ID: 1161847704

View in Genome Browser
Species Human (GRCh38)
Location 19:6721081-6721103
Sequence CTGAGGGAGGGGAAGTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 764}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161847699_1161847704 -8 Left 1161847699 19:6721066-6721088 CCAGAGGCTTCCATGCTGAGGGA 0: 1
1: 0
2: 3
3: 31
4: 241
Right 1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG 0: 1
1: 0
2: 6
3: 87
4: 764
1161847695_1161847704 -1 Left 1161847695 19:6721059-6721081 CCCACTTCCAGAGGCTTCCATGC 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG 0: 1
1: 0
2: 6
3: 87
4: 764
1161847696_1161847704 -2 Left 1161847696 19:6721060-6721082 CCACTTCCAGAGGCTTCCATGCT 0: 1
1: 0
2: 0
3: 31
4: 261
Right 1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG 0: 1
1: 0
2: 6
3: 87
4: 764
1161847694_1161847704 0 Left 1161847694 19:6721058-6721080 CCCCACTTCCAGAGGCTTCCATG 0: 1
1: 0
2: 2
3: 25
4: 290
Right 1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG 0: 1
1: 0
2: 6
3: 87
4: 764

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161847704 Original CRISPR CTGAGGGAGGGGAAGTAGAA TGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900308095 1:2020637-2020659 TTGAAGGAGGGGAAGGACAAAGG - Intronic
900658269 1:3770792-3770814 CTGGGGGAGGGGAGGAGGAAGGG + Intronic
900863089 1:5246523-5246545 GGGAGGGAAGGGAAGAAGAAGGG - Intergenic
901010490 1:6199212-6199234 TGGAGGGCGGGGAAGAAGAACGG - Intronic
901105378 1:6751845-6751867 GAGGGGGAGGGGAAGTGGAAGGG - Intergenic
901116495 1:6849448-6849470 ATGAGAGAGGGGACATAGAAAGG + Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901300520 1:8197002-8197024 ATGAGAGAGAGGAAGAAGAAAGG + Intergenic
901681584 1:10915923-10915945 CTGAGGGTTGGGAAGCAAAAGGG - Intergenic
902864097 1:19266876-19266898 CTGATGGTGGGGATGTAAAATGG - Intergenic
902985755 1:20153130-20153152 AGGAGGGAGAGGATGTAGAAAGG + Intergenic
903025009 1:20422026-20422048 GTGAGGGCTGGGAAGAAGAAGGG - Intergenic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903559759 1:24218465-24218487 CTGAGGGAGCAGCAGTAGACAGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904428842 1:30448837-30448859 GGGAGGGAGGGGAAGGGGAAGGG + Intergenic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
904719729 1:32499086-32499108 CTGAGGAATGGGCAGGAGAAAGG - Intronic
904919717 1:33997526-33997548 CTGAGAGAGGGGAGGAAGACAGG - Intronic
904970761 1:34417920-34417942 GTGAGGGAGGTGGAGGAGAAGGG + Intergenic
905286174 1:36881854-36881876 TTGAGGGAGGGAAAGAAGGATGG - Intronic
905547098 1:38808508-38808530 CTGAGGCAGAGGAAGTGGAAGGG + Intergenic
905617644 1:39412640-39412662 CAGAGGGAGGGGAGATGGAAAGG + Exonic
905709584 1:40089834-40089856 CTGGGGGAGGGGAAGGAAATGGG - Intronic
906154014 1:43603557-43603579 CTGAGGGTGGGGCAGCAGGAGGG + Intronic
906515078 1:46433998-46434020 TAGAGGGTGGGGAAGTAGAGGGG + Intergenic
906581011 1:46935155-46935177 CTGAGGGAGAGTATGAAGAAGGG + Intronic
906658644 1:47566899-47566921 CTGAGGGAGGGGGCTGAGAATGG + Intergenic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
906749705 1:48247974-48247996 GAGAGGTAGGGGAACTAGAAAGG - Exonic
906788039 1:48633340-48633362 CTCAATGAGGGTAAGTAGAATGG + Intronic
907437688 1:54459887-54459909 CTGGGGGTGGGGGAGTAGAGAGG + Intergenic
907578848 1:55553786-55553808 CTGAGGGAGGGGGAGAAAAAAGG - Intergenic
907824952 1:58006772-58006794 CTGAGGGACGGGAGGCAGAGAGG - Intronic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908868270 1:68576737-68576759 CTGAGGGTGTGGAAGTACCAGGG - Intergenic
908949575 1:69543866-69543888 CTTAGGGAGGCCAAGAAGAAAGG + Intergenic
909939410 1:81592910-81592932 CTCAGGGAAGGGAAGTAGCTGGG + Intronic
910062839 1:83114235-83114257 TTGAGGGAGGAGAAGAAGAAGGG - Intergenic
910183075 1:84506302-84506324 CTGGAGGAGGGGGAGGAGAAGGG + Exonic
910982835 1:92975725-92975747 CTGAGGGTGGGGCAGAAGACAGG - Intergenic
911233935 1:95389614-95389636 CTGAGGGAGTGGGATAAGAAAGG - Intergenic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
911924014 1:103803684-103803706 CTTAGGGAAGGGAAGTAGGAGGG - Intergenic
912173855 1:107134403-107134425 CTGAGGCAGAGGAAATAGAAAGG + Intergenic
912302019 1:108527882-108527904 CTGAGGGAGGGGAAATAGAGAGG - Intergenic
912876937 1:113369999-113370021 CTAACTGAGGGGAAGTAGATGGG - Intergenic
912897810 1:113611545-113611567 CTAAGGCAGGGGTAGTAGAATGG - Intronic
912957990 1:114169413-114169435 CTGAGACAGGGGCAGCAGAAAGG - Intergenic
913008551 1:114659744-114659766 CGGAGGGAGGGAAGGAAGAAAGG - Intronic
913425872 1:118728859-118728881 CTGCTGGTGGGAAAGTAGAATGG + Intergenic
915046913 1:153025272-153025294 CTGAGGGAGAGAAAGAAAAAGGG - Intergenic
915136295 1:153733939-153733961 CTGAGGGAGGGGAAATGGAAAGG + Intronic
915268627 1:154735882-154735904 CTGTGGGAGGGGACACAGAAGGG + Intronic
915876215 1:159614200-159614222 CTGGAGGTGGGGTAGTAGAAGGG + Intergenic
915951028 1:160190188-160190210 CTGGGGGAGGGGAGGTATAAGGG - Intergenic
916030756 1:160875763-160875785 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916030762 1:160875787-160875809 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916046679 1:161005282-161005304 GGGAGGGAGGGGAAGGAGGAAGG - Intronic
916096908 1:161359423-161359445 CTGAGGGGGAGGCAGTAGAGAGG + Intronic
916738349 1:167628046-167628068 CTGAGGGAGGGGGTGGAAAACGG - Intergenic
916759514 1:167803837-167803859 AGGAGGGAGGGGGAGGAGAAAGG - Intergenic
916831724 1:168499225-168499247 AAGAGGGAGGGAAAGGAGAAAGG - Intergenic
916957433 1:169853743-169853765 CTGAAGGCTGGGAAGAAGAAGGG - Exonic
917219204 1:172709576-172709598 ATGAGGATGGGGAGGTAGAAAGG - Intergenic
918217678 1:182407252-182407274 CTTAGGGAGAGGAGGTACAAGGG + Intergenic
918586369 1:186193280-186193302 GGGAGGGAGGGGAGGTAGAGGGG + Intergenic
918720690 1:187848822-187848844 CTTAGGGTGGGGAAATAGACAGG + Intergenic
919145504 1:193629429-193629451 ATGAGGGAGAGGGAGGAGAAGGG + Intergenic
919422976 1:197394156-197394178 CAGAGGAAGTGGAAGTAGAAGGG - Intronic
919690946 1:200527926-200527948 CTTCAGGAGGGGCAGTAGAAAGG - Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919882874 1:201912372-201912394 GTGGGGGAGGGGGAGGAGAAGGG - Intronic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920503661 1:206501346-206501368 CACAGGGAGAGGAAGCAGAAAGG + Intergenic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921168131 1:212522061-212522083 TAGAGGGAGAGGAAGGAGAAAGG + Intergenic
921653834 1:217710827-217710849 GTGAGGGGGGACAAGTAGAATGG - Intronic
921700185 1:218260214-218260236 CTGAGGTAGTGGTAGCAGAATGG + Intergenic
922488892 1:225999481-225999503 CTGGGGGAGGGGAACAGGAAAGG + Intergenic
922817267 1:228458789-228458811 CGGAGGGAGGGGATGGAGAGGGG - Exonic
922969681 1:229725591-229725613 GTGAGGGAGGGCATGTAGGAAGG - Intergenic
922990137 1:229900677-229900699 CTGAGGAGGGGTAGGTAGAATGG + Intergenic
923018059 1:230142166-230142188 GGGAGGGTGGGGAAGGAGAACGG + Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
924664392 1:246055809-246055831 CAGAGAGACAGGAAGTAGAATGG + Intronic
