ID: 1161851464

View in Genome Browser
Species Human (GRCh38)
Location 19:6739941-6739963
Sequence TGGGAGTCTCAGCACGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161851459_1161851464 2 Left 1161851459 19:6739916-6739938 CCTCCGCTCTCTCTCGAAGTTTA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851454_1161851464 13 Left 1161851454 19:6739905-6739927 CCGCCCTCCACCCTCCGCTCTCT 0: 1
1: 1
2: 30
3: 361
4: 2547
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851451_1161851464 22 Left 1161851451 19:6739896-6739918 CCTGGGTCCCCGCCCTCCACCCT 0: 1
1: 0
2: 8
3: 64
4: 684
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851455_1161851464 10 Left 1161851455 19:6739908-6739930 CCCTCCACCCTCCGCTCTCTCTC 0: 1
1: 0
2: 13
3: 230
4: 2094
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851449_1161851464 24 Left 1161851449 19:6739894-6739916 CCCCTGGGTCCCCGCCCTCCACC 0: 1
1: 0
2: 5
3: 52
4: 600
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851457_1161851464 6 Left 1161851457 19:6739912-6739934 CCACCCTCCGCTCTCTCTCGAAG 0: 1
1: 0
2: 0
3: 16
4: 235
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851450_1161851464 23 Left 1161851450 19:6739895-6739917 CCCTGGGTCCCCGCCCTCCACCC 0: 1
1: 0
2: 8
3: 69
4: 550
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851452_1161851464 15 Left 1161851452 19:6739903-6739925 CCCCGCCCTCCACCCTCCGCTCT 0: 1
1: 0
2: 7
3: 94
4: 929
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851448_1161851464 28 Left 1161851448 19:6739890-6739912 CCGACCCCTGGGTCCCCGCCCTC 0: 1
1: 0
2: 1
3: 55
4: 588
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851460_1161851464 -1 Left 1161851460 19:6739919-6739941 CCGCTCTCTCTCGAAGTTTATCT 0: 1
1: 0
2: 1
3: 22
4: 267
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851458_1161851464 3 Left 1161851458 19:6739915-6739937 CCCTCCGCTCTCTCTCGAAGTTT 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851453_1161851464 14 Left 1161851453 19:6739904-6739926 CCCGCCCTCCACCCTCCGCTCTC 0: 1
1: 2
2: 14
3: 199
4: 1716
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1161851456_1161851464 9 Left 1161851456 19:6739909-6739931 CCTCCACCCTCCGCTCTCTCTCG 0: 1
1: 0
2: 4
3: 67
4: 668
Right 1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161851464 Original CRISPR TGGGAGTCTCAGCACGCTCA GGG Intronic
904925514 1:34044547-34044569 AGGGAGTGTCAGCAGCCTCATGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
916334571 1:163656013-163656035 TGGGACTCTCACCCCACTCAAGG - Intergenic
921365774 1:214372329-214372351 TGGGAGTCTCAGGCTGCTCTGGG - Intronic
1067735823 10:48849547-48849569 TGGGAGTCTCTGCTCCCTGAGGG - Intronic
1070850387 10:79558328-79558350 TGGGGGTCTCAGCAGGGGCAAGG - Intronic
1070856831 10:79612968-79612990 TGGGGGTCTCAGCAGGGGCAAGG + Intronic
1071496100 10:86168635-86168657 AGGGAGCCTCAGCAAGCCCAGGG + Intronic
1077323224 11:1951773-1951795 TGACAGTCTCTGCACGCTCCTGG - Intronic
1078363916 11:10691509-10691531 TGGGAGGCTGAGGAGGCTCATGG - Intronic
1084324450 11:68391578-68391600 GAGGAGTCTCAGCACCTTCAGGG + Intronic
1084883787 11:72190266-72190288 TGAGAGCCTCAGCACTCTGAAGG + Exonic
