ID: 1161850923

View in Genome Browser
Species Human (GRCh38)
Location 19:6737614-6737636
Sequence GCTCATCGGTGGGCGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161850923_1161850937 9 Left 1161850923 19:6737614-6737636 CCCAAGCCCGCCCACCGATGAGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161850937 19:6737646-6737668 CACGGCGGGGCCCGGCCTTTCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1161850923_1161850930 -9 Left 1161850923 19:6737614-6737636 CCCAAGCCCGCCCACCGATGAGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161850930 19:6737628-6737650 CCGATGAGCCAATCGCCGCACGG 0: 1
1: 0
2: 0
3: 0
4: 15
1161850923_1161850935 1 Left 1161850923 19:6737614-6737636 CCCAAGCCCGCCCACCGATGAGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161850935 19:6737638-6737660 AATCGCCGCACGGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 36
1161850923_1161850932 -5 Left 1161850923 19:6737614-6737636 CCCAAGCCCGCCCACCGATGAGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161850932 19:6737632-6737654 TGAGCCAATCGCCGCACGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1161850923_1161850931 -6 Left 1161850923 19:6737614-6737636 CCCAAGCCCGCCCACCGATGAGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161850931 19:6737631-6737653 ATGAGCCAATCGCCGCACGGCGG 0: 1
1: 0
2: 0
3: 1
4: 11
1161850923_1161850933 -4 Left 1161850923 19:6737614-6737636 CCCAAGCCCGCCCACCGATGAGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161850933 19:6737633-6737655 GAGCCAATCGCCGCACGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161850923 Original CRISPR GCTCATCGGTGGGCGGGCTT GGG (reversed) Intergenic
900599556 1:3497201-3497223 GCTCCTCGGGGTGGGGGCTTGGG + Intronic
901749470 1:11397146-11397168 GCCCCTGGGAGGGCGGGCTTGGG + Intergenic
901872317 1:12145278-12145300 GCTCATCGCTGGGCAGGATGGGG - Intergenic
905854290 1:41297411-41297433 GCTCATCGGGGAGCTGTCTTTGG + Intergenic
906805819 1:48777742-48777764 GCTCAGTGGTGGGCGTGCTGTGG - Intronic
922505526 1:226123397-226123419 CCCCATCAGTGGGCAGGCTTGGG - Intergenic
924462733 1:244273884-244273906 GCTCATTAGTGTGGGGGCTTAGG + Intergenic
1063101187 10:2951331-2951353 GCTCATCCCTGGGGAGGCTTGGG - Intergenic
1078562782 11:12387739-12387761 GCCCATCGGTTGGGGGGTTTGGG + Intronic
1097182266 12:57178249-57178271 GCTCTTCGCTGGGAGGGCTGTGG + Intronic
1098161492 12:67650171-67650193 GGTCATGGGTGGGCGAGCTCTGG - Intronic
1103063797 12:117880455-117880477 TCTCTTTGGTGGGGGGGCTTGGG - Intronic
1114569153 14:23653771-23653793 GCTTATCGGTGGGCTGGCAGAGG - Intergenic
1121310268 14:92931995-92932017 GGTGATGGGTGGGCTGGCTTTGG + Intronic
1122937481 14:104966809-104966831 GCTTAGCGGTGGGCAGGCTCTGG - Intronic
1127043350 15:55001273-55001295 GCTCATAGGTGGAAGGGATTTGG - Intergenic
1139964580 16:70738327-70738349 TCTCATCTGTGGGCCGGCCTGGG + Intronic
