ID: 1161847308 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:6719119-6719141 |
| Sequence | AGGGAGAAGACAGAAGGGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2572 | |||
| Summary | {0: 1, 1: 0, 2: 29, 3: 279, 4: 2263} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1161847297_1161847308 | 16 | Left | 1161847297 | 19:6719080-6719102 | CCGAAGGGGTGGAGTCTCAGGGA | 0: 1 1: 0 2: 1 3: 29 4: 234 |
||
| Right | 1161847308 | 19:6719119-6719141 | AGGGAGAAGACAGAAGGGGAGGG | 0: 1 1: 0 2: 29 3: 279 4: 2263 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1161847308 | Original CRISPR | AGGGAGAAGACAGAAGGGGA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||