ID: 1161852250

View in Genome Browser
Species Human (GRCh38)
Location 19:6743685-6743707
Sequence CTGAAGAATGCAGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 530}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161852250_1161852255 1 Left 1161852250 19:6743685-6743707 CCTTCCACCTCTGCATTCTTCAG 0: 1
1: 0
2: 5
3: 51
4: 530
Right 1161852255 19:6743709-6743731 CCAAGCAGCAAGCCCACCTTCGG 0: 1
1: 0
2: 2
3: 14
4: 143
1161852250_1161852256 11 Left 1161852250 19:6743685-6743707 CCTTCCACCTCTGCATTCTTCAG 0: 1
1: 0
2: 5
3: 51
4: 530
Right 1161852256 19:6743719-6743741 AGCCCACCTTCGGAGTCACATGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161852250 Original CRISPR CTGAAGAATGCAGAGGTGGA AGG (reversed) Intronic
900031205 1:374146-374168 ATGAAGAAAGGAGAGGGGGATGG - Intergenic
900051759 1:602346-602368 ATGAAGAAAGGAGAGGGGGATGG - Intergenic
900150843 1:1178839-1178861 CTGAAGAATGGAGGGTGGGAGGG - Intronic
900835706 1:5002235-5002257 CCAAAGAAGGCTGAGGTGGAAGG - Intergenic
900975206 1:6012288-6012310 GTGATGAAGGCAGAGGTGGTGGG + Intronic
900993161 1:6107091-6107113 CGGACGAATGGAGGGGTGGAAGG + Intronic
901172339 1:7268247-7268269 CTGAAGAGTACAGAGGAGAAGGG + Intronic
901337424 1:8463172-8463194 CTGAATAATTGAGAGGTTGAAGG - Intronic
901593629 1:10367405-10367427 TTAAAGAAGGCAGAGGTGGCTGG + Intronic
901948191 1:12720617-12720639 CTGTAGAACGCAGAGGTTTAGGG - Intronic
902206576 1:14872773-14872795 CAGATGAATGGATAGGTGGATGG + Intronic
902709962 1:18232110-18232132 GTGGAGAAAGCAGAGGGGGATGG - Intronic
902876212 1:19342379-19342401 CTGAAGCATGGGGGGGTGGACGG + Intronic
903142717 1:21348935-21348957 ATGAAGAAAGCAGAGGAGAAAGG + Intergenic
903288379 1:22291448-22291470 CTTCAGGATGCTGAGGTGGAAGG - Intergenic
903363972 1:22794582-22794604 CAGAAGAAATCAGAAGTGGAAGG - Intronic
903366837 1:22810545-22810567 CTCTAGGATGCAGAGGTGTAAGG - Intronic
903751559 1:25624752-25624774 AAGAAGATGGCAGAGGTGGAAGG - Intronic
904049528 1:27630888-27630910 CTGAAGAATGGAGCTGGGGAGGG - Intronic
904936869 1:34137129-34137151 TGGAAGAATGGATAGGTGGATGG - Intronic
904990136 1:34585923-34585945 CTGAAGAAGGCAGGGGTCAAGGG - Intergenic
905083121 1:35343110-35343132 CAGATGAATGCATAGATGGATGG - Intronic
905272161 1:36794172-36794194 CTGCAGAATGGAGAGGAGGTCGG - Intergenic
906107580 1:43304176-43304198 CTTAAGGAGGCAGAGGTGGGAGG - Intronic
906165648 1:43684206-43684228 CTCAAGAAAGAAGAGGTGGCCGG + Intronic
906561222 1:46758465-46758487 CTGAGGAATGCATTGGTGGGAGG + Intronic
906588541 1:47001918-47001940 ATGCAGAAGGCAGAGGTGGAGGG - Intergenic
906727592 1:48055240-48055262 CTGAAGAAGGCAGGGCTGCATGG + Intergenic
907458246 1:54589728-54589750 CTTTAGAAGGCAGAGGTGGGAGG - Intronic
908390386 1:63678440-63678462 CTGGGGAATGCAGTGGTGAACGG + Intergenic
908413264 1:63887297-63887319 CTGAAGAAAGAAGAGGAGGGTGG + Intronic
908543874 1:65146663-65146685 CTGCAGAATGCAAAGGTGTACGG + Intergenic
909491099 1:76227192-76227214 CTCCTGAATGCAGAGGTGGAAGG - Intronic
909535456 1:76730927-76730949 TTGAAGATTGCAGAGCTGGGGGG + Intergenic
909555376 1:76948201-76948223 CTGATGCATGCAAAGGTGGGGGG - Intronic
909583828 1:77266903-77266925 ATGAAGAAGGCAGAGAAGGATGG + Intergenic
910085986 1:83403047-83403069 TTGATCATTGCAGAGGTGGAGGG + Intergenic
910146183 1:84083212-84083234 CTGTAGAATGCAGAGGTACTGGG + Intronic
910208853 1:84774140-84774162 CTGGGGAATGCAGAGGGGAAGGG + Intergenic
910946991 1:92604104-92604126 CTGTGGAAGGCAGAGGTGGGCGG + Intronic
912601984 1:110945382-110945404 CGGAAGAAGGAAGAGGGGGAGGG - Intergenic
912775441 1:112503923-112503945 CTGAGGAAGGCAGAGTGGGAGGG + Intronic
912792926 1:112670938-112670960 TTGAAAAATGCAGATGTTGAAGG + Exonic
913715193 1:121526642-121526664 CTGGAGAGTTCAGAGGAGGAAGG + Intergenic
914392638 1:147236178-147236200 CTGGAGAATGCAGTGGTGCCTGG + Intronic
914843780 1:151269055-151269077 CTCAAGAGTGCAGAGGGGTAGGG - Intergenic
914890102 1:151613817-151613839 CTGAAGACTGCTGAGGAGAACGG - Intronic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
915446053 1:155975665-155975687 CTGAGGAATGGAGAGGTGGCTGG - Intronic
915864150 1:159480004-159480026 AGGAAGAATCCAGAGGTGCAAGG - Intergenic
916821330 1:168401440-168401462 CAGAAGAAGTCAGAGGAGGAGGG - Intergenic
918271110 1:182900787-182900809 CTTAAGAAGGCAGAGGCAGAAGG + Intronic
920843907 1:209577561-209577583 ATGAAGGATGCAGAGGTGAAAGG + Intergenic
922189676 1:223306976-223306998 CTGTAGAATTTAGAAGTGGAAGG - Intronic
922733034 1:227962020-227962042 CAGAAGACTGGAGAGGAGGAGGG + Intergenic
923277915 1:232414732-232414754 CTGAAGAATGCAGCGGCAAAGGG + Intronic
923459624 1:234197052-234197074 CTGATTAATGCAGAGGTGACTGG + Intronic
924371511 1:243355851-243355873 CTTGGGAAGGCAGAGGTGGAGGG - Intronic
924526537 1:244856495-244856517 CAGAAGAAAGCAGAAGTAGAGGG - Exonic
1063096573 10:2913638-2913660 CTGAGGAAGGCAGAGTAGGAAGG + Intergenic
1063636977 10:7791538-7791560 CTGACGAAGGCAGTGGAGGAGGG - Intronic
1063652977 10:7958625-7958647 GTGGAGAAAGCAGGGGTGGATGG + Intronic
1063725433 10:8632508-8632530 CTAGAGAGTGCACAGGTGGAGGG + Intergenic
