ID: 1161847308

View in Genome Browser
Species Human (GRCh38)
Location 19:6719119-6719141
Sequence AGGGAGAAGACAGAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2572
Summary {0: 1, 1: 0, 2: 29, 3: 279, 4: 2263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161847297_1161847308 16 Left 1161847297 19:6719080-6719102 CCGAAGGGGTGGAGTCTCAGGGA 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG 0: 1
1: 0
2: 29
3: 279
4: 2263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161847308 Original CRISPR AGGGAGAAGACAGAAGGGGA GGG Intronic
Too many off-targets to display for this crispr