1086689215 11:89769698-89769720 TGAGAATATCAGCACGCACAAGG + Intergenic
1086716643 11:90070273-90070295 TGAGAATATCAGCACGCACAAGG - Intergenic
1087683764 11:101241309-101241331 AGGGAGGCTCAGGACGCACAGGG + Intergenic
1202806210 11_KI270721v1_random:6968-6990 TGACAGTCTCTGCACGCTCCTGG - Intergenic
1092049367 12:5456880-5456902 TGGGCCACTCAGCACACTCATGG - Intronic
1095293279 12:40500816-40500838 TGGAGTTCTCAGCACACTCATGG + Intronic
1098180467 12:67840954-67840976 GGGGAATCTCAGCAGGGTCAGGG + Intergenic
1101415433 12:104504477-104504499 TGGGAGTCTGAGGACTCTCTCGG + Intronic
1103241026 12:119413600-119413622 TGGGCCTCTCAGCATCCTCATGG + Intronic
1106125653 13:26898194-26898216 TGGGAGACTCAGGACCCACATGG + Intergenic
1108956107 13:56159371-56159393 AGGGAGTCTCAGAAGGCTGAAGG + Intergenic
1112475855 13:99730350-99730372 GGGGAGGTGCAGCACGCTCATGG + Intronic
1113711149 13:112466414-112466436 TGGGTGCCTCAGCACCCACAAGG - Intergenic
1114537115 14:23430010-23430032 TGGGAGTCTCAGAACCCACAGGG - Intronic
1114834906 14:26192467-26192489 TTGAAATCTCAGCATGCTCAAGG + Intergenic
1121309173 14:92925704-92925726 ATGGAGTGTCAGCACGCCCAGGG - Intronic
1122891164 14:104732913-104732935 TGGGGGTCACAGCACCCTCCTGG - Intronic
1122906412 14:104803593-104803615 TGGGAGTCGCAGCACCCTAGGGG + Exonic
1124820753 15:33043929-33043951 TGGGCATCTCTGCACTCTCAGGG + Intronic
1134250071 16:12568250-12568272 TGTGAGTCTGAGCTAGCTCATGG - Intronic
1139952848 16:70680364-70680386 CGGGAGTGTGAGCACGCCCAGGG + Intronic
1140051789 16:71488029-71488051 TGGGAGTCTTAGCAAGAGCAAGG + Intronic
1142434113 16:90046462-90046484 TGGGAATCCCAGCACGCACCTGG + Intergenic
1150610788 17:66731526-66731548 TGGGAGACTCAGCCCACTCCAGG + Intronic
1153989719 18:10385508-10385530 AGGCTGTCTCAGCACCCTCAGGG + Intergenic
1155498715 18:26466272-26466294 TGCCAGTCTCAGCAAGCCCAGGG - Intronic
1158609733 18:58928242-58928264 TGGCAGTCTCAGAAGGCTAAAGG - Intronic
1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG + Intronic
1162328405 19:10012011-10012033 TGGGGGTCCCAGCACGGTGAGGG - Intergenic
1163362149 19:16853365-16853387 TTGGAGTCTCAGCACCCACTGGG - Intronic
1164713696 19:30376626-30376648 TGGGAGTGTCAGTGAGCTCAGGG + Intronic
1167616019 19:50534325-50534347 TGTGAGTGTCATCACCCTCATGG + Intronic
925220317 2:2134189-2134211 TGGGAGTCTCACCTCCCTCCTGG + Intronic
927911632 2:26903939-26903961 AGGGAGTCTCTGGACCCTCACGG - Intronic
932408241 2:71528530-71528552 TGGGTGTCTCACCACGCACCAGG - Intronic
933777433 2:85779510-85779532 TGGGAGGCCCAGCACCCCCAGGG - Intronic
934619850 2:95797383-95797405 TGAGAGTCTCAGCTCCCCCATGG - Intergenic
934641038 2:96027174-96027196 TGAGAGTCTCAGCTCCCCCATGG + Intronic
937791921 2:125971171-125971193 TGGGAGCCTCAGGAAGCTCCTGG + Intergenic
947591167 2:231386843-231386865 TGGGAGGCTCAGGAAGCTCTTGG + Intergenic
1171240676 20:23565072-23565094 AGGGAGGCTCAGGAAGCTCATGG + Intronic
1173668576 20:44781235-44781257 TGGGAGTTTCAGCAAGGTCTGGG - Intronic
1173819055 20:46009102-46009124 TGGGACACTCAACACCCTCACGG - Intronic
1182576966 22:31279378-31279400 TGGGAGTCTCAGCAATCTCTTGG + Intronic
1185127436 22:49018952-49018974 CGGGAGTTTCAGCTTGCTCAGGG - Intergenic