1063781325 10:9328417-9328439 AGGAAAAATGCAAAGGTGGAAGG - Intergenic
1064273979 10:13890474-13890496 CTTACGGATGCAGAGGTGGAAGG + Intronic
1064594518 10:16930010-16930032 ATGAAGACTGAAGGGGTGGATGG - Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065824676 10:29559413-29559435 CTGAAGAATTTAGAGATGAAGGG - Intronic
1067077087 10:43194098-43194120 CTGCAGAATGCAGGTCTGGAGGG - Intergenic
1067115288 10:43431120-43431142 CTGTAGGAGGCAGAGGTGGGTGG - Intergenic
1067715243 10:48685444-48685466 CTGAGGAGTGCAGAGTTGGAGGG + Intronic
1067793116 10:49302360-49302382 CCGAAGACTGCAGAGGTCAAGGG + Intronic
1067831858 10:49615096-49615118 TTGAAGAAGGCAGAGCTGGGTGG - Intronic
1068031229 10:51707883-51707905 CTCAAGAATCCAGAGTTAGAAGG - Intronic
1068075225 10:52245405-52245427 TTGAAGAAATCAGAGTTGGAAGG + Intronic
1069285859 10:66714587-66714609 CTCAAAAAAGCAGAGGTGGATGG - Intronic
1069607832 10:69750976-69750998 CTGGAGATTGATGAGGTGGAGGG + Intergenic
1070443475 10:76469442-76469464 CTCAAGAATGATGGGGTGGAGGG + Intronic
1070545008 10:77445307-77445329 ATGGACGATGCAGAGGTGGATGG - Intronic
1071573877 10:86712068-86712090 CTGAAGGATGCAGAAGCTGAGGG + Intronic
1072517940 10:96204834-96204856 TGGATGAATGCAGAGGTGGTAGG - Intronic
1073065152 10:100754113-100754135 CTGGAGAGGGGAGAGGTGGAGGG + Intronic
1073298035 10:102452918-102452940 CTGGAGAAGGAAGAGGTGCAGGG - Intergenic
1073541946 10:104322081-104322103 CTGCAAAATGCAGAGGAGGGAGG + Intronic
1074024717 10:109622465-109622487 TTGAAGAATGGTGAGCTGGAGGG + Intergenic
1074133198 10:110602537-110602559 ATGAAGAAAGGAGATGTGGAGGG + Exonic
1074350302 10:112730247-112730269 CTTAAGAATGCAGAGGAAGGAGG - Intronic
1074457377 10:113606957-113606979 CTGTAGGAGGCTGAGGTGGATGG + Intronic
1075549156 10:123379430-123379452 CTGGGGAATGCAGAGGGAGAGGG - Intergenic
1077300357 11:1843907-1843929 GTGAGGAATGGAGACGTGGAAGG + Intergenic
1077357339 11:2124535-2124557 CTGCAGCAGGAAGAGGTGGAGGG - Intergenic
1077443753 11:2580765-2580787 CTGAAGAAAGCAGGGGTGGTGGG - Intronic
1079151312 11:17902130-17902152 CTGAAGAAGGGAGAGAGGGATGG + Intronic
1080121715 11:28685437-28685459 TTGAACAATGCAGAGGTTGGGGG + Intergenic
1080146232 11:28987409-28987431 CTGAAGAATGCAGAAGTGGCAGG + Intergenic
1080822966 11:35824605-35824627 CTTAAGAAAGGTGAGGTGGAGGG - Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1081900898 11:46626994-46627016 CTGTGGAAAGCCGAGGTGGATGG + Intronic
1083593267 11:63907457-63907479 CTGGGGATTGCAGAGGAGGAAGG - Intronic
1083697802 11:64454233-64454255 CTTAAGAATGCAGAAGAGGCTGG + Intergenic
1083840139 11:65299561-65299583 CTGCAGAAGGCAGAGCTGGATGG - Intronic
1083984680 11:66205735-66205757 CTTAAGGAGGCAGAGGTGGAAGG - Intronic
1084397305 11:68920725-68920747 CTGTGGGAGGCAGAGGTGGAAGG - Intronic
1085139278 11:74125856-74125878 CTAAGGAGTGCAGAGGTGGAGGG - Intronic
1085413412 11:76305340-76305362 CTGGAGAAGGCAGAGTTGGGAGG + Intergenic
1085887047 11:80533388-80533410 CTGAAGAAGACACAAGTGGATGG - Intergenic
1087191118 11:95255693-95255715 CTGTGGAATGGAGAGGTGGCTGG - Intergenic
1087213099 11:95463031-95463053 GTGTAGAAGGAAGAGGTGGAGGG + Intergenic
1087266050 11:96062556-96062578 CTGAAATATGGAGTGGTGGAAGG + Intronic
1087599473 11:100294027-100294049 CTGAAGAATGAAAAGAGGGAAGG - Intronic
1088096815 11:106110101-106110123 CTTAAGAGTCCAAAGGTGGAAGG - Intergenic
1089453010 11:118610116-118610138 CTGAAGAACACAGAGGTGGAGGG - Intronic
1089858844 11:121571233-121571255 GTGAACCAAGCAGAGGTGGAGGG + Intronic
1090973193 11:131660314-131660336 CTGCAGGATGAAGAGGGGGATGG + Intronic
1091048849 11:132349822-132349844 CTGGATTATGGAGAGGTGGAGGG + Intergenic
1091059288 11:132446529-132446551 CCAAAGAATGCAGGGGTAGAAGG + Intronic
1091600156 12:1913093-1913115 CTGAAGATCGAGGAGGTGGATGG - Exonic
1091725462 12:2843567-2843589 CTTAAGGATGCCGAGGTGGGTGG + Intronic
1093774915 12:23062433-23062455 CTGAAGAATGCAGGGATATAAGG + Intergenic
1094688041 12:32739426-32739448 CTTAAGAGTACAGAGGTTGAGGG + Intronic
1095042584 12:37459112-37459134 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1095285134 12:40401534-40401556 TTGAAGAATGAAGAGTTTGAGGG - Intronic
1095338972 12:41065552-41065574 CTGAAGAATTCTGAGGAGGGTGG + Intronic
1095804258 12:46301112-46301134 CTGAAAAATGCTGAAGAGGAAGG - Intergenic
1096423616 12:51481842-51481864 CTCAGGAAGGCTGAGGTGGAAGG + Intronic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1097979267 12:65720309-65720331 CTTTGGAATGCAGAGGTGGGTGG - Intergenic
1098032516 12:66269022-66269044 ATGAAGAAGGTAGAGGGGGAAGG - Intergenic
1098336813 12:69412920-69412942 GGAAAGAATGCAGCGGTGGAAGG + Intergenic
1099237729 12:80102108-80102130 ATGCAGAATGCAGTGGTTGAGGG + Intergenic
1099604795 12:84789986-84790008 CTGAAGAATGAAGAGAAGGTTGG + Intergenic
1101076845 12:101139136-101139158 GTGAAGAATGGATGGGTGGAAGG - Intergenic
1101099526 12:101378111-101378133 CTGAAGAATTAAGAGTTTGAAGG + Intronic
1101211290 12:102537722-102537744 CTTTAGAAAGCTGAGGTGGAAGG + Intergenic
1101242009 12:102848309-102848331 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242016 12:102848344-102848366 CAGGAGACTGAAGAGGTGGAGGG + Intronic
1101242036 12:102848449-102848471 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242050 12:102848519-102848541 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242113 12:102848868-102848890 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101569047 12:105936438-105936460 CTGGATAAAGCAAAGGTGGAAGG + Intergenic
1101577331 12:106010023-106010045 CTGAAGTATTAAGAGGTGAAGGG + Intergenic
1101680845 12:106963599-106963621 CTGAAGCAAGAAGAGATGGAAGG - Intronic
1102036402 12:109772789-109772811 ATGAAGAATGGAGAAGTGGCTGG + Intergenic
1102676634 12:114664019-114664041 CTGACGTATGTGGAGGTGGAAGG + Intergenic
1103744853 12:123115494-123115516 CTGAACCATGCAGAAGTTGATGG + Intronic
1103948799 12:124540883-124540905 CTGGAGAGTGGAGAGCTGGAGGG + Intronic
1104627106 12:130366478-130366500 CTGAAGAATCCAGGTGGGGATGG + Intronic
1104803200 12:131568720-131568742 CTGAAGAATGGACAGATGGATGG - Intergenic
1105585441 13:21738758-21738780 CTGAAGCAAGCAGAGGTGGAGGG + Intergenic
1105652520 13:22395420-22395442 GTGAAGGATACAGAGGTGGAAGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106443467 13:29801482-29801504 CTGAAAAATGCGGGGGTTGAGGG - Intronic
1108754237 13:53480709-53480731 CTGTTGTATGCAGAGGGGGATGG + Intergenic
1109837364 13:67877415-67877437 CCCAAGAGTGCAGAGGTGAAGGG - Intergenic
1109941493 13:69372637-69372659 CAGGATAATGCAGATGTGGATGG - Intergenic
1110206816 13:72924476-72924498 CTGTAGGAGGCTGAGGTGGAAGG + Intronic
1110625596 13:77652207-77652229 AAGAAGAATGCAGAGGTATAGGG - Intergenic
1110981956 13:81911526-81911548 CTGAGGAATGAAGGGCTGGAAGG - Intergenic
1111161584 13:84401519-84401541 TTGAAGAATATAGAGATGGATGG + Intergenic
1111846973 13:93522904-93522926 CTGAAGGAGACAAAGGTGGAGGG + Intronic
1112426943 13:99311262-99311284 GTAGAGAATGCAGAGGGGGAAGG + Intronic
1113084828 13:106557705-106557727 CTGAGGAATGCAGATGTTTATGG + Intronic
1113431735 13:110256384-110256406 GTGAAGACAGCAGAGGAGGATGG + Intronic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1116038475 14:39657211-39657233 CTGAAGAATGCAGAAGCCTAAGG + Intergenic
1116095568 14:40362732-40362754 TTGAACAATGCAGAGGTTGTGGG - Intergenic
1116215663 14:42014063-42014085 AGGAAGAATGCAGAGAGGGAGGG - Intergenic
1116421845 14:44742385-44742407 CTTTAGAATGCCGAGGTGGGTGG + Intergenic
1117239865 14:53819380-53819402 CTGAAGAATAAAGAGCTGGGTGG - Intergenic
1117967387 14:61220007-61220029 CTAAAGAATGCATTGGTGTAGGG + Intronic
1118550122 14:66940704-66940726 CTGAGGAATCCAGAGGCAGACGG - Intronic
1119077818 14:71661528-71661550 CTTTAGAATGCAGAGCTGAATGG - Intronic
1119513366 14:75229033-75229055 AGCCAGAATGCAGAGGTGGAAGG + Intergenic
1120363773 14:83540336-83540358 CTGAAAAATTCAGAGATGAAGGG + Intergenic
1120923640 14:89777404-89777426 CTAATGAATGGATAGGTGGAAGG - Intergenic
1121109341 14:91302033-91302055 CTGAAGGATGGAGATCTGGATGG + Intronic
1122330239 14:100907023-100907045 CTGCAAAATGGAGAGGTGGAAGG + Intergenic
1122935431 14:104953850-104953872 CTGAAGGGTGAGGAGGTGGAAGG - Exonic
1202941115 14_KI270725v1_random:146846-146868 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1124213419 15:27783513-27783535 CTGAAATATGAAGAGGGGGAGGG + Intronic
1125606705 15:40943587-40943609 CTGATGTAGGCAGAGGTAGAAGG + Intergenic
1125717811 15:41829530-41829552 CTTTGGAATGCTGAGGTGGAAGG - Intronic
1127027006 15:54817839-54817861 CAGCAGAAAGCAGAGGTCGAAGG - Intergenic
1127256445 15:57297587-57297609 CTGAAGAATTCAGAGATGCATGG + Intronic
1127562364 15:60151898-60151920 GTGAAGAATCCTGAGGTGAACGG + Intergenic
1127966269 15:63924987-63925009 ATGGAGGATGCAGAGATGGATGG + Intronic
1128316778 15:66664979-66665001 ATTCAGAAGGCAGAGGTGGAAGG - Intronic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1128745252 15:70109954-70109976 AAGGAGAATGCAGAGGTGGGTGG + Intergenic
1129202097 15:74009034-74009056 TGCAAGAATGCAGAGATGGAGGG + Intronic
1129693850 15:77729456-77729478 CAGAAGAATCCAGAGCTGGGAGG + Intronic
1129883593 15:79023237-79023259 GTGATGAATGCAGGGCTGGAGGG + Intronic
1130992662 15:88885696-88885718 CTTAAGGAGGCCGAGGTGGATGG - Intronic
1131399748 15:92114860-92114882 CCCAAGAATGCAGAGCTGGGAGG - Intronic
1131608248 15:93932628-93932650 TTTAAAATTGCAGAGGTGGATGG + Intergenic
1131835731 15:96388778-96388800 CTGAAGGAAGCAGTGATGGAAGG + Intergenic
1133791792 16:9014711-9014733 CTGAAGAAAGAAGAGGAGAATGG - Intergenic
1135007609 16:18840949-18840971 CTTAAGAAGGCTGAGGTGGGAGG + Intronic
1135352472 16:21740698-21740720 CTGAAGAAAGGAGAGATGCAGGG - Intronic
1135450960 16:22556820-22556842 CTGAAGAAAGGAGAGATGCAGGG - Intergenic
1136298216 16:29315848-29315870 CTAAAGAATGCTGCTGTGGATGG + Intergenic
1137563824 16:49521114-49521136 CTCATAAGTGCAGAGGTGGAGGG - Intronic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1139246184 16:65446670-65446692 CTGGAGCATGCAGAAGTTGAGGG + Intergenic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140296945 16:73718073-73718095 TTGGAGAATGGAGAGATGGAGGG - Intergenic