1063230087 10:4057242-4057264 GTGAGCTGGGGGAAGTAGAATGG - Intergenic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063503567 10:6576501-6576523 CTTAGAGACAGGAAGTAGAAGGG + Intronic
1064281005 10:13951482-13951504 CTGAAAGAGGTGGAGTAGAAGGG + Intronic
1064688354 10:17887504-17887526 CTGAAGAAGCGAAAGTAGAATGG + Intronic
1066080795 10:31928813-31928835 CTGAGGGAGGGTAAGTTACAGGG + Intronic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066413911 10:35201315-35201337 CTTAAGGAGGGGAAGAGGAAGGG + Intronic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067078565 10:43201649-43201671 CTGGGGGAAGGGAGGTTGAATGG + Intronic
1067184307 10:44014097-44014119 GGGAGGGAGGGAAAGGAGAAGGG - Intergenic
1067409962 10:46055542-46055564 AGGAGGAAGGGGAAGGAGAAGGG - Intergenic
1067707515 10:48620898-48620920 CTGAGGAAGGTGAAGCAGCAAGG - Intronic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1067833214 10:49622012-49622034 AGGAGGGAGGGGAGGCAGAAGGG + Intronic
1068063845 10:52103397-52103419 CTGAGGGGGAGGAAGGAGAGGGG - Intronic
1068182590 10:53541335-53541357 CTGAGGAAGGGGAAATAACAAGG + Intergenic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1069230960 10:66007854-66007876 AGGAAGGAGGGGAAGTAGGAAGG - Intronic
1069740337 10:70683200-70683222 CTGAGGGCGGGGAGGTAAACGGG - Intronic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1072339386 10:94431888-94431910 TGAAGGGAGGGGAAGCAGAAAGG - Intronic
1072728845 10:97831284-97831306 TTGAGGGAGGGGAAGTATTGGGG - Intergenic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073086502 10:100893967-100893989 CTCAGGGATGGGGAGAAGAATGG - Intergenic
1073253290 10:102134764-102134786 CTGATGGAGGTGAAGATGAATGG - Intronic
1073479983 10:103780283-103780305 CTTGGGGAAGGGAAGGAGAAAGG - Intronic
1073620956 10:105047831-105047853 ATGAGGGAAGGGAGGAAGAATGG + Intronic
1073682196 10:105716760-105716782 GGGAGGGAGGGGAAGAAGGAAGG - Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074053981 10:109905517-109905539 CTTAGAGAGAGAAAGTAGAATGG + Intronic
1074682938 10:115927871-115927893 CTTAGGGACAGGAAGTAGTATGG + Intronic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075262468 10:120975195-120975217 CTGCGGGTGGGAAGGTAGAATGG + Intergenic
1075262880 10:120978104-120978126 CTGAGGGTGGGGAAGGGGAGAGG + Intergenic
1075330979 10:121573811-121573833 CTGCGGGAAGGGTAGTAAAATGG + Intronic
1076028248 10:127134957-127134979 ACTAGGGAGGGGAAGAAGAAAGG + Intronic
1076318866 10:129564175-129564197 GTGGGGGAGTGGAAGAAGAAGGG - Intronic
1076516188 10:131045602-131045624 CTGAAGGATGGGAAGTCCAAAGG - Intergenic
1077091269 11:779405-779427 TTGGGGGAGGGGAAGAGGAATGG - Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078156632 11:8805556-8805578 CTGAAGGACTGGAAGTAGGAGGG - Intronic
1078309092 11:10220511-10220533 CTAAGGGAGTGGTGGTAGAAAGG - Intronic
1078578756 11:12522958-12522980 ATGAGAGAGGGAATGTAGAAGGG + Intronic
1079041376 11:17063478-17063500 CTGAAGGAGGGGAGTTGGAAAGG - Intergenic
1079325683 11:19489298-19489320 GAGAGAGAGGGGAAGAAGAAGGG + Intronic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1079810938 11:24999308-24999330 ATGAGAGAAGGGAAGAAGAAGGG + Intronic
1079822505 11:25148346-25148368 GTGAGGGAGGGAAGGAAGAAAGG + Intergenic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081583484 11:44368202-44368224 CTGATGGAAGGGAGGCAGAAAGG - Intergenic
1081622832 11:44629055-44629077 CTGAGGGAGGAGAAGGAGTTAGG - Intergenic
1081623763 11:44634722-44634744 GGGAGGGAGGGGAAGGAGGAGGG - Intergenic
1083208643 11:61168698-61168720 CTGATGCAGGGGAAGGAGATGGG - Intergenic
1083317996 11:61828135-61828157 CTGAGGGAGGGGCGGAGGAAGGG + Exonic
1083715691 11:64575256-64575278 AGGAGGGAGGGAAAGAAGAAAGG + Intergenic
1084690629 11:70723782-70723804 CTGAGGAAGAGGATGTAGAGAGG + Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1085843634 11:80041759-80041781 TTGGGGGTGGGGAATTAGAATGG - Intergenic
1088423439 11:109674211-109674233 CTGAGTGAGGGGATGGACAATGG - Intergenic
1088677024 11:112204546-112204568 CTGAGGGGGAGGAAGAAGAGGGG - Intronic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089498604 11:118920025-118920047 CTGGGGGTGGGGACGTAAAAGGG + Intronic
1089611318 11:119671093-119671115 CTGAGTGAGGGAGAGAAGAAAGG + Intronic
1089740371 11:120578146-120578168 CAGAGGGCAGGGAAGTAGAAGGG + Intronic
1090185201 11:124734450-124734472 CTGAGGAAAGGGAGGTGGAAAGG + Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090640742 11:128726903-128726925 CTGAAGGAGGGGAGGGACAACGG + Intronic
1091226270 11:133957971-133957993 TTGGGGGAGGGGAAGCAGACAGG - Intergenic
1091454688 12:598345-598367 CAGAGGGAGGGCAAGGAGGAGGG - Intronic
1091725135 12:2841066-2841088 CTGACAGAGGGGATGGAGAAAGG - Intronic
1091767319 12:3130128-3130150 CGGGGGAAGCGGAAGTAGAAGGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092109177 12:5946689-5946711 CTGCTGGAGGGAAAGAAGAAAGG - Intergenic
1092745300 12:11667346-11667368 TAAAGGGAGGGGAAGTAGAAGGG - Intronic
1092790369 12:12065606-12065628 CTGTGGGAAGGTAAGTAGATGGG + Intronic
1093155996 12:15686124-15686146 CTGAGGGAGAAGAAGTGGAGGGG - Intronic
1093640322 12:21520110-21520132 CTAAGGAATGTGAAGTAGAAAGG - Intergenic
1093866258 12:24230402-24230424 CTGGGGGAGGGGTAGAAAAACGG + Intergenic
1094122122 12:26985916-26985938 CTGAGGCAGAGGCAGGAGAATGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1095279535 12:40333979-40334001 CTGAGGCCGTGGAAGTAGATGGG + Intronic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1096660189 12:53119314-53119336 CTGAGGGAAGGTAACTAGCAAGG - Intronic
1096913743 12:55010099-55010121 GTGAAGGAGGGGAAGTAAAAAGG - Intergenic
1097119577 12:56721040-56721062 CTGAAGGAGGTGAAGTAAGAAGG + Exonic
1097201507 12:57282767-57282789 CTGAGGCAGTGGGATTAGAAAGG + Intronic
1097247891 12:57616601-57616623 GTAAGGGATGGGAAGTAGGAAGG - Intronic
1097545172 12:60990012-60990034 CTGAGAGAGGGAAAGTAAAAAGG - Intergenic
1098128222 12:67322191-67322213 CTGAGAGAGAGGAATGAGAAGGG + Intergenic
1098152153 12:67557830-67557852 CTGAGGAATGGGAAATAGGAAGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1100071382 12:90723811-90723833 CTGAGCAAGGGGCAGAAGAATGG - Intergenic
1100855193 12:98751595-98751617 CTGAGGGAGGTGAACTAGGGAGG + Intronic
1101412703 12:104482493-104482515 CTGAGGGTGGGGAAAGGGAAGGG - Intronic
1101700237 12:107167077-107167099 CAGAGGGACAGGAAGTACAAAGG - Intergenic
1101824604 12:108210326-108210348 CTGAGGGAGGAGCAGCAGAGAGG - Intronic
1102105173 12:110315193-110315215 TTGAAAGAGGGGAAGAAGAATGG + Intronic
1102439216 12:112948730-112948752 CTCAGAGAGGGGAAGTGGGAGGG - Intronic
1102544198 12:113642774-113642796 TTGAGGGAGGGAAGGAAGAAGGG - Intergenic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102637329 12:114335757-114335779 CTGGGGGAGGGGAGGAAGTAGGG + Intergenic
1103005346 12:117416331-117416353 CTGAGGGGTGGGGAGTAGAGAGG - Intronic
1103046803 12:117742625-117742647 CTGGGTGAGGGGAATTAGAAAGG + Intronic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1103437466 12:120937820-120937842 GTGAGGGAGAGGAAGCAGGATGG - Intergenic
