500-8126522 TCTCTTTTGCAGCACAAGGAAGG + Intergenic
952692315 3:36224354-36224376 TCTTATTTGCAGCACATAGAAGG + Intergenic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
959577701 3:107952132-107952154 GTTCATTTGCACTACATGGCAGG - Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960419412 3:117425558-117425580 CCTCTTATGCTGGACATGGCAGG - Intergenic
960967568 3:123115817-123115839 GCTCATTTGCAGGCCCTGCCTGG + Intronic
961955592 3:130799691-130799713 GCACTTTTGCAGGCCATGGCGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972981689 4:44712092-44712114 TCTTATTTGAAGGAAATGGAAGG + Intronic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
975675010 4:76818663-76818685 TCTTATAGGCAGGAGATGGCTGG + Intergenic
977898040 4:102385775-102385797 TCTCAATTTCAGGACAAGGAAGG + Intronic
980518625 4:133900756-133900778 TCTAATTTCCAGGATATTGCAGG + Intergenic
982096510 4:151928234-151928256 TCTCACTAGCAAGATATGGCAGG + Intergenic
982238038 4:153270445-153270467 TCTGATTTGCAGTATATGCCTGG + Exonic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
984544119 4:181078706-181078728 GCTCATCTGCAGGACATGTGAGG + Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
985615351 5:916767-916789 TCTGACATTCAGGACATGGCGGG + Intronic
985717553 5:1471207-1471229 TCTCAAATGCAGGTCTTGGCAGG - Intronic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
989519384 5:42383050-42383072 TCTCTTTTGCAGGCCAGGCCTGG - Intergenic
991183029 5:63776939-63776961 TCTGAATTGCAGGACAAAGCTGG + Intergenic
991564478 5:67990721-67990743 TGTCATCTGCTGGACAGGGCAGG - Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998423085 5:142005236-142005258 TCTCATTTGCAGCCCTGGGCAGG + Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998849588 5:146340312-146340334 TCTCAGATGAAGGACGTGGCTGG - Exonic
1000008489 5:157209851-157209873 GTTCAATAGCAGGACATGGCTGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1001549357 5:172591866-172591888 TCCCATTTGCAAGACCTGCCTGG + Intergenic
1001905393 5:175468142-175468164 TCTAATTTCCAGGACATAGTGGG + Intergenic
1007016868 6:38477404-38477426 TCTCATCTACAGGACATGCCAGG + Intronic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1012663820 6:101940588-101940610 CCTCATTTCCAGGACACAGCAGG - Intronic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1016443028 6:144103891-144103913 TCTTATTGGCAAGACATGCCAGG + Intergenic
1017826673 6:158086838-158086860 CGTCATCTGGAGGACATGGCGGG - Exonic
1017890147 6:158631139-158631161 TCTCATCTACAAGACAGGGCTGG - Intronic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1023085859 7:36569345-36569367 TCTCCTCTGCAGGCCATGGGTGG + Intronic
1023307561 7:38847100-38847122 TCCCACTGGCAGGACTTGGCTGG + Intronic
1024075919 7:45817795-45817817 GCTCATTCCCAGCACATGGCCGG - Intergenic
1024647681 7:51383497-51383519 GCTCATTCCCAGCACATGGCCGG + Intergenic
1026232877 7:68500592-68500614 TATCATTTGCTAGGCATGGCGGG - Intergenic
1027382298 7:77624012-77624034 GCTCTTTGGGAGGACATGGCAGG + Intronic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1033038337 7:137895812-137895834 TTTCATATGCATGGCATGGCAGG - Intronic
1036963066 8:13266945-13266967 ACTCATGTGCAGCTCATGGCTGG - Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1039191758 8:34984110-34984132 TCTCACTTTCAGGACATCTCAGG + Intergenic
1041070542 8:54123921-54123943 TCTGTTTTCCAGGACATGGTAGG + Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1041887005 8:62821754-62821776 TCTCTTTTGGAGGACACGACAGG + Intronic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1043920365 8:85975779-85975801 TGTCATTTTCAGAACAGGGCAGG - Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048283760 8:133125136-133125158 TCTCATTTCTAGGACCTGGAAGG - Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053049232 9:34945062-34945084 TGTCATTTGGAAGACATGGGGGG - Intergenic
1055476437 9:76667708-76667730 GCTAATCTGCAGGACATGGGAGG + Intronic
1056012218 9:82344339-82344361 TCTCACTTCCAGAACATAGCAGG - Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057622331 9:96647125-96647147 TCTCAGTAGCATGACATGGTAGG - Intronic
1058228045 9:102391221-102391243 TCTCTTTTCCAGAACATGTCTGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1062511799 9:136910294-136910316 TCTCATAAGCAGCACATGGAGGG - Intronic
1186082441 X:5947726-5947748 TGTCATTTTCCCGACATGGCTGG + Intronic
1186363010 X:8862415-8862437 TCTCATTTCCAAGACAGGGGTGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1188288604 X:28360799-28360821 TCTCATATGCATAACATGGAAGG + Intergenic
1190191717 X:48282128-48282150 TTTGATGTGCAGAACATGGCTGG + Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1192880355 X:75276326-75276348 TATTATTTGCAAGGCATGGCCGG - Intronic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195919251 X:109966316-109966338 TTCCCTTTGCAGGGCATGGCAGG - Intergenic
1196026572 X:111047549-111047571 TCTCATCTGCAGGGCTTTGCTGG - Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1197738346 X:129870007-129870029 TAAAATTTGCAGGACTTGGCTGG - Intergenic
1198136957 X:133762806-133762828 TTTCATTTGCAGGACATCAAGGG - Intronic
1198228858 X:134670703-134670725 TCTTATTTGCATGGCAGGGCTGG - Intronic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199878097 X:151950956-151950978 TGTCATTCTCAGGCCATGGCTGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic