ID: 1161849627

View in Genome Browser
Species Human (GRCh38)
Location 19:6731721-6731743
Sequence GAGGCCAGATAAAGGCATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161849622_1161849627 -6 Left 1161849622 19:6731704-6731726 CCACCCAACAGGGCAGAGAGGCC 0: 1
1: 1
2: 2
3: 38
4: 241
Right 1161849627 19:6731721-6731743 GAGGCCAGATAAAGGCATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 155
1161849623_1161849627 -9 Left 1161849623 19:6731707-6731729 CCCAACAGGGCAGAGAGGCCAGA 0: 1
1: 0
2: 1
3: 30
4: 318
Right 1161849627 19:6731721-6731743 GAGGCCAGATAAAGGCATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 155
1161849624_1161849627 -10 Left 1161849624 19:6731708-6731730 CCAACAGGGCAGAGAGGCCAGAT 0: 1
1: 0
2: 2
3: 31
4: 250
Right 1161849627 19:6731721-6731743 GAGGCCAGATAAAGGCATTCGGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161849627 Original CRISPR GAGGCCAGATAAAGGCATTC GGG Intronic
902895136 1:19474505-19474527 GGGGCAAGATAAAGGAATGCAGG - Intronic
903554599 1:24184293-24184315 GAGGTCAGTTAAAGGGAGTCAGG - Intronic
903846030 1:26280366-26280388 GATGCCCGATGAAGACATTCAGG - Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906207998 1:43997242-43997264 GAGGCCACGTAAAGCCATCCAGG + Intronic
911364744 1:96924044-96924066 GAGGCCAAAGTAAGGCATTTTGG + Intergenic
915565495 1:156710568-156710590 TAGGCCAGATAACTGGATTCTGG + Intergenic
916479170 1:165199868-165199890 CATGCCAAATAAAGGGATTCAGG + Intergenic
917621689 1:176802518-176802540 GAGGCAAGATAAAGCCAAGCCGG + Intronic
917658119 1:177148025-177148047 GAGCCCAAATAAAGGCAAGCTGG + Intronic
923053034 1:230402074-230402096 GAGTCCAGATGAAGCCTTTCAGG + Intronic
923421275 1:233817735-233817757 GAGGCCAGATATAGGAAACCAGG + Intergenic
923764943 1:236884537-236884559 GAGACCAGGTACAGGCTTTCAGG + Intronic
1063567685 10:7185131-7185153 CAGGCCAGCTTAAGACATTCTGG - Intronic
1065208868 10:23383092-23383114 GGGGTAAGATAAATGCATTCTGG - Intergenic
1067211324 10:44262150-44262172 GAGTCCAGAGAAGGGCATTCAGG + Intergenic
1068388878 10:56366354-56366376 GAGGCCTGATATAGGCATATAGG - Intergenic
1071358246 10:84819138-84819160 GAGGCCAGCTACAGGCAGCCAGG - Intergenic
1074184172 10:111086762-111086784 TAGCCCAGATGAAGGCATTGGGG + Intergenic
1075052776 10:119195123-119195145 GAGGCCAGTTAAAAGCAGGCGGG - Intergenic
1075262672 10:120976658-120976680 GAGGCCAGATAAGGGAATCTAGG - Intergenic
1076484980 10:130810116-130810138 TAGGCCAGATAAGGCCCTTCTGG - Intergenic
1078159703 11:8830075-8830097 GAGGCCAGAGAAAGGCAGTGAGG - Intronic
1079202039 11:18384664-18384686 GTGGCCAGATAAAGGACATCAGG - Intergenic
1079518794 11:21300389-21300411 GAGGCCAGAAAAAGGGCTTTAGG + Intronic
1083734488 11:64671634-64671656 CAGGCCAGAGAAAGGCAGCCAGG + Intronic
1084855627 11:71983903-71983925 AAGGCCAGAGAAAGGCTTGCAGG - Intronic
1089342952 11:117772054-117772076 GAGGCCAGACATAGGCCTGCCGG - Intronic
1090254720 11:125275415-125275437 GAGGCCACACAAAGGCATTTGGG + Intronic
1091552049 12:1543449-1543471 GGGGCCAGAAAAAGACATTAGGG - Intronic
1096286627 12:50306070-50306092 TAGGTCATATAAAGGCATTGTGG + Intergenic
1097127628 12:56787451-56787473 GATGCCAGATAAATGAATTTAGG - Exonic
1098437317 12:70481711-70481733 GAGACCACATAAAGGACTTCTGG + Intergenic