1103981635 12:124740738-124740760 CTGAGGGAGGGCATGTAGGAGGG - Intergenic
1104167779 12:126250699-126250721 CACAGGGAGTGGAAGTACAAAGG - Intergenic
1104593611 12:130104358-130104380 CTGGGGGAGGGGGCGTAGGAAGG + Intergenic
1104919860 12:132285149-132285171 CTGAGGGAGGGCAGGCAGGAGGG - Intronic
1105309013 13:19189883-19189905 CTGATGGAAGGGAATGAGAAGGG - Intergenic
1105334231 13:19449922-19449944 CTGAAAGAAGGGAAGGAGAAAGG - Intronic
1105607644 13:21940027-21940049 CTGAAGGATGGGAAGCAGATGGG - Intergenic
1105851525 13:24340195-24340217 CTGAGGGAAGGGGAGGAGCAGGG + Intergenic
1106303508 13:28490499-28490521 TTGAGGGAGGGGAAGGAAATTGG - Intronic
1106356395 13:28987448-28987470 ATGAGGGAGAGGAAGGAGATGGG + Intronic
1106783532 13:33085093-33085115 GTAAGGGAGGGAAAGAAGAATGG + Intergenic
1107222139 13:37995571-37995593 CTGATGAGGGTGAAGTAGAAGGG - Intergenic
1107911898 13:45113108-45113130 CAGAGGGAAGGCAAGGAGAAAGG + Intergenic
1108628193 13:52253591-52253613 CTGAAAGAAGGGAAGGAGAAAGG - Intergenic
1108657866 13:52552858-52552880 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic
1109202891 13:59450662-59450684 CTGTGGATGGGGAATTAGAATGG - Intergenic
1109405123 13:61887611-61887633 ATGAGGCATGGGAAGGAGAAAGG - Intergenic
1109552214 13:63917990-63918012 GGGAGGGAGGGGAAGGGGAAGGG - Intergenic
1109710575 13:66153418-66153440 CTTAGGAAGTGGAAGTGGAAAGG + Intergenic
1110522226 13:76493205-76493227 CTTTGGGAAGTGAAGTAGAAAGG + Intergenic
1110756680 13:79183255-79183277 AGGAGGGAGGGGAAGGAGATAGG + Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1112536536 13:100262672-100262694 GAGAGGGAGGGGAAGGGGAAGGG - Intronic
1112888999 13:104209121-104209143 GAAAGGGAGGGGTAGTAGAATGG + Intergenic
1113358987 13:109610772-109610794 CTGAGGGGTGGGAAGCAGTAGGG - Intergenic
1113740959 13:112712130-112712152 CTCAGGGTGGGGAGGGAGAACGG - Intronic
1115165911 14:30448556-30448578 CTGAGGGAGAGGAAGTTTACTGG - Intergenic
1115306699 14:31940997-31941019 CTGAGGGAGGGAACATAGATTGG - Intergenic
1115421478 14:33199712-33199734 AAGAGGGAGGGGAAGAAGAAGGG - Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1115864791 14:37732934-37732956 CTGAGGCAGAGGAAGAAGAGGGG + Intronic
1115983329 14:39077645-39077667 GTGAGGAAGGGGAAGTAGATTGG - Intronic
1116752882 14:48909102-48909124 CTGAAGGAGGGGAAGAAAGAAGG - Intergenic
1116958992 14:50951165-50951187 TTGAGGGAGAGGAAGAAGACAGG - Intergenic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117866923 14:60159755-60159777 CTGGGGGAGGGGAGATAGGAAGG - Intronic
1117997236 14:61489289-61489311 TTGAGGGAGGGGAGGGAGAGAGG + Intronic
1118069771 14:62233119-62233141 CTGCTGGAGGGAAAGTAAAATGG - Intergenic
1118309151 14:64680055-64680077 CTCTGGGAGGGGAAGAAGAAAGG - Intergenic
1118865872 14:69703211-69703233 CTGACAGAGGGGAAGTATACTGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119188215 14:72660006-72660028 CAGAGGGACAGAAAGTAGAATGG + Intronic
1119423305 14:74521054-74521076 TGGAGGGAAGGGAAGTAGAAGGG - Intronic
1119640438 14:76310522-76310544 CTGGGGGAGGGCAAGTGAAAAGG - Intergenic
1121859781 14:97306443-97306465 CTGAGCTAAGGGAAGTAAAATGG - Intergenic
1121916765 14:97842501-97842523 CCGAGGGAGGGAAGGAAGAAAGG + Intergenic
1124343001 15:28901958-28901980 GTGGGGGAGGGGAAGAATAAAGG + Intronic
1124668509 15:31616016-31616038 CTGAGGGGGTGGGAGAAGAAAGG - Intronic
1124899801 15:33811404-33811426 CTGAGGCAGAGGCAGGAGAATGG + Intronic
1124989006 15:34652165-34652187 ATGAGGAAGTGGAAGTGGAATGG + Intergenic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1125482058 15:40088025-40088047 CTGGGAGAGAGGAAGAAGAAAGG - Exonic
1125722592 15:41852380-41852402 CTGGGGGAGGGGAGGTAGACGGG - Intronic
1125775359 15:42207999-42208021 CTGAGGCCGGGGAAGTGGACAGG - Intronic
1126367034 15:47904724-47904746 CTGAGGGAAGGAGAGAAGAAGGG + Intergenic
1126832913 15:52627212-52627234 AAGAGGGAAGGGAAGGAGAAGGG + Intronic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1127862610 15:63006913-63006935 CTGAGGGAGGGAAAAGAGAGGGG + Intergenic
1127868253 15:63048773-63048795 CTGCGGGGGGGGAAGCAGGAGGG - Intronic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1128370535 15:67036016-67036038 CTGGGGGAGGGCGAGGAGAAGGG - Intergenic
1128608158 15:69053810-69053832 CTGAGGGAGGGTAAGAAGCAGGG + Intronic
1129026349 15:72577785-72577807 CAGAGGTAGAGGAAGTCGAATGG + Intronic
1129170888 15:73807202-73807224 GTGAGGGAGGGGAAGGGGAGAGG + Intergenic
1129198910 15:73986983-73987005 CTCAGAGAGGGGAGGCAGAAGGG + Intronic
1129266995 15:74398653-74398675 CTGATGGCGGGGATGTAAAATGG + Intergenic
1129902040 15:79158576-79158598 CAGAGGGACTGAAAGTAGAAAGG + Intergenic
1130053687 15:80504813-80504835 CTCAGGGAGGGGAAGTGGCTGGG + Intronic
1130438402 15:83925835-83925857 CTCAGGGAAGGGATGTAGCAGGG - Intronic
1130855996 15:87840725-87840747 GGGAGGGAGGGGAGGAAGAAAGG + Intergenic
1131408694 15:92187737-92187759 GTGATGGAGGGGAAGGAGACAGG + Intergenic
1131579217 15:93625599-93625621 CTGAGGGGGAGGAAGAGGAATGG + Intergenic
1131641581 15:94299041-94299063 CAAAGGGAGGGGAAGGGGAAGGG - Intronic
1131785401 15:95906573-95906595 GTGGGGGAGGGGGAGGAGAAGGG + Intergenic
1132175283 15:99709240-99709262 GAGAGGGAAGGGAAGTAGCAAGG + Intronic
1132246695 15:100302073-100302095 CTGAGGGTGGGGAAGGACAGAGG - Intronic
1132303052 15:100788263-100788285 CTGCTGCAGGGGAAGTAGCAGGG - Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132528313 16:428953-428975 GTGAGGATGGGGAAGTGGAAGGG + Intronic
1133300954 16:4782549-4782571 CTGCTGGAGGGAAAGTAAAATGG - Intronic
1133395282 16:5442214-5442236 TTGAGGGGGAGGATGTAGAAGGG + Intergenic
1133589554 16:7229562-7229584 GGGAGGGAGGGGAAGGAGAAAGG + Intronic
1133964247 16:10519425-10519447 GGGAGGGAGGGGAAGGGGAAGGG - Intergenic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1134770633 16:16806111-16806133 GAGAGGGAGGGGAAGGGGAAGGG - Intergenic
1135220193 16:20607912-20607934 CTGAGGGATGGGTAGAGGAATGG - Intergenic
1135236695 16:20763468-20763490 GTGAGGCAGAGGAAGGAGAATGG + Intronic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1137800876 16:51260919-51260941 CTGAGGGAGAGAAGGAAGAAGGG - Intergenic
1138047121 16:53736890-53736912 CTGGGGGAGGGGAATGAGTATGG - Intronic
1138215469 16:55201414-55201436 GGGAGGGAGGGGAGGAAGAAAGG - Intergenic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1138565113 16:57827508-57827530 CTGAGGGACAGGCAGGAGAAGGG - Intronic
1139130164 16:64133348-64133370 TTGAGGGAGGGCAAGGAGGATGG + Intergenic
1139354227 16:66357761-66357783 AGGAAGGAGGGGAAGTGGAAAGG + Intergenic
1140313121 16:73868028-73868050 TTTAGGGAGGGGCAGGAGAAGGG - Intergenic
1141318584 16:82985261-82985283 CTAAAGGAGGGGGAGTTGAAAGG + Intronic
1141717124 16:85733353-85733375 CTTAGAGACAGGAAGTAGAATGG + Intronic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1142675973 17:1513598-1513620 CTGTGGCAGGGGAAGTAGCCTGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1143016595 17:3893859-3893881 CTAAGGGAGGGGAAGTGGGGTGG - Intronic