1140190496 16:72811819-72811841 ACTTTTGGGTGGGCGGGCTTGGG - Intronic
1143171596 17:4933753-4933775 GCTCTGAGGTGGTCGGGCTTGGG - Exonic
1148852053 17:50560280-50560302 GCTCAGCTCTGGGCGGGCCTGGG - Intergenic
1161850923 19:6737614-6737636 GCTCATCGGTGGGCGGGCTTGGG - Intergenic
1165994996 19:39837696-39837718 GCTCATCGGTGAGGGGTCTGGGG - Exonic
1166786530 19:45370456-45370478 GGTCATCGGTGGGCGCGCCTGGG - Intronic
1167454149 19:49589978-49590000 GCTCATAGGTGGGGAGGCCTGGG - Exonic
1168489413 19:56795555-56795577 GCTCTGCGGTGGACGGGCTGAGG + Intronic
925278167 2:2665210-2665232 GCTCCCCGGTGGGTGGGCATGGG - Intergenic
935709259 2:105882679-105882701 GTTCAGCGGTGGGCAGGCTGGGG + Intronic
939617488 2:144377551-144377573 ACTCATGGGTGGGCGGGCAGTGG + Intergenic
945160692 2:206887377-206887399 GCTCATGGATGGCAGGGCTTCGG - Intergenic
946006242 2:216527328-216527350 GCTCCTCGGGGGCCGGGCTGAGG - Intronic
1170901358 20:20466343-20466365 GCCCATCTGTGGGCTGGATTTGG + Intronic
1184732301 22:46377650-46377672 GTTCATATGTGGGCGGGGTTGGG - Intronic
954610782 3:51943563-51943585 GCTTATCAGTGGGCAGGCTCTGG - Intronic
962955099 3:140258371-140258393 GCTAATCCATGGCCGGGCTTTGG + Intronic
963041250 3:141071656-141071678 GCTCAGTGGTGGGCAGGCTTGGG - Intronic
967980967 3:195065346-195065368 GGTGATCTGTGGGCGGGCTGGGG + Intergenic
967981014 3:195065531-195065553 GGTGATCTGTGGGCGGGCTGGGG + Intergenic
967981226 3:195066435-195066457 GGTGATCTGTGGGCGGGCTGGGG + Intergenic
971807391 4:31377075-31377097 GCTCATGGGTTGGAGGGATTTGG + Intergenic
980391650 4:132155396-132155418 GCTCATAGGTGGGAGGGTCTTGG - Intergenic
983885473 4:172975722-172975744 GCTCATCGGCGAGGGGGCTAAGG + Intronic
984850154 4:184145566-184145588 GCTCCTCGGTGGCAGGGCTGTGG + Intronic
996329177 5:122311412-122311434 CCTCAGGGGTGGGCGAGCTTCGG + Intronic
999238031 5:150111457-150111479 ACTCATTTGTGGGAGGGCTTGGG - Intronic
1000787969 5:165570110-165570132 GCTCATAGGTGGAAGGGATTTGG - Intergenic
1002945930 6:1760566-1760588 GCTCAAGGGTGGGCGGTCCTCGG - Intronic
1019308336 7:346933-346955 GTGCAGCGGTGGGCGTGCTTTGG + Intergenic
1019331642 7:463369-463391 GGTCATTGGTGGACCGGCTTTGG - Intergenic
1030820834 7:114088221-114088243 GCTCCCTGGTGGGCAGGCTTTGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036252637 8:7176131-7176153 GCTCATAGGTGGAAGGGATTTGG - Intergenic
1036364862 8:8111331-8111353 GCTCATAGGTGGAAGGGATTTGG + Intergenic
1039049673 8:33481874-33481896 GCTCAACGTTGGCCTGGCTTGGG + Intronic
1041281028 8:56211396-56211418 GCGCAGCGGCGGGCGGGGTTTGG - Intergenic
1051138974 9:13956909-13956931 GCTCATCTGTGGGCTAGGTTTGG - Intergenic
1056899479 9:90584593-90584615 GCTCATCGGGGTGTGGGCTGGGG - Intergenic
1061968802 9:134032110-134032132 GCTCATTGGTGGGCCAGTTTGGG + Exonic
1062527656 9:136984816-136984838 GCTCTACGGTGGGCGGGCTGCGG + Exonic
1200912855 Y:8546402-8546424 GCTCATTTGTGTGCAGGCTTGGG - Intergenic