1100778649 12:98000474-98000496 GGGGACAGATACAGGAATTCAGG - Intergenic
1102415443 12:112758344-112758366 GAGCCCAGGCAAAAGCATTCTGG - Intronic
1102424076 12:112826813-112826835 GAGAGCAGATAAAGCCATTGTGG - Intronic
1103887835 12:124216131-124216153 GAGGTAAGATGAAGGCATTCAGG - Intronic
1103938555 12:124489595-124489617 GAGGCAGGAAAAAGCCATTCAGG + Intronic
1104500717 12:129282883-129282905 GGGGCCAGATGAATGCACTCTGG + Intronic
1112795731 13:103054705-103054727 GAGGCCAGATGAAGTTTTTCAGG + Intronic
1114544139 14:23486190-23486212 GAAGCCAGATGAAGGTTTTCTGG - Intronic
1117878886 14:60287540-60287562 GAGAAAAGAAAAAGGCATTCAGG - Intronic
1120073340 14:80127401-80127423 GGAGCCAGAGAAAGGCATTTTGG - Intergenic
1120432295 14:84434361-84434383 GATTCCAGAAAAAGGCATTTTGG + Intergenic
1123433458 15:20237572-20237594 GAGGCCAAAGAAAGGCCTTTTGG - Intergenic
1124147163 15:27138607-27138629 GTGTCCAGATGAAGGCATCCAGG - Intronic
1128234000 15:66054671-66054693 AAGGCCAGATAATGGAATTAGGG + Intronic
1129287306 15:74536113-74536135 TAGGCCACATAAAGGAATTTAGG + Intergenic
1130111137 15:80966673-80966695 GAGGCCAGAGAAAAGCTTCCTGG - Intronic
1130150696 15:81309344-81309366 GAGGCCACCTATAAGCATTCAGG - Exonic
1130186498 15:81688614-81688636 GACACTAGTTAAAGGCATTCAGG + Intergenic
1134729466 16:16449068-16449090 GAGGCCAAGAAAAGGCCTTCAGG + Intergenic
1137264111 16:46854529-46854551 GAGGCCAGCTAAAGCGATTATGG - Intergenic
1144219169 17:13084403-13084425 GAGGCCAGGTAAAAACACTCAGG - Intergenic
1146700653 17:34956719-34956741 AGGGCAAGATAAAGCCATTCAGG - Intronic
1146924315 17:36733504-36733526 GAGGCCTGAGCAATGCATTCTGG + Intergenic
1147603286 17:41758975-41758997 GAGGCCAGACACAGACATACTGG + Intronic
1155866229 18:30968431-30968453 GAGGACAGAAAAAGTCATGCTGG - Intergenic
1156630521 18:38962893-38962915 GAGGGCAGGCAAAGGCATTTGGG + Intergenic
1161645515 19:5451157-5451179 GAGCCCAGATAATGGGGTTCAGG - Intergenic
1161849627 19:6731721-6731743 GAGGCCAGATAAAGGCATTCGGG + Intronic
1162562393 19:11424164-11424186 GGGGCCAGATAAAGGCACCCGGG + Intronic
1166376847 19:42332326-42332348 AAGGCCACACACAGGCATTCCGG - Intronic
1166663140 19:44660260-44660282 GGGCCCAGATACAGGCAGTCTGG - Intronic
1167198906 19:48050365-48050387 GAGGGAAGAGAAAGCCATTCTGG - Intronic
927398858 2:22687421-22687443 ACGGTGAGATAAAGGCATTCTGG + Intergenic
933803005 2:85977874-85977896 CAGGCCAGATGAGGGCTTTCAGG + Intergenic
934684838 2:96313401-96313423 GAGGCCAGCTGACAGCATTCTGG - Intergenic
937584494 2:123530094-123530116 GAGGCCAAATAGAGGCAATAAGG - Intergenic
940882872 2:158964398-158964420 GAGCACAAATATAGGCATTCTGG + Intergenic
944482450 2:200171849-200171871 GAGGCCACATATAGGTGTTCTGG - Intergenic
944488727 2:200234945-200234967 GAGGTAGGATAAAGCCATTCTGG + Intergenic
945138793 2:206661103-206661125 AAGGCCATATAAAGGCATGAGGG + Intronic
945676149 2:212857875-212857897 GAGCCCAGATAAAGACAAACAGG + Intergenic
1169430988 20:5536149-5536171 GAGGATAGATAAAAGGATTCTGG - Intergenic
1170746812 20:19106916-19106938 GAGGCCAGAGAAAATCATCCAGG - Intergenic
1171105819 20:22431219-22431241 AAGCCCTGATAAAAGCATTCGGG + Intergenic
1173040269 20:39455677-39455699 GAGGCAAGAAACAGGCTTTCTGG - Intergenic