1143156460 17:4840375-4840397 CTGTGGGAGGGGAAAAAAAATGG + Intronic
1143218795 17:5244444-5244466 CTGAGTGATGGGAAGTACTAAGG + Intergenic
1143379910 17:6489534-6489556 CTGAAGGAGGGGAGTAAGAAAGG + Intronic
1143380683 17:6494246-6494268 CTGAAGGAGGGGAGTAAGAAAGG + Intronic
1143565517 17:7717962-7717984 GTGGGGGAGGGGGAGGAGAAGGG + Exonic
1143693977 17:8596644-8596666 AGGAGGGAGGGGGAGTAGGAGGG + Intronic
1143693984 17:8596660-8596682 AGGAGGGAGGGGGAGTAGGAGGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144277484 17:13687860-13687882 CTGAGGAAGAGGAAGAAGAGAGG - Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146592754 17:34142284-34142306 GTGAGGAAGGGGAAATACAAGGG + Intronic
1146762616 17:35491578-35491600 CTGAGGGATGGGCTGCAGAATGG + Intronic
1146938563 17:36827431-36827453 TTGAGGGAGCTGATGTAGAAGGG - Intergenic
1147159617 17:38562556-38562578 GTGAGGGGTGGGAAGTAGAAGGG + Intronic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147566273 17:41538141-41538163 CTGAGGGAGGGGAAGGACAAGGG + Intergenic
1147586299 17:41655586-41655608 CTGGGGGAGGGGACGTGGCAGGG - Intergenic
1147651343 17:42063699-42063721 CTGAGGGAGAGGCAGTGGCAAGG + Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148525470 17:48328827-48328849 GTGGGCGAGGGAAAGTAGAAAGG - Intronic
1148553650 17:48565021-48565043 TTGAGGGAGGAGATGTGGAATGG + Intronic
1148696952 17:49566319-49566341 CAGAGGAAGGGAAAGTGGAAAGG + Intergenic
1148819473 17:50352338-50352360 CTGATGGATGAGATGTAGAATGG - Intronic
1148885601 17:50770084-50770106 CTGGGGCAGGGAAAGTACAATGG - Intergenic
1149595597 17:57862796-57862818 CTGAGGAAGGGGGACCAGAAGGG + Exonic
1149639345 17:58192948-58192970 AGGAGGGAGGGGAAATGGAAGGG + Intronic
1149775729 17:59355566-59355588 AGGAGGGAGGTGAAGGAGAACGG - Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150059758 17:62056366-62056388 AATAGGGAGGGGAAGGAGAAGGG + Intronic
1150219337 17:63487268-63487290 CTGAGGGAGGGGCAGCTGATCGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151530561 17:74702076-74702098 ATGGGAGAGGGGGAGTAGAAGGG + Intronic
1152047531 17:77947392-77947414 CTGAGGGAAGGGAAGTATATAGG + Intergenic
1152048748 17:77956978-77957000 CTGAGGGAGGGGGATAAGAAAGG + Intergenic
1152362320 17:79838545-79838567 TGCAGGGAGGGGAAGAAGAAAGG - Intronic
1152589724 17:81205484-81205506 CAGCGGGAGGGGAGGTAGGAGGG + Intronic
1152609234 17:81307473-81307495 AAGGGGGAGGGGAAGGAGAAAGG - Intergenic
1153450419 18:5221210-5221232 ATGGGGGAGGGGAAGGGGAAGGG - Intergenic
1153493332 18:5671980-5672002 CTGAGGCAGAGGGAGAAGAAGGG - Intergenic
1153580829 18:6571664-6571686 CAGAGAGAGTGGAAGAAGAAAGG - Intronic
1153706218 18:7748401-7748423 CAGAGGAAGGGGAGGAAGAAGGG - Intronic
1154344027 18:13527708-13527730 GCAAAGGAGGGGAAGTAGAATGG + Intronic
1155438199 18:25834462-25834484 CTTAGGGAGGCAAAGGAGAATGG - Intergenic
1155586280 18:27369423-27369445 CGGAGGGAGGGAAGGAAGAAAGG + Intergenic
1156876466 18:42019913-42019935 CTGGTGGAGAGGAAGTAGGAAGG - Intronic
1157270830 18:46274819-46274841 CAGTGGGAGGGGAAATGGAAAGG + Intergenic
1157405985 18:47423184-47423206 TGGGGGGAGGGGCAGTAGAAGGG + Intergenic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157980554 18:52374862-52374884 ATGAGAGAAGGGAAGTTGAAAGG + Intronic
1158041519 18:53100529-53100551 GGGAGGGAGGGAAAGAAGAAAGG + Intronic
1158381731 18:56938053-56938075 CTGAGGGGGAGGAAGTGGAGGGG + Intronic
1158528186 18:58234282-58234304 GGGAGGAAGGGGAAGGAGAAGGG - Intronic
1158937259 18:62376082-62376104 CTGAGGGAGAGGCAGTAGCCAGG + Intronic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG + Intronic
1162171184 19:8790261-8790283 GGGAGGGAGGGAAAGAAGAAAGG + Intergenic
1162743104 19:12784071-12784093 CCGAGGGAGGGGACGTCGGATGG + Intronic
1162761700 19:12892294-12892316 CTGTTGGGGGGGAAGAAGAAAGG - Intronic
1163213928 19:15862486-15862508 GAGGGGGAGGGGAAGAAGAAGGG + Intergenic
1163617260 19:18336701-18336723 CTGAGGGAGGGGAATAGGGAGGG + Intergenic
1163827840 19:19533531-19533553 AGGAGGGAGAGGAAGGAGAAAGG - Intronic
1164681161 19:30134678-30134700 GTGAGGGAGGAGTAGTAGGAAGG + Intergenic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165202168 19:34153935-34153957 CAGAGGGATGGGAATTGGAAAGG + Intergenic
1165258095 19:34592148-34592170 CTGAGGGATGACAAGGAGAATGG + Intergenic
1165775584 19:38402815-38402837 CTGAGGGAGGAAAAGGAAAATGG + Intergenic
1165847404 19:38827084-38827106 GGGAGGGAGGGGAAGGAGGAAGG + Intronic
1165847416 19:38827114-38827136 GGGAGGGAGGGGAGGGAGAAAGG + Intronic
1166118875 19:40673108-40673130 CTGAGTAAGGGATAGTAGAAAGG - Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166381046 19:42355600-42355622 CTGAGGGAGGGGGTGCAGAATGG + Intronic
1166803539 19:45471914-45471936 GAGAGGGAGGGGTAATAGAAGGG + Intronic
1166853522 19:45771321-45771343 CTGAGGCAGGGGAAAGAGAGGGG + Intronic
1166992194 19:46699233-46699255 CTGAGGAAGTGGCAGTTGAAGGG - Intronic
1167035115 19:46990581-46990603 CAGAGGGTGGGGAAGAGGAAAGG + Intronic
1167116877 19:47493563-47493585 CTGAGGGGTGGGAACTTGAAGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167401049 19:49269695-49269717 CTGAGGGAGAGGAGGAGGAAGGG - Intergenic
1167440679 19:49507024-49507046 AAGGGGGAGGGGAAGGAGAAGGG - Intronic
1167450664 19:49566736-49566758 GTGAAGGAGTGGAAGTGGAAAGG - Intronic
1167680383 19:50916595-50916617 CAGGGGGATGGGAGGTAGAAGGG - Intergenic
1168159276 19:54498264-54498286 CTGAGGGTGGGGTGGTAGCAGGG - Intronic
926050031 2:9738858-9738880 GTGAGGGAGAGGAACTGGAAGGG + Intergenic
926239390 2:11073416-11073438 ATGCGGGAGGGGAAGAGGAAAGG - Intergenic
926466200 2:13191491-13191513 CTGAGGGAGGGGAATAAACAAGG + Intergenic
926964990 2:18400041-18400063 ATGAGGAAGTGGAAGTAGATGGG + Intergenic
927389213 2:22574291-22574313 CTGAGGGAGAGCAAATGGAATGG - Intergenic
927441741 2:23123563-23123585 CTCAGGAAGGGGGAGAAGAAAGG - Intergenic
927475473 2:23411197-23411219 GTGAGGGAGGGGCAGTTCAAGGG + Intronic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
927826830 2:26315168-26315190 CTGAGGGAGTGGGAGTGAAAGGG + Intronic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928029673 2:27767821-27767843 GTGAGGGAGGTGAGCTAGAAAGG - Intergenic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928399543 2:30967945-30967967 CTCAGGTAGAGGAAGGAGAAAGG - Intronic
928931880 2:36633315-36633337 GGGAGGGAGGGGAGGGAGAAAGG - Intronic
929694665 2:44104006-44104028 CTCAGGGAGGGGAAAATGAAAGG - Intergenic
930270562 2:49251547-49251569 GGGAGGGAGGGGAAGAGGAAGGG - Intergenic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
931443620 2:62308512-62308534 CTGAGAGAGAGGAAGGAAAAGGG + Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931849257 2:66236295-66236317 CTGAGGGGGGGGGGGTAAAAGGG + Intergenic
932322183 2:70830403-70830425 CTAAGGGAGTGGAAGGAGAAGGG + Exonic
932759256 2:74428760-74428782 GTGAGGTAGGGGAATGAGAAGGG + Intronic
933387300 2:81627464-81627486 CTGAGGGAAGGGATGAAGAGAGG + Intergenic
933761496 2:85675350-85675372 CAGAGGGAGGGAAGGAAGAAAGG + Intergenic