1140310650 16:73845013-73845035 CTAAAGAAGGAAGAGGTGGTAGG + Intergenic
1140421418 16:74822430-74822452 CTCAAGAAAGCTGAGGTGGCTGG + Intergenic
1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG + Intronic
1141641809 16:85346057-85346079 ATGAACAATGGATAGGTGGATGG + Intergenic
1142059862 16:88022352-88022374 CTAAAGAATGCTGCTGTGGATGG + Intronic
1142971098 17:3612098-3612120 TTTAAGAATGCAGAGCTGGCGGG - Intronic
1144574008 17:16417678-16417700 CTGAAAACTGGAGAGCTGGAGGG - Exonic
1145015052 17:19391152-19391174 CTGAAGCGGGCAGAGGAGGAAGG - Intergenic
1145028452 17:19486799-19486821 CTGGCAGATGCAGAGGTGGAAGG - Intergenic
1146016293 17:29236472-29236494 CTTTAGAAGGCTGAGGTGGACGG - Intergenic
1147572708 17:41581195-41581217 GTGAAGATTCCAGAGGTGGGTGG - Intergenic
1147710496 17:42460129-42460151 CAGAAAGCTGCAGAGGTGGAAGG + Intronic
1148699171 17:49577587-49577609 CTGCAGATTCCAGAGGCGGATGG + Intronic
1148974821 17:51518450-51518472 GTGAAGAATGAATGGGTGGAAGG - Intergenic
1149737683 17:59011486-59011508 CAAATGAGTGCAGAGGTGGAAGG + Intronic
1150182892 17:63145118-63145140 CTGAAGAAAGCAGAAATGCAAGG - Intronic
1150620511 17:66804364-66804386 CTGAAAAATCCACAGATGGAGGG - Exonic
1151745900 17:76011669-76011691 CTGGAGAAGGCAGAGGGAGAGGG + Intronic
1152006611 17:77686127-77686149 TAGAAGGATGGAGAGGTGGAGGG - Intergenic
1152369511 17:79877694-79877716 AAGGAGAACGCAGAGGTGGATGG - Intergenic
1152477787 17:80529350-80529372 CTGATGGCTGCAGAGGAGGAAGG - Intergenic
1152948448 17:83211567-83211589 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1153971338 18:10229778-10229800 CTGAGGAAAGCAGAAGTGGAGGG - Intergenic
1154192029 18:12237731-12237753 CTGAACAATGCAGAAAAGGAAGG + Intergenic
1155327222 18:24676829-24676851 CTCAAGAATGGAGAGTTGAATGG + Intergenic
1155532816 18:26784723-26784745 CTGAAGAACCCAGATATGGAAGG - Intergenic
1156333933 18:36151559-36151581 CTTAGGAAAGCTGAGGTGGATGG + Intronic
1156794632 18:41028709-41028731 CTGAGAAATGCAGAGGTGCAGGG - Intergenic
1157489178 18:48110387-48110409 CTTAAGAATGCAGAGCAGGCTGG - Intronic
1157642158 18:49227676-49227698 TTGAAGCTTGCTGAGGTGGATGG + Intronic
1158397704 18:57092534-57092556 CTGAAAATTTCAGAGGTGGGCGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160542271 18:79630587-79630609 CTGTAGAATGGAGTGGTCGATGG - Intergenic
1160544319 18:79642493-79642515 AACAGGAATGCAGAGGTGGATGG + Intergenic
1161084061 19:2325895-2325917 CTGAAGCCTGTGGAGGTGGACGG - Intronic
1161314167 19:3610187-3610209 CTGCAGTAGGCAGAGGTGCAAGG - Intergenic
1161329173 19:3678267-3678289 ATGGAGAATGGAGGGGTGGAGGG + Intronic
1161852250 19:6743685-6743707 CTGAAGAATGCAGAGGTGGAAGG - Intronic
1161854252 19:6754419-6754441 CTGATGCCTGCAGAGGTGGAGGG + Exonic
1161930665 19:7337343-7337365 CTGAATAATGCAGTGTGGGAAGG + Intergenic
1162187562 19:8917748-8917770 CAAAAGGATGGAGAGGTGGATGG - Intronic
1162375632 19:10303671-10303693 CTTCAGAAGGCAGAGGTGGGAGG - Intergenic
1164555156 19:29245720-29245742 CTGAAGACTGATGAGGTCGAAGG + Intergenic
1164896889 19:31884586-31884608 TTTAAGAATGCAGGGGAGGAGGG + Intergenic
1165797370 19:38526835-38526857 CAAAAGGATGCAGAGGTTGACGG - Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166147217 19:40845955-40845977 ATGAAGCACCCAGAGGTGGAGGG - Exonic
1166151374 19:40877851-40877873 ATGAAGCACCCAGAGGTGGAGGG - Exonic
1166155863 19:40910545-40910567 ATGAAGCACCCAGAGGTGGAGGG - Intergenic
1166178944 19:41093750-41093772 ATGAAGCACCCAGAGGTGGAGGG + Exonic
1166577561 19:43856792-43856814 CAAAATAATGCAGAGGTTGAGGG + Intergenic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
925736895 2:6971552-6971574 CTGAAGACTGCAAAAGTGAAAGG - Intronic
926210710 2:10867597-10867619 GTGGAGTCTGCAGAGGTGGAAGG + Intergenic
926239800 2:11076704-11076726 TTGAAAAATGCAGATGTTGAAGG - Intergenic
926362367 2:12101896-12101918 CTGAAGAGTGGAAAGCTGGAGGG + Intergenic
926524159 2:13955559-13955581 CTTTAGAAAGCAGAGGTGGGAGG - Intergenic
926893766 2:17661656-17661678 AGGAACAATGCAGAAGTGGAGGG - Intergenic
927038389 2:19204028-19204050 ATGAATAAAGAAGAGGTGGAGGG - Intergenic
927503768 2:23599954-23599976 CTGCAGAATGAAAAGGGGGATGG - Intronic
927595446 2:24392902-24392924 AAGAAGAATGCAGAGTGGGAGGG + Intergenic
927916562 2:26940569-26940591 CTTAAGGAGGCAGAGGTGGAAGG - Intronic
928413508 2:31072155-31072177 CTGTGGGGTGCAGAGGTGGAGGG + Intronic
929026380 2:37607216-37607238 TTGGAGAATGCAGAGGTTAAGGG + Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930833391 2:55769781-55769803 CTGAAGAACCCAGAGGAGGCTGG + Intergenic
931920346 2:67008552-67008574 CTGCACAAGGCAGAGGTGGCGGG + Intergenic
931975685 2:67641616-67641638 CTAAGGAATGCAGGGGAGGAAGG + Intergenic
932214277 2:69956491-69956513 AAGAAGAAAGCAGAGGAGGAGGG + Intergenic
934102315 2:88664917-88664939 CTGAAGAATGAAGAGTTGAGAGG + Intergenic
934543897 2:95198858-95198880 CTGAAGAATGCAAAGGTATCTGG - Intergenic
935008160 2:99102267-99102289 ATGAAGAAAGGAGATGTGGAGGG + Intronic
935352728 2:102167689-102167711 CTTAAGGAGGCAGAGGTGGGCGG - Intronic
935585991 2:104800864-104800886 CTGAACACTGCTGAGATGGAGGG - Intergenic