956667785 3:71658402-71658424 TGTGAGTCACAGCACCCACAAGG + Intergenic
957636254 3:82790317-82790339 TGGGCATCTCTGCACTCTCAGGG + Intergenic
961471321 3:127114937-127114959 TGGGGGTCTGAGCACACTCCTGG + Intergenic
963042804 3:141081726-141081748 ATGGAGGCTCAGCAGGCTCAGGG - Intronic
963965164 3:151360096-151360118 TGGGAATCTTTGCACGCTGATGG + Intronic
967970563 3:194996060-194996082 GGGGAGTCTCAGCAGGATCAGGG - Intergenic
968486829 4:866978-867000 TGGGGTGCTCTGCACGCTCAGGG + Exonic
968964622 4:3763683-3763705 TGGGAGGCTCATCTGGCTCAGGG + Intergenic
975000314 4:69217740-69217762 TGCATGTCTCAGCATGCTCAGGG + Intergenic
976241801 4:82965796-82965818 GAGGAGTCTCAGCAGACTCAAGG + Intronic
980744883 4:137000727-137000749 TGGGCATCTCTGCACTCTCAAGG + Intergenic
986449786 5:7852414-7852436 TGGGTTTCTCAGGAAGCTCATGG - Intronic
986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG + Intronic
989468437 5:41785740-41785762 TGGGACCCTCAGCAGGCTGAAGG + Intronic
993703445 5:91144096-91144118 TGGGCATCTCTGCACTCTCAAGG - Intronic
994068005 5:95565008-95565030 TGGGAATCTCAGCTATCTCAAGG + Intronic
997892886 5:137690667-137690689 TGAGAGTCTCTGCAGGCTCCTGG + Intronic
999243547 5:150140946-150140968 TGGGAGCCTCAGGACCCTGAGGG - Intronic
1001577808 5:172775508-172775530 TGGGAGTCTTAGAAGGCTCCAGG - Intergenic
1003252448 6:4442147-4442169 TGGGAGTCTCAGGCCTCTGATGG + Intergenic
1007100582 6:39243538-39243560 TGGGTGTCTCAGCACCCGGATGG + Intergenic
1008642745 6:53481444-53481466 AGGGAGTCTTTGCAAGCTCAAGG + Intergenic
1012534386 6:100278163-100278185 TGGGAATCCCAGGAGGCTCAGGG + Intergenic
1013789885 6:113824833-113824855 TGGGAGTCCTTGCATGCTCAAGG + Intergenic
1018819529 6:167363093-167363115 TGTGAGTCTCAGCAGCTTCAAGG + Intronic
1019352643 7:562172-562194 TGGGAGTCTCTGCAGGTTCCGGG + Intronic
1019389663 7:778987-779009 TGGAAGGCCCAGCACCCTCAGGG + Intronic
1019872753 7:3780729-3780751 TGGGAGTCTCTGCCTGCACAGGG - Intronic
1021802219 7:24318300-24318322 TGGGCGGCTCCGAACGCTCAGGG - Intergenic
1022212400 7:28224481-28224503 TGGGAATCTGAGCATGATCAAGG - Intergenic
1027734064 7:81909900-81909922 TGGGAGTTTGAGCAGGCCCATGG + Intergenic
1033056571 7:138060232-138060254 TGGGGGTCACACCACCCTCAGGG - Intronic
1033480940 7:141739698-141739720 TGGTAGTCTAAGCTGGCTCAAGG - Intronic
1035633678 8:1127485-1127507 TGGGAGCCACAGCACCCTCCGGG - Intergenic
1037389096 8:18374178-18374200 TGGGAGTCTAAGCACTTCCAGGG - Intergenic
1037933618 8:22899404-22899426 TTGGAGGCTCAGCTCCCTCATGG - Intronic
1047918990 8:129613420-129613442 TGGGATTCACAGCACGTTTAAGG - Intergenic
1049751934 8:144289023-144289045 TGGCAGTCTCAGAAAGCCCAAGG + Intronic
1056698152 9:88878254-88878276 TGGGAGTCTGCACACCCTCAGGG - Intergenic
1060516866 9:124271378-124271400 GGGGAGGCTCAGCACCCACAGGG + Intronic
1062686530 9:137816508-137816530 TGGGTTGCTCAGGACGCTCATGG + Intronic
1186063529 X:5737444-5737466 TGGGAGTCTGAGGAGGCACAGGG + Intergenic
1193671933 X:84397556-84397578 TGGGAGTCTCACCAGTCTCCAGG + Intronic
1194708132 X:97200519-97200541 TGTCAGTCTCAGCACTGTCAGGG - Intronic
1196045109 X:111248708-111248730 TGGAAGTCCCAGCACGCTCCTGG + Exonic
1201309636 Y:12584660-12584682 TGGGAGTCTCAGCAGGGAGATGG + Intergenic