933896243 2:86812357-86812379 GTGAGGAAGGGAAAGTAGTATGG + Intergenic
933948451 2:87308432-87308454 AAGAGGGAGGTGAAGAAGAAAGG - Intergenic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934854787 2:97722939-97722961 TTGAGGGAGGGCAAATACAATGG + Intronic
935052411 2:99535038-99535060 CAGAGGTCGGGGAAGGAGAATGG - Intergenic
935473661 2:103490807-103490829 CTGAGGAAGAGGAAGAAGAGGGG - Intergenic
935831460 2:107004999-107005021 CTGAGGGAGGGGATGAGGGAGGG + Intergenic
935831463 2:107005011-107005033 ATGAGGGAGGGGATGAGGAATGG + Intergenic
936610363 2:113996542-113996564 ATCAAGGAGGGGAAATAGAAAGG - Intergenic
937072288 2:119073393-119073415 CTGAGGGAGGGAAGGAAGAAAGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937814024 2:126231524-126231546 CAGAAGGAGGGGGAGGAGAATGG - Intergenic
937899863 2:127011692-127011714 CTGGGGGAGGGGAGGAGGAAAGG - Intergenic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938270799 2:129969162-129969184 CTGAGGGGGTGGAAAAAGAATGG - Intergenic
938613336 2:132971798-132971820 CTGGGGGAGGAGAAGAAGTACGG + Intronic
938841459 2:135168831-135168853 CTGAGGGAGGGAAGGTACCAGGG + Exonic
939437775 2:142200727-142200749 CTGAGAGAATGCAAGTAGAAGGG - Intergenic
939606063 2:144255685-144255707 CTGAAGGAGGGAGAGAAGAAGGG + Intronic
939963998 2:148592835-148592857 CTGAGAGAGGGGAAGCAGTGGGG - Intergenic
940111067 2:150154649-150154671 CTGAGGGAAGGGAAAAGGAAGGG - Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941069529 2:160940406-160940428 CTGAGGGAGAGAAACTAGGAGGG - Intergenic
941563181 2:167075259-167075281 TAGAGGGAGGTGAAGAAGAAAGG + Intronic
941956113 2:171206406-171206428 ATGAGAGAGGAGAGGTAGAAAGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942075404 2:172352690-172352712 CTGAGCCAGGGGAAGAAGAAAGG + Intergenic
943877070 2:193081368-193081390 CTGATGGAGGCCAAGGAGAAGGG - Intergenic
944464051 2:199982696-199982718 CTGAGAGAGGGGGGGAAGAAAGG - Intronic
944534759 2:200697753-200697775 CTGAGGGAGAGGCAATGGAAAGG + Intergenic
945317391 2:208384493-208384515 TTGAGGGAGAGGTAATAGAATGG - Intronic
945875073 2:215269462-215269484 CTGAGAGAGCTAAAGTAGAAAGG - Intergenic
946137530 2:217659904-217659926 CTGAGGGGGAGGAGGTGGAATGG + Intronic
946399671 2:219461710-219461732 CTCAGGGAGGGGAAGAAGCTGGG + Intronic
946400688 2:219466916-219466938 CTGAGGGAGGGGAAACTGAGAGG - Intronic
946516183 2:220413621-220413643 ATGAGGGAAGGAAAGAAGAAAGG - Intergenic
948101213 2:235374746-235374768 GTGACGGAGGGGAGGGAGAAGGG - Intergenic
948318702 2:237051679-237051701 CTGAGGCAGAGGCAGCAGAATGG + Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948830677 2:240596960-240596982 GGGAGGGAGGGGGAGCAGAAGGG + Intronic
1168795486 20:608176-608198 GTGGGGGAGGGGAAGCACAAAGG - Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169276861 20:4239066-4239088 CTGGGGGAGGGAGAGTAAAATGG + Intronic
1169292412 20:4364137-4364159 TTGAGGGATGGGAAGAAGGATGG + Intergenic
1169889573 20:10437632-10437654 TGGAGGGAGGAGAAGCAGAAAGG - Intronic
1169900832 20:10550414-10550436 GTGAGGGAGAGGAAGGACAAGGG - Intronic
1170509020 20:17057992-17058014 ATAAGGGAGGGGAAGAAGGAAGG + Intergenic
1170564801 20:17592772-17592794 CTGGGAGAGGGGAGGTGGAAAGG - Intronic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1171367687 20:24637349-24637371 TGGAGGGAGGGGACGTGGAAGGG - Intronic
1172053773 20:32139897-32139919 CTGAGGAAGGGGTACTTGAAAGG - Intronic
1172190054 20:33056516-33056538 CAGAGAGAGTGGAAGTAGGAAGG - Intronic
1172642111 20:36446796-36446818 CTGCGGGAGCGGAAGTAGCTGGG - Exonic
1173112253 20:40202979-40203001 ATGAAGGAGGGGAAGGGGAAGGG + Intergenic
1173149957 20:40558574-40558596 GGGAGGGAGGGGAAGGAGAAAGG + Intergenic
1173253031 20:41374617-41374639 CAGAGGGAGGGGACTTAGGAGGG + Intergenic
1173955028 20:47024982-47025004 CTGAGGAAGAGGAAGAAGATAGG - Intronic
1174219506 20:48942139-48942161 ATGAGGGAGGGAAAAGAGAAAGG + Intronic
1174911100 20:54608454-54608476 ATAAGGAAGAGGAAGTAGAAAGG + Intronic
1175225051 20:57439748-57439770 ATGGGGGTGGGGCAGTAGAAGGG + Intergenic
1175232737 20:57484262-57484284 ATAAGGGATGGGAAGGAGAATGG + Intergenic
1175303956 20:57963315-57963337 CACAGAGACGGGAAGTAGAATGG + Intergenic
1175392431 20:58635831-58635853 TGGAGGGAGGGGAAGAAGAGAGG + Intergenic
1175589786 20:60179877-60179899 CATAGGGAGGGGAAGTTGCATGG - Intergenic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1175748067 20:61475483-61475505 AGGAGGGAGGGGAGGTAGAGAGG - Intronic
1175873533 20:62219344-62219366 CTGGGGGAGGGGACATGGAAGGG - Intronic
1175978565 20:62725783-62725805 CGGAGGGAGAGGGAGAAGAAGGG + Intronic
1176738827 21:10578737-10578759 CTGAAAGAAGGGAAGGAGAAAGG + Intronic
1177412555 21:20749245-20749267 CTGAGGGAAGGGTAGGAGACAGG - Intergenic
1178249424 21:30987640-30987662 GGGTGGGAGGGGAAGTAGAAAGG + Intergenic
1178319867 21:31597213-31597235 GGGAGGGAGGGGAAGGGGAAGGG - Intergenic
1178379148 21:32093604-32093626 GAGAGGGAGGGAAAGAAGAAAGG - Intergenic
1178389391 21:32185798-32185820 CAGAGGGAGGGGAGGTGGCAGGG - Intergenic
1178871208 21:36378104-36378126 GGGAGGGAGGGGAAGCAGAGCGG + Intronic
1179042361 21:37815436-37815458 CTTGGGGAGGGGGAGAAGAATGG + Intronic
1180013088 21:45064255-45064277 GGGAGGGAGAGGAAGAAGAAGGG - Intergenic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181471963 22:23145981-23146003 CTCAGGCAGTGGAAGTAGAGTGG - Intronic
1181625436 22:24119495-24119517 CTGTGGGATGGGAAGAAGAGAGG + Exonic
1181663367 22:24370916-24370938 CTGGGGGAGGGAAAAAAGAAAGG + Intronic
1181774167 22:25147766-25147788 GTGAAAGAGGGGAAGAAGAAGGG + Intronic
1181923515 22:26339316-26339338 CAGAGAGAGGGAAAGAAGAAAGG + Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182668002 22:31973043-31973065 CTGATGCAGGGGAGGAAGAATGG + Intergenic
1183042639 22:35193666-35193688 CGGAGGGAAGGGAAGAAGGAAGG + Intergenic
1184183059 22:42844086-42844108 CAGTGGGAGGGGAAGAAGAGGGG + Intronic
1184403685 22:44287927-44287949 CTGAGGGAGGAGACGGGGAAAGG + Intronic
1184465708 22:44668257-44668279 GGGAGGGAGGGGAAGACGAATGG - Intergenic
1184554248 22:45224809-45224831 CTGAGGCTGAGGAAGTAGAGTGG + Intronic
1184769668 22:46589853-46589875 CTGAGGGAGGGGAGGCAGTCAGG - Intronic
1184898697 22:47429695-47429717 CAGAGGGAGGGGTTGTAGAAAGG + Intergenic
1185201290 22:49507091-49507113 GGAAGGGAGGGGAAGGAGAAAGG + Intronic
949605549 3:5649208-5649230 CTGCTGGTGGGAAAGTAGAATGG + Intergenic
949854735 3:8451113-8451135 CTGTGGGAGGGGAAGAGAAATGG - Intergenic
950078523 3:10204974-10204996 CTAAGGGAGGGGAGGGAGATGGG - Intronic
950256372 3:11510078-11510100 CTGGGGGAGGGGCAGAAGATGGG - Intronic
950259898 3:11536130-11536152 GTGAGGGGGAGGAATTAGAAAGG + Intronic
950298269 3:11850833-11850855 CTGATGGAGGGGAAGGAGAGGGG + Intergenic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950688973 3:14640625-14640647 CTGAGGGAGGGGGACTAGGAGGG + Intergenic
950840393 3:15963255-15963277 CTGGGAGAGAGGAAGCAGAAAGG + Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951224402 3:20104392-20104414 ATGAGGAAAGGGAAGTAGAGAGG + Intronic