935923457 2:108040591-108040613 CTATAGAATGAATAGGTGGAAGG + Intergenic
936461009 2:112713811-112713833 CTGAGGATCGCGGAGGTGGAGGG - Intergenic
937430357 2:121832783-121832805 CTGGAGAAAACAGATGTGGAAGG + Intergenic
938374451 2:130796580-130796602 CTCAGGAATGCAGAGTGGGAGGG - Intergenic
939125159 2:138169107-138169129 CTGAAGAATGTAGACATTGAAGG + Intergenic
939227091 2:139377833-139377855 TTGAAGGATGCATAGGTGGGTGG - Intergenic
939365831 2:141229994-141230016 CTGTAGAAAGTAGATGTGGAAGG - Intronic
940010007 2:149042458-149042480 TGGAAGAAAGCAGAAGTGGAGGG + Intronic
940475140 2:154152728-154152750 ATGAAGAATGCAGAAGTGTCAGG - Intronic
940933241 2:159461589-159461611 TTGAAAAATGCAGATGTTGAAGG - Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942915081 2:181295068-181295090 GGGAAGAATGCAGACATGGATGG + Intergenic
944115411 2:196180680-196180702 ATGAAGAATGCTGAGACGGAAGG + Intergenic
944462883 2:199970166-199970188 CTGAAGAGGCCAGAGGTGTAAGG - Intronic
945648227 2:212528066-212528088 CTGAAGAATACAATGGAGGAGGG + Intronic
946442213 2:219706390-219706412 CTGTAGGAGGCAGAGGTGGGAGG - Intergenic
946522286 2:220479434-220479456 CTGAGGGAGGCTGAGGTGGAAGG + Intergenic
947325436 2:228970114-228970136 TTGAAGAAAGCAGAGGAGGTTGG - Intronic
947369373 2:229428800-229428822 CACAAGAAGTCAGAGGTGGAGGG + Intronic
947839228 2:233197085-233197107 CTGAAGCAGGCAGTGGTGGATGG + Intronic
947946621 2:234109195-234109217 CTGAAGAATTTAGAGGTAAAGGG + Intergenic
948058987 2:235029947-235029969 AGGAACAATGCAGAGGTGGACGG + Intronic
948175463 2:235939365-235939387 GTGATGAGTTCAGAGGTGGAAGG - Intronic
948845366 2:240680441-240680463 TTGAAGAAGGCAGACGTGAAGGG + Exonic
948848495 2:240694438-240694460 TTGAAGAAGGCAGACGTGAAGGG - Exonic
1168824768 20:802657-802679 CTGAAGACGGCAAAGGGGGAAGG - Intergenic
1168993073 20:2111451-2111473 CTTAAGGAGGCTGAGGTGGAAGG + Intronic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1171537015 20:25902186-25902208 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1171804093 20:29658968-29658990 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1172068489 20:32238879-32238901 GTGAGGAATGCGGAGGTGAAGGG - Intergenic
1172259250 20:33548012-33548034 CTTAAGGAGGCAGAGGTGGAAGG - Intronic
1172830331 20:37828681-37828703 CTGAATAGTGCATAGGTGGCAGG - Intronic
1173137587 20:40453048-40453070 CTGAAGGATCAAGAGGAGGAGGG - Intergenic
1173670160 20:44793387-44793409 CAGATGAATGCGGAGGGGGAGGG + Intronic
1173916969 20:46714913-46714935 GTGCAGGAGGCAGAGGTGGAGGG - Intronic
1174737002 20:52973673-52973695 CAGAGGGATGCAGGGGTGGAGGG - Intronic
1175328855 20:58148894-58148916 TTGAAGAATGCAAAGGGGGCCGG - Intergenic
1175402559 20:58708771-58708793 CAGAAGAATGCTGAGGCGGACGG + Intronic
1175549398 20:59807065-59807087 CTGAAGTCTGCGGAGGTGCACGG - Intronic
1175650176 20:60715134-60715156 CTTTGGAAAGCAGAGGTGGAAGG - Intergenic
1175717695 20:61266344-61266366 CTGGAGAAGGCAGAGGAGAAAGG + Intronic
1175739798 20:61412653-61412675 GTGGAGAAGGCAGAGCTGGAAGG - Intronic
1175787381 20:61720470-61720492 GTGGAGAATGCAGGGGTGTAGGG + Intronic
1175934927 20:62510077-62510099 GTGAAGGATGGAGGGGTGGAGGG - Intergenic
1176582046 21:8540096-8540118 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1177554053 21:22667337-22667359 CTAAAGAATGCAAAGCTGAAGGG - Intergenic
1178430785 21:32517069-32517091 CTGCAGGATGCAGAGGAGGGTGG + Intergenic
1178592488 21:33923253-33923275 CTGCAGAATGCAGATAAGGATGG + Intergenic
1179017423 21:37605508-37605530 TGGATGAATGCATAGGTGGATGG - Intergenic
1179197796 21:39182586-39182608 CTGAAAAATGTAGAGGTGAAAGG + Intronic
1179247841 21:39649064-39649086 CTGATGAATTTAGAGCTGGAAGG - Intronic
1179639903 21:42740560-42740582 ATGATGAATGCATAGATGGATGG + Intronic
1179919418 21:44499592-44499614 CAGAAGGACTCAGAGGTGGATGG + Exonic
1179976300 21:44869363-44869385 CTGAAGAATGTAGAGATAAAGGG + Intronic
1179986253 21:44921965-44921987 CTTTGGAAGGCAGAGGTGGATGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180264883 22:10517144-10517166 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1180644049 22:17323304-17323326 CTGAAGAATTTAGAGGTAAAAGG + Intergenic
1180913394 22:19469141-19469163 CAGAAGGATGCAGAGGTGACTGG + Intronic
1182026373 22:27122416-27122438 CTTCAGAAGGCAGAGGTGGGTGG - Intergenic
1182362111 22:29752784-29752806 CTGCAGGAGGCAGAGGTGGGAGG - Intronic
1182692085 22:32171289-32171311 CTGAAGAATGGAGAGGCAGGTGG + Intergenic
1183194324 22:36343036-36343058 CTGGAGAGGGCACAGGTGGAGGG - Intronic
1184470510 22:44692966-44692988 CTAAAGAAAGCAGAGCTAGAGGG + Intronic
950964145 3:17134442-17134464 CTGACAAATGGAGAGGAGGAAGG - Intergenic
951390274 3:22094545-22094567 CACATGAAAGCAGAGGTGGAAGG + Intronic
952933686 3:38378949-38378971 TTGAAGATTGCAGAGCTGAATGG + Intronic
953043794 3:39277793-39277815 GTGAAGAATCCAGAGCTGTAGGG - Intronic
954443148 3:50532716-50532738 ATGAGGAAAGCAGAGCTGGAGGG + Intergenic
954714993 3:52522532-52522554 CTGCAGAATGGAGGGGTGCATGG - Intronic
954792409 3:53143083-53143105 CTGGACACTGTAGAGGTGGAGGG + Intergenic