1175392594 20:58636504-58636526 CAGGCCAGACACAGCCATTCAGG - Intergenic
1177438684 21:21089569-21089591 AATCCCAGATAAAGTCATTCTGG - Intronic
1177571534 21:22893374-22893396 TAGGCCAGAACAAGGCATTGTGG + Intergenic
1177926286 21:27219826-27219848 GAGGCCAGAAGAAGGAATGCTGG + Intergenic
1179367723 21:40773697-40773719 GATGCCATAGAAAGGCATTTGGG + Intronic
1179377648 21:40865096-40865118 GAGTCCAGATAAATGAATTTTGG + Intergenic
1181467718 22:23119027-23119049 GAGGCCAGCAGAAGGCATGCTGG + Intronic
1181543938 22:23590182-23590204 GATGCCACATAATGGCTTTCTGG + Intergenic
1182307334 22:29379611-29379633 GAGGCCAGGTAAAGGACTGCAGG + Intronic
1183334836 22:37240700-37240722 GAGATCAGATAAAGTCACTCTGG + Intronic
1183659345 22:39209488-39209510 GTGGCCATATAACGGCACTCTGG - Intergenic
1184042021 22:41949902-41949924 GAGGCCAGATAGAGGCCTGGAGG + Intergenic
1185234603 22:49704745-49704767 GAGGCCAGATAAGGGTTTGCGGG + Intergenic
949326618 3:2873099-2873121 GAGGGCAAGTAAAGGGATTCTGG + Intronic
950073849 3:10173239-10173261 GAGGCCAGATATTGGGATTCGGG - Intronic
950106446 3:10391960-10391982 GAGGTGAGGGAAAGGCATTCAGG - Intronic
950857767 3:16121382-16121404 GAAACCAGGGAAAGGCATTCTGG + Intergenic
952383283 3:32820292-32820314 GAAGCCAGCTAAAGGCCATCAGG - Intronic
954922898 3:54207086-54207108 AAGGCCAGATGAAGGGATTCTGG - Intronic
954948378 3:54446791-54446813 GAGGCCAGGGAAGGGCATGCTGG - Intronic
955010171 3:55006294-55006316 GAGGCCAGGGGAAGGCACTCAGG - Intronic
955064239 3:55520945-55520967 GGAGCCAGAGAGAGGCATTCTGG + Intronic
956041293 3:65148109-65148131 AAGGCAAGATAAAGGGATTTTGG + Intergenic
956558254 3:70544513-70544535 GAGTCCAGGTAAAAGCATTTTGG - Intergenic
958436153 3:94098305-94098327 GAGGCCAGTTAAAATCATTTAGG - Intronic
958792440 3:98667393-98667415 TAGGGCTGATAAAGGAATTCAGG + Intergenic
961064750 3:123865963-123865985 GAGGCCATATGTAGGCACTCTGG + Intronic
961514786 3:127425738-127425760 GAGGCCAGGTGAAGTCCTTCAGG - Intergenic
964939828 3:162144217-162144239 TAAGTCAGATAAAGGCATTTAGG + Intergenic
965485927 3:169278370-169278392 GATCCCAGTTAAAGGCATTTAGG - Intronic
967252845 3:187560718-187560740 GGGGCCAGGTAAAGTCCTTCAGG - Intergenic
968023880 3:195421257-195421279 GAGTCCAAACAAAGGCATTTTGG + Intronic
970585503 4:17511095-17511117 GGGACCAGAAAAAGGCTTTCAGG - Intronic
971878024 4:32329188-32329210 GAAACCAGGTAAAGGCTTTCAGG + Intergenic
978698131 4:111608074-111608096 GAGGTCACATATAGGCATGCCGG + Intergenic
979134101 4:117086576-117086598 GAGGCCATAAGTAGGCATTCTGG - Intergenic
979415985 4:120439360-120439382 GAGGGCAGAGAAGGGCTTTCAGG + Intergenic
981400252 4:144305467-144305489 GAGGACAGATAGAGTCATTTAGG - Intergenic
986403701 5:7404907-7404929 GAGGCCACATGAAGGTGTTCTGG - Intronic
989037480 5:37190679-37190701 GATGCCACATAATGGCACTCAGG + Intronic
989631642 5:43489384-43489406 GAGGCAAGATAAAGAAATTGAGG - Intronic
990184351 5:53197381-53197403 GAAGACAGATAAAAGCATTCAGG + Intergenic
993295357 5:86131619-86131641 GAGCTGAGATGAAGGCATTCTGG - Intergenic
998008545 5:138674369-138674391 GAGGCCACATGTAGGCACTCTGG + Intronic
999432760 5:151538329-151538351 TGGGCCTGATATAGGCATTCTGG + Intronic
1000046245 5:157524159-157524181 GAGGGCAGCTAAAGGAATTAGGG - Intronic