951899232 3:27640714-27640736 GTGAGGGAGTGCAAGTAGATGGG + Intergenic
952202043 3:31139790-31139812 TAGAGGGATGGGAAGAAGAAGGG + Intergenic
952410915 3:33048972-33048994 CAGAGGGAGGGGCAGGAGAGAGG + Intronic
952461564 3:33531915-33531937 CTGGTGGTGGGGAAGTAAAATGG + Intronic
952967538 3:38630544-38630566 CTGAGGGAGGAGAGGGGGAAGGG + Intronic
953150556 3:40320435-40320457 CTGGAGTAGGGGAAGAAGAAGGG + Intergenic
953554148 3:43929420-43929442 CTGCTGGAGGGGATGTAAAATGG + Intergenic
953974506 3:47371838-47371860 CTGAGGGAGGGCCAGAAGAGAGG - Intergenic
954525697 3:51268869-51268891 CTGTGGGAGGGGAATCAAAAAGG - Intronic
954784477 3:53082802-53082824 GTGGGGGTGGGGAAGTATAATGG + Intronic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
955343716 3:58145566-58145588 CAGAGGGAAGGTAAGTGGAAAGG - Intronic
955727986 3:61953068-61953090 CTGGGGCACGGTAAGTAGAAAGG - Intronic
955832662 3:63020983-63021005 CTGATGGAGGGGAATCAGAAGGG - Intergenic
955924087 3:63988941-63988963 CAGAGGGAAGGGAAAGAGAAAGG + Intronic
956405472 3:68924435-68924457 CAGAGAGACAGGAAGTAGAAAGG + Intronic
956652311 3:71515628-71515650 GGGAGGGAGGGGGAGGAGAAAGG + Intronic
956741202 3:72277551-72277573 CTGAGGTTGGCGAAGCAGAAAGG + Intergenic
956765470 3:72480933-72480955 TTGAGGGAGGGGAAGGAATATGG + Intergenic
956833621 3:73077478-73077500 CTGAGGAAGGGGAATTTGATAGG - Intergenic
956984314 3:74679563-74679585 CTTAGGGACAGAAAGTAGAAGGG + Intergenic
957562417 3:81839657-81839679 ATGGGGGAGGGGAAGGAGTAGGG + Intergenic
958182416 3:90077097-90077119 GTGAGGGAGGGGAAAGAGAGAGG + Intergenic
959619699 3:108386614-108386636 CTGAGGGAGGAAGAGGAGAAGGG - Intronic
959739636 3:109702431-109702453 TTGTGGGAGGGGAATGAGAATGG + Intergenic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960266207 3:115624012-115624034 TTGAGGGTGTGGACGTAGAAAGG + Intronic
960692241 3:120359050-120359072 CTGGGGTGGGGGAATTAGAAAGG + Intergenic
960951201 3:122999650-122999672 CCTGGGGAGGGGAAGGAGAAAGG - Intronic
961180581 3:124873415-124873437 GTGGGGGAGGGGAGGAAGAAGGG - Intronic
962675037 3:137749821-137749843 GTGAAGGAGGGGAAGCAGAGGGG + Intergenic
962747843 3:138410771-138410793 CTGAGGGAGGGGAGGCAGCCGGG + Intergenic
962866695 3:139453207-139453229 CTGAGGGCTGGGCAGAAGAAAGG - Intronic
963145361 3:141988502-141988524 CTGAGGCAGGAGAACTAGAGGGG - Intronic
964297306 3:155247772-155247794 AAGAGGGAGAGGAGGTAGAAGGG + Intergenic
964468565 3:157026237-157026259 CAGAGTGAGAGGAAGAAGAAAGG - Intronic
964763166 3:160153407-160153429 CTGAGGGAGGCCAAGAAGGATGG - Intergenic
964892650 3:161555491-161555513 CTGAGGGATGTGAAGAACAAAGG - Intergenic
965578818 3:170245589-170245611 ATGAGGGAGAGGAAGAAGACAGG - Intronic
965816490 3:172641937-172641959 ATAAGTGATGGGAAGTAGAAGGG - Intronic
966676545 3:182596202-182596224 CTCAGAGAGGAGAAGTACAAAGG + Intergenic
966737382 3:183198428-183198450 GTGAGGGAGGGGCAGGAGAAAGG + Intronic
966997713 3:185300032-185300054 CTTAGAAATGGGAAGTAGAATGG - Intronic
967420368 3:189265707-189265729 CAGAAGGAGGGGGAGTAGGAAGG - Intronic
967954707 3:194869280-194869302 CTGAGGGAGGGGAAGGAAAGGGG + Intergenic
968035614 3:195544940-195544962 CTCAGCGAGGGGAAGCAGGATGG + Intergenic
968298145 3:197593055-197593077 CAGAGGGCAGGGAAGGAGAAGGG + Intergenic
968462495 4:732364-732386 GAGAGGGAGGGGAAGGAGAAGGG - Intronic
969155104 4:5203356-5203378 TTGAGGGAAGGGGAATAGAATGG - Intronic
969334972 4:6502465-6502487 CAGAGGGAGGGCAGGAAGAAGGG - Intronic
969432335 4:7162709-7162731 CTTAGGGAGTGGAGGAAGAAGGG + Intergenic
971115034 4:23635815-23635837 CTGTTGGTGGGGAAGTAAAATGG + Intergenic
972340417 4:38148139-38148161 CAGACTGAGGGGATGTAGAAAGG - Intergenic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
972782729 4:42300123-42300145 AGGAGGGAGGGGAGGAAGAAAGG - Intergenic
972817703 4:42662174-42662196 CTGAGGGATGGGGGGTGGAATGG + Intergenic
973314361 4:48744333-48744355 TTGAAGGAGGGGAAGGAGAGAGG + Intronic
973857040 4:55022098-55022120 AAGAGGGAGGGAAAGAAGAAGGG + Intergenic
973900435 4:55464596-55464618 TAGAGGGTGGGGAAGTAAAAAGG + Intronic
975010912 4:69349987-69350009 CTGAGCGGGGAGAAGTAGAAAGG - Intronic
975177397 4:71303756-71303778 GGGAGGGAGGGGAAGAAGAAAGG - Intronic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
975381886 4:73710125-73710147 CTGAGAAAGGAGATGTAGAAAGG + Intergenic
976628760 4:87216146-87216168 CTGGGGGTGGGGAAGAAGAGAGG + Intronic
976635013 4:87278812-87278834 CTGAGGGAAAGGAAATAGACTGG - Intergenic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
976753860 4:88477545-88477567 GTGGGGGAGGGGAAGGGGAAGGG + Intronic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
977051687 4:92136186-92136208 GTGGGGAAGGGGATGTAGAAAGG + Intergenic
977292738 4:95181145-95181167 CTGAGGGCGGGGAAGAAGTGAGG - Intronic
978328963 4:107590467-107590489 CTGAGGAAGGGTGAGTAAAATGG - Intronic
978810612 4:112845580-112845602 CTGGGGTTGGGGAAGTTGAATGG + Intronic
978870926 4:113576849-113576871 ATGAGGGAGGGGAATTAGAAGGG - Intronic
979449912 4:120858632-120858654 CAGAGGGACGGAAGGTAGAAGGG - Intronic
980604505 4:135071871-135071893 GGGAGGGAGGGAAAGGAGAAAGG - Intergenic
980986118 4:139696157-139696179 CTGAGGAAGAGGAAGAAGAGGGG + Intronic
983523084 4:168731052-168731074 CTGAAGGTGGGGAAGAGGAATGG - Intronic
983989410 4:174099330-174099352 CTGAAGGGGGGAAAGTAGGATGG + Intergenic
984251993 4:177346601-177346623 CGGAGGGAGGAGAGGCAGAAAGG - Intronic
984586603 4:181571201-181571223 CTGGAGGCGGGAAAGTAGAAAGG + Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
985333169 4:188863389-188863411 CTGAGGAGGAGGAAGAAGAAGGG - Intergenic
985658538 5:1144198-1144220 CTCAGGGAGGGGAAGTTGGCCGG + Intergenic
986056144 5:4138695-4138717 AAGGAGGAGGGGAAGTAGAACGG - Intergenic
986746585 5:10750243-10750265 CTGATGAACGGGAAGGAGAATGG + Intronic
987043216 5:14082668-14082690 CTGCGGGAGATGAAGTAGGATGG + Intergenic
987193871 5:15505543-15505565 GGGAGGAAGGGGAACTAGAATGG + Intronic
987468158 5:18296725-18296747 CTGAGGGAGAGAAGGTAGGATGG + Intergenic
987890287 5:23867654-23867676 GGGAGGGAGGGAAAATAGAAAGG - Intergenic
990774935 5:59295761-59295783 CTGAGGTAGGAGGAGGAGAATGG - Intronic
990898494 5:60725314-60725336 CATAGGGACAGGAAGTAGAATGG - Intergenic
991126475 5:63075436-63075458 CAGTGGGAAGGGAAGTAGAGGGG - Intergenic
992160570 5:73996811-73996833 GTGAGAGAGGGAAAGGAGAATGG - Intergenic
992180754 5:74196023-74196045 TGAAGGGAGGTGAAGTAGAAGGG + Intergenic
992431921 5:76718006-76718028 CTTTGGGAGGGAAAGAAGAAAGG + Intronic
992921320 5:81524792-81524814 CACAGGGAGGGGAAGAAGAATGG + Intronic
993127422 5:83852353-83852375 CTGTCGGAGGGTAAATAGAAGGG - Intergenic
993212170 5:84965731-84965753 CAGAAGGAGGTGAAGTGGAATGG + Intergenic
993322469 5:86489081-86489103 ATGAGGGAGGGAAAATACAAAGG + Intergenic
995400536 5:111736020-111736042 CTGAGGGAGGGGCGGGAGATAGG + Intronic
995637402 5:114209302-114209324 CAGAGGAAGGGGAACTAGTAAGG - Intergenic
995759527 5:115548667-115548689 CTGAGGAATGGGATGTGGAATGG + Intergenic
995769893 5:115657185-115657207 CTGAGGGAGGGCAAAAAGTAAGG + Intergenic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