956217527 3:66864270-66864292 CAGAAGGATGCAGGGGAGGAAGG - Intergenic
956910413 3:73810297-73810319 GTGAAGAATGCGGGTGTGGATGG + Intergenic
956916327 3:73875566-73875588 CTGAGGATTGCAGAGGGGGAGGG + Intergenic
957518176 3:81283264-81283286 CTTAAGGAGGCAAAGGTGGATGG + Intergenic
958893007 3:99801184-99801206 CTGAAGAATGCTGTGGGGTAAGG + Intergenic
959663288 3:108893036-108893058 CTGCAGAATGTAGAGGTAGTTGG - Intergenic
960022336 3:112969199-112969221 CAGAAGAATGAAGAGGAGAAAGG + Intronic
961066206 3:123879444-123879466 CTCAAAAATGGAGAGGAGGAAGG - Intronic
961171370 3:124800004-124800026 ATCAAGAATGCAGAGGTGAATGG + Intronic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
961654988 3:128436199-128436221 CTGAAGACTGGAAGGGTGGAAGG + Intergenic
961747065 3:129070954-129070976 CTGTAAAATGGAGAGGAGGAAGG - Intergenic
962134342 3:132718510-132718532 CTGAAGAAAGAAGAGGAGAATGG - Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
962482652 3:135811026-135811048 CTAAACAATGCAGTGGTAGAAGG - Intergenic
963461688 3:145622456-145622478 CTGTGGAATGAAGAGGTGAAAGG - Intergenic
963822652 3:149915240-149915262 CTGAATAATCCAGAGATGTAAGG - Intronic
963841693 3:150114298-150114320 CAAGAGAATGCAGAGGAGGAGGG + Intergenic
964408488 3:156374660-156374682 TGGTAGAATGCAGAGGTGAATGG + Intronic
964843166 3:161016477-161016499 CTGAAGAAGGAACAGGTTGAAGG + Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965603144 3:170474290-170474312 CCAAAGAATGAAGAGGTGGAGGG - Intronic
966079805 3:175987541-175987563 CTGAAGAATGCCTAGATGGCTGG + Intergenic
967151506 3:186654546-186654568 CTAAGGAATGAAGAGGTGGTGGG - Intergenic
967281328 3:187826856-187826878 CTGAAAAATTCATATGTGGAAGG + Intergenic
967827196 3:193886646-193886668 GTGAAGAATGCACAGGTGTATGG + Intergenic
967875233 3:194264384-194264406 CTTTAGGATGCTGAGGTGGATGG + Intergenic
968074753 3:195810183-195810205 CTGAAACATCCCGAGGTGGAAGG + Intronic
968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG + Intergenic
969178675 4:5420671-5420693 CTCAAGAATGCTGTGCTGGAAGG + Intronic
969424850 4:7118194-7118216 CTGAGGAATGGAGAGATGGATGG + Intergenic
971473467 4:27050975-27050997 CTGAAGGATGCAGAAGGGGGAGG - Intergenic
972021990 4:34326918-34326940 CTAAAGAATTCAGAAGAGGAAGG + Intergenic
972170479 4:36340044-36340066 CTGGAGAATACAAAGGTAGAAGG + Intronic
973746482 4:53968222-53968244 CTGAAGCATTCTGAGGTGGGAGG + Intronic
973834292 4:54793596-54793618 CTGAAGCATTCAGAGTTGTAAGG - Intergenic
974592546 4:63972577-63972599 ATGAAGAAAGCAAAGGTGGCTGG - Intergenic
974769349 4:66390473-66390495 CTATAGAATATAGAGGTGGATGG + Intergenic
975077855 4:70235297-70235319 CTGAAGAAGGAAGAGGTGGCAGG + Intergenic
976187770 4:82459397-82459419 CTCAAGAGTGCTGAGGTGGGAGG - Intronic
977441182 4:97070204-97070226 CAGAAGAATGCAGAGTGGCAAGG + Intergenic
981206289 4:142044540-142044562 CTGATGAATGAAGAAATGGAAGG + Intronic
981398054 4:144277801-144277823 TGGAAGAATGTGGAGGTGGAGGG - Intergenic
981644692 4:146985614-146985636 CTGAAGAGTCCAGAGTTGTAGGG + Intergenic
981691178 4:147511098-147511120 CTATTGAATGCAGAGATGGAAGG - Intronic
982122764 4:152158359-152158381 ATCAATAATGCAGAGGAGGAGGG + Intergenic
982949206 4:161667817-161667839 ATGAAAAATGCAAAGATGGAAGG + Intronic
983550393 4:169011242-169011264 GTGAAGAATGAAGGGGTGCATGG + Intergenic
984432681 4:179668249-179668271 CTGAAGAAAGCTGAGGTTGTTGG - Intergenic
984842214 4:184079197-184079219 CTTAAGGAGGCTGAGGTGGAAGG + Intergenic
985820978 5:2160359-2160381 CAGAAAAATGGATAGGTGGATGG - Intergenic
985986084 5:3517550-3517572 GTGAAGAATGCGGAAGGGGAAGG + Intergenic
986067113 5:4245427-4245449 AAAAAGAAAGCAGAGGTGGAAGG - Intergenic
986133161 5:4949238-4949260 GTAAAAAATGCAGAGGAGGAGGG + Intergenic
986614712 5:9604534-9604556 CTGAAGAATGGAGAGGAAGGGGG + Intergenic
986627144 5:9732620-9732642 TTGAAGAATGCATGGGTTGATGG + Intergenic
987759066 5:22135637-22135659 CTGAAGAATGAAGAGAAGGCTGG + Intronic
988630497 5:32925834-32925856 GTGGAGAATGCAAAGATGGAGGG + Intergenic
988942435 5:36159741-36159763 GTGGAGAAGACAGAGGTGGAAGG - Intronic
989962552 5:50433826-50433848 CTCAAGAGTTCAGAGGAGGAAGG - Intronic
991893778 5:71369083-71369105 CTGAAGAATGAAGAGAAGGCTGG + Intergenic
993887437 5:93432415-93432437 CTGCAGAATTCAGACATGGAGGG - Intergenic
994508848 5:100677560-100677582 CTAATGAATGCAGTGGTGGGAGG + Intergenic
994758217 5:103820357-103820379 CTTTAGAATGCTGAGGTGGATGG + Intergenic
995250780 5:109991051-109991073 CTGAACAAAAAAGAGGTGGAGGG + Intergenic
995538845 5:113164788-113164810 CTCAAGACTGCAGACTTGGATGG + Intronic
996261497 5:121475934-121475956 CAGAAGAATGCAGAGGCAGGAGG + Intergenic
996354451 5:122580471-122580493 CTGAAGAACGAAGAGTTGCAGGG - Intergenic
996460376 5:123734009-123734031 TTGAAGAATGCCTAGGTGGCTGG + Intergenic
996985288 5:129554592-129554614 CTGCAGAATGAAGAGATGGAAGG + Intronic
997401393 5:133605894-133605916 CTGAAGAAGGCAGAGTTGAGTGG + Intronic
998374354 5:141681362-141681384 TTGGAGAAAGCAGAGGTGGGGGG - Intronic
999616388 5:153429185-153429207 TAGAAGTATGCAGAGGTGGATGG + Intergenic