1001057052 5:168458360-168458382 GAGGCCAGAGGAAGGCCCTCAGG - Intronic
1001286566 5:170427991-170428013 GAGGAGAGAGGAAGGCATTCTGG - Intronic
1001735668 5:173997309-173997331 GAGCCAATATAAAGGCTTTCAGG + Intronic
1004055604 6:12135069-12135091 GAGGCCAGATATATGCCTACAGG + Intronic
1006136376 6:31898541-31898563 GAGGCCAATTAAAGGCCTTCTGG + Intronic
1006565977 6:34957683-34957705 CAAGTCAGATAAAGGCCTTCTGG - Intronic
1009493110 6:64316224-64316246 GAGGCAAGATAAAGAAATACAGG + Intronic
1011439353 6:87370839-87370861 GCCACCAGATAAAGGCATTCAGG + Intronic
1011881019 6:92026982-92027004 AAGGCTAGATAAAATCATTCAGG - Intergenic
1011883061 6:92056339-92056361 GGGGACAAAAAAAGGCATTCTGG + Intergenic
1013498546 6:110723218-110723240 AAGGCCACATGAAGGCAGTCTGG + Intronic
1014876674 6:126669822-126669844 GAAGGCAGATAAGGGGATTCAGG + Intergenic
1016354588 6:143204347-143204369 GAGGCCACATGTAGGCACTCTGG - Intronic
1016641908 6:146359273-146359295 GATGCCAGACCAAGGCATTCTGG + Intronic
1018426701 6:163689550-163689572 GAGGTCAAATAAAGGCATAAAGG + Intergenic
1019971287 7:4542966-4542988 GACGCCATATGTAGGCATTCTGG - Intergenic
1021848431 7:24784854-24784876 GAGGCTAGAAAAAGGCAGTCCGG - Intergenic
1022253226 7:28629410-28629432 GAGGCCAGAAAGAAGAATTCAGG - Intronic
1025603135 7:63017988-63018010 GATCCCAGAGGAAGGCATTCTGG + Intergenic
1026601495 7:71781356-71781378 GAGCCCTGAGAGAGGCATTCTGG + Exonic
1028404560 7:90461494-90461516 GAGGCCAGCTCAAGGGTTTCAGG + Intronic
1028984472 7:96998855-96998877 GGGGCCCGATAATGGAATTCAGG - Intergenic
1030773159 7:113499802-113499824 GAGACCAGAGGAAAGCATTCAGG + Intergenic
1032852385 7:135806031-135806053 GAGGAGAGATACAGGAATTCTGG + Intergenic
1033456145 7:141505734-141505756 GAGGATGGATAAAGGGATTCAGG + Intergenic
1036242769 8:7093122-7093144 GAGGGCAGATGAAGGCCTGCTGG + Intergenic
1036621760 8:10428643-10428665 GAGCACAGATAAAGGACTTCTGG - Exonic
1036708134 8:11059988-11060010 GTGGCCAGATACAGGCAATAAGG + Intronic
1036782101 8:11656859-11656881 GATGCCAAAGGAAGGCATTCTGG - Intergenic
1037360411 8:18068344-18068366 GAGGGGAGATTAAGGCATACGGG + Intronic
1039053431 8:33514900-33514922 GAGTCCAGAGAAAGCCCTTCGGG + Intergenic
1042837272 8:73090288-73090310 GAGGCAAAATTGAGGCATTCGGG + Intronic
1044731776 8:95234310-95234332 GAGGCCACATGTGGGCATTCTGG - Intergenic
1048405132 8:134111323-134111345 GAGGCCATAATAAGGCATTCAGG + Intergenic
1050033013 9:1406116-1406138 GAGGCCTGTTAAAAGCATTTTGG - Intergenic
1050746463 9:8882069-8882091 GAGAGCAGATAAAAGCAGTCTGG + Intronic
1052309581 9:27050925-27050947 GAATCCAGATAAAGGTATTATGG - Intronic
1056515193 9:87343332-87343354 GAGGCAAGGAGAAGGCATTCCGG - Intergenic
1058547129 9:106072542-106072564 GTAACCAGATAAAGGAATTCAGG + Intergenic
1190160827 X:48030318-48030340 GAAGCCACATAAACGCATGCAGG + Intronic
1190751674 X:53367398-53367420 GAGGCATGGGAAAGGCATTCGGG + Intergenic
1195446667 X:104959808-104959830 GAAAGCAGAGAAAGGCATTCTGG - Intronic
1195657411 X:107345339-107345361 GAGGCCAGAGAAAAGCCTCCAGG + Intergenic
1198483708 X:137065410-137065432 GAGGCCACATATAGGCACTCTGG + Intergenic
1201789728 Y:17826137-17826159 GAGGACAGAAACAGGCTTTCAGG + Intergenic
1201811826 Y:18079852-18079874 GAGGACAGAAACAGGCTTTCAGG - Intergenic