996022238 5:118604088-118604110 ATAAGGAAGGGGAAGGAGAAGGG - Intergenic
996111464 5:119571242-119571264 GGAAGGGAGGGGAAGAAGAAGGG - Intronic
996416326 5:123214566-123214588 CTGTGGGAGGTGAAGGAGAGGGG - Intergenic
996619020 5:125477775-125477797 CCGTGGGAGGTGAAGCAGAAAGG + Intergenic
997175851 5:131776763-131776785 ATGAGGGAGAGTAACTAGAAAGG + Intronic
997460250 5:134047096-134047118 CTTTGGGAGGGGCAGGAGAAAGG - Intergenic
998834506 5:146190643-146190665 GGGAGGGAGGGAAAGGAGAAAGG + Intergenic
998874289 5:146583797-146583819 CTGAGGAAGCTGGAGTAGAAGGG - Intronic
1000022277 5:157328354-157328376 TTGGGGGCGGGGAACTAGAAAGG + Intronic
1000030024 5:157393565-157393587 CTGAGAGAGGGGAGTTAGAATGG - Intronic
1000179299 5:158792361-158792383 CTGAGGGGTGGGAAGAAGAAAGG - Intronic
1000240302 5:159402701-159402723 CAGGGGTAGGGGGAGTAGAATGG + Intergenic
1000984845 5:167855696-167855718 GGGAGGGAAGGGAAGGAGAAAGG + Intronic
1001434290 5:171687238-171687260 GTCAGGGAGAGGAAGAAGAAAGG + Intergenic
1001566984 5:172706228-172706250 CTGAGAGTGGGGGAGAAGAAGGG + Intergenic
1002327633 5:178420386-178420408 CTCAGGGAGGGGAGGGGGAAAGG - Intronic
1002327719 5:178420611-178420633 CTCAGGGAGGGGAGGAGGAAAGG - Intronic
1002755254 6:153143-153165 ATGGGAGAGGGGAAGTTGAAGGG + Intergenic
1003141860 6:3478425-3478447 CTGATGGAGGGAAAGAAGACAGG - Intergenic
1003403364 6:5809100-5809122 CTGATGGAAGGGAAGGAGAAGGG - Intergenic
1004886812 6:20059092-20059114 CCATGGGTGGGGAAGTAGAATGG + Intergenic
1004934096 6:20490768-20490790 CTGACGGATGGGCTGTAGAATGG + Exonic
1005147499 6:22708170-22708192 CAGAGGGAATGGAAGCAGAAAGG - Intergenic
1005160641 6:22858446-22858468 ATGAGGGAGATGAAGGAGAAAGG + Intergenic
1005310021 6:24550222-24550244 CTGAGGGAGGGTAATTATACTGG - Intronic
1005809620 6:29506056-29506078 CTGAGGGTGGGGATGAAGAAGGG - Intergenic
1006171791 6:32097306-32097328 CTGAGGGTGGGGAAGAGGGAGGG + Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006411737 6:33877858-33877880 CTGGGGGAGAGGCAGGAGAAGGG - Intergenic
1006562968 6:34929759-34929781 GAGGGGGAGGGGAAGGAGAAGGG - Intronic
1006829747 6:36961641-36961663 CTGAGGGAGTGGGAGGAGAGGGG + Intronic
1007360720 6:41353343-41353365 CTGAGGGAAGGGAACAGGAAGGG + Intergenic
1007825704 6:44599092-44599114 CTTAGGGAGGGGGAGCTGAAGGG - Intergenic
1008922592 6:56858208-56858230 CAGAGGGAGAGGAAGCAGGAAGG + Intronic
1009826694 6:68875220-68875242 CAGAGGGAGGGGGAGAGGAAGGG - Intronic
1010340096 6:74740250-74740272 TTCAGGAGGGGGAAGTAGAAGGG + Intergenic
1010489588 6:76459481-76459503 CTGAGGGAGTGAAAGAAGGAAGG - Intergenic
1011002321 6:82604718-82604740 TTGAGGGAGGGAAAGTGGCAGGG + Intergenic
1011084222 6:83521485-83521507 GTGAGGGAAGGGAAGGAGAAGGG - Intronic
1011832667 6:91392101-91392123 GTGAGGGAGGAGAAAAAGAATGG + Intergenic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1012676683 6:102122540-102122562 CTGAGAGTGAGGATGTAGAAGGG - Intergenic
1013394414 6:109720524-109720546 GTGAGGGAGGGGGAGAAAAATGG - Intronic
1013538573 6:111085912-111085934 CTCATGGAGGTGAAGTACAATGG - Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014080449 6:117280952-117280974 TTGAGGGAGGGGAAGGAAAAGGG + Intergenic
1014125842 6:117776273-117776295 TGGAGGGAGGGGAAGGGGAATGG - Intergenic
1014377685 6:120696416-120696438 AGGAGGGAGGGAAAGAAGAAAGG + Intergenic
1014858509 6:126432694-126432716 CTGAGTGAGAGGCATTAGAATGG - Intergenic
1015250754 6:131125011-131125033 GGGAGGGAGGGAAAGAAGAAAGG - Intergenic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1015784382 6:136905978-136906000 CTAAGGCAGTGGAGGTAGAAAGG - Intronic
1015882355 6:137881727-137881749 CTGGGGGAGGGGAGGTGGAATGG - Exonic
1016388553 6:143552382-143552404 CTGAGGGAGTAGGAGTTGAAGGG + Intronic
1016785362 6:148005546-148005568 AGGAGGGAGGGAGAGTAGAATGG + Intergenic
1016951197 6:149581868-149581890 CTAAGGGAGGTGAGGTAGACAGG - Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1018162264 6:161056747-161056769 CTGAGGAAGGTGAAGGAAAAAGG - Intronic
1018379072 6:163241160-163241182 CTGAGAGAGGGGAAGAAAAAAGG + Intronic
1018549146 6:164974716-164974738 CTGAGAAATGGAAAGTAGAATGG - Intergenic
1018735633 6:166685431-166685453 CTGAGGGAGGACAAGTGGGATGG - Intronic
1018745942 6:166762206-166762228 CTGAGGGAGGGGAGGACGCAGGG - Intronic
1019101642 6:169635432-169635454 CTGAGGGAGGGGCCGCAGGAGGG + Intronic
1019207465 6:170374684-170374706 CTGAGTGAAGGGAAGAAGAAAGG - Intronic
1019695218 7:2442081-2442103 CTCAGAGACAGGAAGTAGAATGG - Intergenic
1019972213 7:4550170-4550192 TTGGGGGAGGGGGATTAGAATGG + Intergenic
1020083405 7:5298098-5298120 CTGAGGGTCGGGAACCAGAATGG + Intronic
1020115545 7:5474136-5474158 CATAGGGACAGGAAGTAGAATGG + Intronic
1021848274 7:24783720-24783742 CTGAGGGAGGGGAACTTCACAGG + Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022442543 7:30446128-30446150 CTGAGGTTGGGTGAGTAGAAGGG - Exonic
1022617386 7:31945767-31945789 CTGAAGGAGAGGAAAGAGAATGG - Intronic
1022638464 7:32159647-32159669 ATAAGGGAGGAGAAGTAGAAAGG + Intronic
1022832771 7:34085077-34085099 CTGAGGGATAGCAATTAGAAGGG + Intronic
1023382324 7:39622118-39622140 TTGAGGGAGGGGCAGGATAAGGG - Intergenic
1023711633 7:42999674-42999696 CTGAGAGAGGTGAGGAAGAAGGG - Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024178165 7:46861896-46861918 AGGAGGGAAGGGAAGAAGAAAGG + Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024327261 7:48118824-48118846 TTGAGGGTTGGGAAGTAGGATGG - Intergenic
1025623443 7:63196170-63196192 CTAAGGGAGTGAAAGTAAAACGG + Intergenic
1025725592 7:64055559-64055581 CAGAGAGAAGGAAAGTAGAATGG - Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026245385 7:68615127-68615149 GAGAGGGAGGAGAAGAAGAAAGG + Intergenic
1026359516 7:69590862-69590884 GTAAGGGAGTGGAAGGAGAAAGG + Intergenic
1026520506 7:71113698-71113720 GGGAGGGAGGGAAAGAAGAAAGG - Intergenic
1026924113 7:74177535-74177557 CTCAGAGACAGGAAGTAGAATGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027159765 7:75793773-75793795 GAGAGGGAGGGGAAGGGGAAGGG + Intergenic
1028577371 7:92366951-92366973 CTAGGGAAGGGGAAGAAGAATGG + Intronic
1028610394 7:92703946-92703968 CTGAGGCAGAGTAAGTAGGAAGG - Intronic
1028730846 7:94146852-94146874 ATGAGGGAGGGGGAGGAGCAGGG - Intergenic
1028929008 7:96392157-96392179 CTGAGGGAGAGGCAGAAAAAAGG - Intergenic
1029184466 7:98728721-98728743 GGGAGGGAGGGAAAGAAGAAGGG - Intergenic
1029400472 7:100342280-100342302 GTGGGGGAGGGGAGGGAGAATGG - Intronic
1029795849 7:102893812-102893834 ATGGGGGAGGGGGAGAAGAAGGG + Intronic
1029820153 7:103138953-103138975 TTGAGGGAGTGGAAATAGGAGGG - Intronic
1030617962 7:111757996-111758018 CTGAGGGTGCTGAAGTAGGAAGG + Intronic
1030866872 7:114710790-114710812 TTGAGGGAGAGGCAGCAGAAAGG + Intergenic
1030952884 7:115814073-115814095 TTAAGGGAGGGGAGGTAGAGAGG - Intergenic
1031043612 7:116863149-116863171 TTGAGGAGGGGGAAGTAGAAGGG - Intronic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032540014 7:132695064-132695086 CTGAGGGAGGGCATGTTGCAGGG + Intronic