1000149912 5:158489864-158489886 GTGAAAAAAGAAGAGGTGGAAGG + Intergenic
1000283873 5:159809245-159809267 ATGAAGAATGCAGAGTAGGAGGG + Intergenic
1000287739 5:159841906-159841928 AGTAAGAATGAAGAGGTGGATGG - Intergenic
1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG + Intronic
1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG + Intronic
1001418985 5:171572568-171572590 CTGAAGAGTACAGAGCAGGAGGG - Intergenic
1002742615 5:181444722-181444744 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1003220464 6:4156671-4156693 CTGATGAATGCAGAGGGGCGAGG + Intergenic
1004008583 6:11659176-11659198 CTGAAGAATGTCCAAGTGGAAGG + Intergenic
1004295328 6:14404970-14404992 GGGAAGAATGCACAGGTAGATGG + Intergenic
1004643654 6:17539334-17539356 CTGGAGGAGGCAGAGGAGGAGGG - Exonic
1005289172 6:24361521-24361543 GTGGAGAATGCACAGGTTGAGGG + Intergenic
1005819879 6:29588951-29588973 GTGAAGAAGGCAGAGGGGCAGGG - Exonic
1006109188 6:31734629-31734651 CTGAAGACAGGAGAGGTGGGTGG + Intronic
1006317255 6:33298172-33298194 CTCAGGCAGGCAGAGGTGGAGGG + Intronic
1006483351 6:34316925-34316947 CTGAAGAAGGCAAGGGTGCAGGG + Intronic
1006503471 6:34473174-34473196 CTGCAGAAGGCAGACCTGGAAGG + Intronic
1006592811 6:35170687-35170709 CTCAAGGATGGAGGGGTGGAGGG - Intergenic
1006682566 6:35807640-35807662 TTCAAGACTGCAGAGTTGGAGGG + Intronic
1007141120 6:39575691-39575713 CTTAACACTGCAGAGGAGGAGGG + Intronic
1007359925 6:41347568-41347590 CTCAAGAAGGCAGAAGTGGGAGG - Intronic
1007387507 6:41529600-41529622 CTCTGGAATGGAGAGGTGGATGG - Intergenic
1007764934 6:44154710-44154732 CTGCAGGACTCAGAGGTGGACGG + Exonic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1009575797 6:65457406-65457428 CTTAGGAAGGCTGAGGTGGAAGG - Intronic
1009996977 6:70906776-70906798 CTGAGAAACCCAGAGGTGGAAGG - Intronic
1010108761 6:72199585-72199607 CTGGAGAGGGCAGAGGTGGAGGG + Intronic
1010203074 6:73299621-73299643 CGGAAGGATGCAGGGGCGGAGGG + Intronic
1011570887 6:88733253-88733275 TGGAAGAAGGCTGAGGTGGAAGG + Intronic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1016418640 6:143860462-143860484 CTGGATAATGCAGAATTGGAAGG + Exonic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1017438129 6:154436986-154437008 AGGAAGGATGCAGAGATGGATGG + Intronic
1018460543 6:163994668-163994690 CTGAAGAATGTGGAGCTGGCGGG - Intergenic
1019247750 6:170720461-170720483 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1019943931 7:4311927-4311949 CTGAGGGATGCAGAGATGGCAGG + Intergenic
1020972643 7:14964993-14965015 GTGAAAAAAGCAGAGGTAGAGGG + Intronic
1021160347 7:17264866-17264888 CTGAATAATGCTGTGGTGAATGG + Intergenic
1021588006 7:22230546-22230568 CTGAAGAAGGCAGTGGAGAATGG - Intronic
1022029269 7:26477541-26477563 TTGGAGACTGCAGAGGAGGAAGG + Intergenic
1022521240 7:31008314-31008336 CTGAAGGTTGCAGAGGGGAAGGG + Intergenic
1022908033 7:34874910-34874932 CTGAAAAAAGCAGAGGTAGTTGG - Intronic
1022923582 7:35038521-35038543 GCAAAGAATGCAGGGGTGGAGGG - Intergenic
1023354102 7:39349977-39349999 CAGATGAATGCAGCAGTGGAGGG + Intronic
1023769682 7:43545018-43545040 CTGTGGGAGGCAGAGGTGGAAGG + Intronic
1024787323 7:52923100-52923122 CTAAAGAAGGCAGTGATGGAAGG + Intergenic
1025243908 7:57301536-57301558 ATGAAGGAGGCTGAGGTGGAAGG - Intergenic
1025288475 7:57688889-57688911 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1026871644 7:73856392-73856414 CTTTAGGAGGCAGAGGTGGAAGG - Intergenic
1026925537 7:74190259-74190281 CTCGAGAATCTAGAGGTGGATGG + Exonic
1028006391 7:85574657-85574679 CTGTAGAATGCAGAGGGAGGAGG + Intergenic
1028937821 7:96485838-96485860 ATTAAGAATGCAGAGATGGGAGG - Intronic
1029222646 7:99002657-99002679 GTGAGGAATGCAGAGGAGGGAGG + Intronic
1029371903 7:100155613-100155635 ATGCAGAATGCTGGGGTGGACGG - Intronic
1029479885 7:100805914-100805936 CAGAAGGATGCAGAGATGGAGGG - Intronic
1029556150 7:101270649-101270671 CTTTAGAAGGCAGAGGTGGGTGG + Intergenic
1029648194 7:101871598-101871620 CGGAAGGATGCAGATGTGCATGG + Intronic
1029851342 7:103464698-103464720 CTGAAGAAGGCCCAGGTGGATGG + Intergenic
1030838678 7:114320363-114320385 CTTAAGAACACAGAGGTGGTAGG - Intronic
1030983061 7:116209662-116209684 CTGAGGACTCCAGAGGTGCAGGG - Intergenic
1032121697 7:129161781-129161803 CTGAAGGAGGCAGAGGGGAAAGG - Intronic
1033130810 7:138744069-138744091 CTGTAGAATGCATAGGGGAAGGG + Intronic
1033277800 7:139985805-139985827 CTGAGGAATGAATGGGTGGACGG + Intronic
1033344972 7:140519518-140519540 CTGAATAATGCAGAGCTCTACGG - Intronic
1033347203 7:140534698-140534720 CTGCAGAGTGTGGAGGTGGAGGG + Intronic
1033417969 7:141181020-141181042 ATGAGGAATGGAGAGATGGATGG - Intronic
1033499696 7:141935695-141935717 GTGAGGAATGGAGAGGTGGCTGG - Intronic
1033511468 7:142064163-142064185 CTGAAGGAAGCAGAGGTGTCAGG - Intronic
1033514532 7:142093191-142093213 CTGAAGAAAGCAGAGGTGTCAGG - Intronic
1033720266 7:144051275-144051297 CTGAGGAACGCAGAGGTCAAGGG + Exonic
1033724259 7:144095978-144096000 CTTAGGAATGCAGAGGTGAAAGG + Exonic