1032650139 7:133869057-133869079 TTCAGGGAGGGTAACTAGAAAGG - Intronic
1033619701 7:143051193-143051215 CGGCGGGAGGGGAAGTGCAATGG + Intergenic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034545817 7:151788198-151788220 CTGTGGGTGGGAAAGTAAAATGG - Intronic
1034636482 7:152571370-152571392 CTGAGCTATGGGCAGTAGAAGGG + Intergenic
1034944937 7:155255689-155255711 GAGGGGGAGGGGAAGAAGAAGGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036504691 8:9344728-9344750 GGGAGGGAGGGAAAGAAGAAAGG + Intergenic
1036658899 8:10695089-10695111 ATGGGGGAGGGGAAGGGGAATGG + Intronic
1036718756 8:11152467-11152489 CTGAAGGAAGGAAAGAAGAAGGG + Intronic
1037103735 8:15079869-15079891 GAGAGGGAGGGGGAGAAGAAAGG - Intronic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037926908 8:22850814-22850836 CTCAGGGAGGGGTAGGAGGAAGG + Intronic
1037952431 8:23027911-23027933 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1037963654 8:23117476-23117498 CTGAGGAAGGGGGATGAGAAGGG - Intergenic
1037967399 8:23145246-23145268 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1038840123 8:31177070-31177092 GTGGGGGAGGGGCAGTTGAAAGG - Intergenic
1039217879 8:35293182-35293204 AAGAGGTAGTGGAAGTAGAAGGG + Intronic
1039444195 8:37617855-37617877 CTCAGGGAGGTAGAGTAGAATGG + Intergenic
1039939802 8:42080372-42080394 GGGAGGGAGGGGAAGAAGGAAGG - Intergenic
1040619853 8:49079309-49079331 CTGAGGGACTTGAAGAAGAAAGG - Intergenic
1040978924 8:53225134-53225156 CTTAGGCATGGGAAGTAAAAAGG - Intergenic
1040987304 8:53309910-53309932 CTGAGGGTTGGGGAGTGGAAGGG - Intergenic
1041150078 8:54922953-54922975 CTTTGGGAAGGGAAGCAGAAGGG + Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041413942 8:57587017-57587039 GGGTGGAAGGGGAAGTAGAAAGG + Intergenic
1041466228 8:58160091-58160113 CTAAGGGAGAGGAAGGAGCAAGG - Intronic
1041729311 8:61048818-61048840 GTGAGGGAGGGGAAGAGGGAAGG - Intergenic
1042030879 8:64474222-64474244 CTGATGGATGGGAAAAAGAAAGG + Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1043398055 8:79857815-79857837 CTGAGGGAGGAGAAGCAAAAAGG - Intergenic
1043673980 8:82925850-82925872 CTGAAGGAGCAGAAGTAAAAGGG + Intergenic
1044338886 8:91024068-91024090 CTGAGAGAGGTGAAGTAGTCAGG + Intronic
1044527127 8:93264831-93264853 GAGAGGGATGGGAAGTGGAAAGG - Intergenic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1045820550 8:106332047-106332069 CTGAGGATGGGGAGGAAGAAGGG - Intronic
1046072313 8:109271607-109271629 CTGGAGGAGGGCAAGAAGAATGG + Intronic
1046836079 8:118803077-118803099 CTGTAGGAGGGGAAGCAGATGGG + Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1047794718 8:128242876-128242898 GGGAGGGAGGGAAAGAAGAAAGG - Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048896971 8:139000945-139000967 ATGAGGGAGGGGCAGAATAAAGG - Intergenic
1048924308 8:139257027-139257049 CAGAGGGAAGGGAAGAAGAGTGG - Intergenic
1049556701 8:143286091-143286113 CTGGGGGAGGGGAAGGGAAAGGG - Intergenic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1051160842 9:14205274-14205296 GGGAGGGAGGGAAAGAAGAAAGG + Intronic
1052443502 9:28529156-28529178 CTGAGGTACTGGAAGGAGAATGG - Intronic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1053185153 9:36009722-36009744 ATGAGGCAGGAGAAGCAGAAAGG + Intergenic
1053590636 9:39510998-39511020 CTGAGAACGGGGAGGTAGAAGGG - Intergenic
1054575668 9:66854291-66854313 CTGAGAACGGGGAGGTAGAAGGG + Intergenic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055295177 9:74826619-74826641 CTGGAGGAGGGCAAGGAGAAGGG - Intronic
1055309271 9:74961673-74961695 CTGAGGGAGGGGCAAGAGCATGG + Intergenic
1055515705 9:77031136-77031158 GGGAGGGAGGGGAAGAGGAAAGG - Intergenic
1055552585 9:77445115-77445137 CTGATGGCGGGGAAGGAGAAGGG + Intronic
1055761124 9:79609461-79609483 TTGAGAGAGAGGAAATAGAATGG + Intronic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056318518 9:85414920-85414942 TTGAGAGAGAGGAAGGAGAAGGG + Intergenic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057442115 9:95090491-95090513 CTGCGGGAGGGGAGGTAGCCAGG + Intergenic
1057862317 9:98650873-98650895 CGTAGGGACAGGAAGTAGAATGG + Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1059636231 9:116173579-116173601 CTGAGGGAAATGAAGTACAATGG - Intronic
1059973334 9:119690127-119690149 CTCAGGGAGGAGAAGGAGAATGG - Intergenic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061012831 9:127965563-127965585 CTGAGGGAGGGGCAGACGGATGG - Intronic
1061099923 9:128484758-128484780 CTGAAGGAGTTGAAGCAGAAGGG + Exonic
1061228857 9:129300458-129300480 GGGAGGGAGGGGAAGAAGAAAGG - Intergenic
1061620354 9:131807654-131807676 CTGAGGGAGGGGGAGTATAGGGG - Intergenic
1061806772 9:133141300-133141322 GAGAGGGTGGGGCAGTAGAATGG - Intronic
1062218360 9:135401270-135401292 CTGAGGGATGGAAACTGGAAGGG + Intergenic
1062265291 9:135684087-135684109 CTGAAGGAAGGGAACTAGAAGGG - Intergenic
1185574923 X:1163691-1163713 CGGAGGGAGGGAAAGAAGAAAGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185822442 X:3218494-3218516 GGGAGGGAGGTGAAGGAGAAAGG + Intergenic
1185931176 X:4205103-4205125 AAGAGGCAGGGGAAATAGAACGG + Intergenic
1185999191 X:4989229-4989251 CGGAGGGAGGGGAGGTAGGGAGG - Intergenic
1186522845 X:10221108-10221130 CTGAGGGAGGTTGAGTAAAAAGG + Intronic
1186628195 X:11317755-11317777 ATGAAGGATGGCAAGTAGAATGG + Intronic
1186738948 X:12497043-12497065 TTCATGGAGGGGAAGAAGAATGG + Intronic
1187128873 X:16481677-16481699 GAGAGGGAGGGGAAGTGGGAAGG - Intergenic
1187293950 X:17981069-17981091 GAGAGGGAGGGGAAGGAGCAGGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187507410 X:19888172-19888194 CTGTTGGAGGGGAAGGAAAAGGG + Intergenic
1187587862 X:20683953-20683975 GGGAGGGAGGGGGAGAAGAAAGG - Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1188694334 X:33171264-33171286 TTGAGAAAGGGGAAGTAGTAGGG + Intronic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189110566 X:38286002-38286024 AGGAGGAAGGGGAAGAAGAAGGG - Exonic
1189650837 X:43187932-43187954 CTTAGGAAGAAGAAGTAGAAGGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190930859 X:54948805-54948827 CTATGAGAGGAGAAGTAGAAGGG - Intronic
1192801735 X:74471831-74471853 CTTAGGGACAGAAAGTAGAATGG - Intronic
1194674951 X:96783197-96783219 GAGAGGGAGGGGAAGAAAAAAGG + Intronic
1194723643 X:97369392-97369414 CTGAGGGAGGAGAGGTTTAAAGG + Intronic
1195681118 X:107547367-107547389 GTGGAGAAGGGGAAGTAGAAGGG - Intronic
1195957565 X:110348839-110348861 CTAAGAAAGGGGAAGTAAAATGG + Intronic
1196062346 X:111424020-111424042 CTGAAGGACAGGAAGTAGATAGG + Intergenic
1197983302 X:132241272-132241294 CTGAGGGAAGAGAAGTGCAACGG + Intergenic
1198517227 X:137421738-137421760 CTGAGTCAGAGGAACTAGAAGGG + Intergenic
1199779890 X:151048646-151048668 GTGGGGGAGGGGAGGTAAAAAGG - Intergenic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1201625707 Y:16012245-16012267 AGGAGGGAGGGGAGGAAGAACGG + Intergenic
1201696192 Y:16829111-16829133 CTGAGGGAGGGAGGGAAGAACGG + Intergenic
1202597565 Y:26558267-26558289 CTGAAAGAAGGGAAGGAGAAAGG + Intergenic