1033727067 7:144129983-144130005 CTAAGGAATGCAGAGGTCAAGGG + Exonic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1033738658 7:144250711-144250733 CTGAGGAATGTAGAGGTCAAGGG - Intergenic
1033744389 7:144300243-144300265 CTGAGGAATGTAGAGGTCAAGGG + Intergenic
1035308701 7:157951658-157951680 CTGAAGACTGCGGAAGCGGAGGG - Intronic
1035500386 8:87475-87497 ATGAAGAAAGGAGAGGGGGATGG - Intergenic
1035615535 8:998407-998429 ATGAAGGAGGCAGAGGTGGGAGG - Intergenic
1036489269 8:9210013-9210035 CTGCAGAAAGCAGGGATGGAAGG + Intergenic
1037408885 8:18573036-18573058 CTGAGGAATGCATTGGTAGAGGG + Intronic
1037570143 8:20150913-20150935 CTGAAGAAAGGAGAGGTGTGGGG - Intronic
1038226706 8:25664264-25664286 CTGAAGGGTGCACAGGAGGAAGG + Intergenic
1038584593 8:28777604-28777626 CTAAAGAAATCAGATGTGGAAGG - Intronic
1039676436 8:39673091-39673113 CTAAAGGATGCAGGGGTGGTTGG + Intronic
1040301916 8:46192435-46192457 TTGAAGCCTGCAGAGGGGGAAGG + Intergenic
1040495535 8:47961658-47961680 CTGAAGAATGCATTTGGGGAGGG - Exonic
1041099078 8:54378716-54378738 ATGAAGAATGCAGAGAGGAAGGG + Intergenic
1041183782 8:55276484-55276506 CTCAAAAATGTAGAGATGGAGGG - Intronic
1041248710 8:55914068-55914090 ATGGAGAATGGAGAGGTGGAGGG + Intronic
1041505542 8:58593556-58593578 CTGGAAGATGCAGAGATGGAAGG - Intronic
1041568489 8:59308558-59308580 CTGATCAATGCACATGTGGAGGG + Intergenic
1042871534 8:73404536-73404558 CTGAAGGATGCAGAGATGTGGGG - Intergenic
1043817721 8:84823627-84823649 GAGAAGAAGGCAGAGGTGGGAGG - Intronic
1045816969 8:106288072-106288094 ATGCAGAATGCAGAGGTTGCTGG + Intronic
1046564913 8:115886647-115886669 GTGAAGAATGGAGTGGCGGAGGG - Intergenic
1046649685 8:116823854-116823876 CTGAAAAATGTGGAGGGGGATGG - Intronic
1046850160 8:118963060-118963082 TGGAAGCATGCAGAGGGGGAAGG + Intergenic
1047257694 8:123228079-123228101 CTCGAGGATGCACAGGTGGATGG - Intronic
1047902465 8:129438490-129438512 TTGAACAATGCAGAGGTTAAGGG - Intergenic
1047971994 8:130092381-130092403 CTGTAGAAAGCTGAGGTGGGAGG + Intronic
1048926411 8:139276466-139276488 CTGGAGAAAGCAGAGGAGGTGGG + Intergenic
1049431075 8:142565236-142565258 CTGAAGAATGCAGCAGCGGCAGG - Intergenic
1049579939 8:143406651-143406673 CTGGAGAAGGCAGAGGTAGGAGG + Intergenic
1050291586 9:4160998-4161020 CTTAAGAAGGCTAAGGTGGAAGG + Intronic
1051572063 9:18570113-18570135 CTTAGGGAGGCAGAGGTGGAAGG + Intronic
1054913618 9:70476347-70476369 GTGAAGAATCCAGGGGTGGAAGG - Intergenic
1055079660 9:72257022-72257044 CTTTAGAATGCTGAGGTGGGAGG - Intronic
1055510139 9:76988091-76988113 CTGGAGGATGAAGAGGTGGCAGG - Intergenic
1055599371 9:77899634-77899656 TGGAAGAATGAAGAGGTGGGTGG + Intronic
1055743560 9:79416895-79416917 CTGGAGAATTCAAAGGTGAAAGG - Intergenic
1056340952 9:85631204-85631226 CTGGAGAGCCCAGAGGTGGAGGG + Intronic
1056508238 9:87277968-87277990 CTGAAGAATCCAGAGGTAAAAGG - Intergenic
1057387121 9:94614150-94614172 GGGAAGAAGGCAGAGGAGGAAGG + Intronic
1058354592 9:104068959-104068981 CAGGAGAATTCAGGGGTGGAGGG - Intergenic
1058398934 9:104590885-104590907 CTGAGGAATACAGAGGTGCATGG + Intergenic
1058595850 9:106614895-106614917 CTGAGGAAGGCAGAAGTGCAAGG - Intergenic
1059971832 9:119676183-119676205 TTGAAGAATCCACAGGTGGCAGG + Intergenic
1060066354 9:120504510-120504532 CTGAAGAAGGCAGAGGCAGTGGG - Intronic
1060174049 9:121484347-121484369 AAGAAAAATGCAGAGGTAGAAGG - Intergenic
1060225514 9:121787692-121787714 CAGAAGGGTGGAGAGGTGGAAGG - Intergenic
1060537517 9:124402493-124402515 TTGAAGGATTCAGAGGTGAAAGG + Intronic
1060908085 9:127325996-127326018 CTGACGATTGGAGAGGTAGAGGG - Intronic
1061623647 9:131827728-131827750 GTGAAGAATGCGGGGGTGGAAGG + Intergenic
1061934913 9:133852104-133852126 CTGAAGAATGGATGGGTGGATGG + Intronic
1061951951 9:133941557-133941579 CTGAAGAATACAGACATGAAAGG + Intronic
1062310778 9:135935400-135935422 CTCTAGAAGGCAGAGGTGGGGGG + Intronic
1203608521 Un_KI270748v1:75941-75963 ATGAAGAAAGGAGAGGGGGATGG + Intergenic
1203612064 Un_KI270749v1:18113-18135 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1185637133 X:1560970-1560992 CTTTGGAATGCTGAGGTGGATGG - Intergenic
1185837775 X:3361074-3361096 CGGAAGAGTGCAGCGGCGGACGG - Intergenic
1186168711 X:6854820-6854842 CAGAGGGGTGCAGAGGTGGAAGG + Intergenic
1186269311 X:7867598-7867620 CTGATGAATACAGAGGGGAAAGG - Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186636396 X:11409547-11409569 CTCAAGCAAGGAGAGGTGGAGGG + Intronic
1186942744 X:14528893-14528915 CTGAAGAAAGCTCAGTTGGAAGG + Intergenic
1187224915 X:17366705-17366727 ATGAAGGAAGCAGAGGTGGCAGG + Intergenic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1188987681 X:36781952-36781974 CAGAAAAATGCATGGGTGGATGG - Intergenic
1190855259 X:54287989-54288011 CTGAAGATTGCTGATTTGGAAGG + Intronic
1191851269 X:65588030-65588052 CAGAAGCCTGCAGAGGAGGAAGG - Intergenic
1193414410 X:81204042-81204064 CTGAAGACTACAGAGGAGGGAGG - Intronic
1193974040 X:88095584-88095606 TTGAAAAATGCAGATGTTGAAGG - Intergenic
1194414751 X:93597262-93597284 CTGAGGGATGTAGAGGTGGTTGG + Intergenic
1194905798 X:99575250-99575272 CTGAAGATGGCAAAGGGGGAAGG + Intergenic
1195845909 X:109228768-109228790 CTTATGAAAACAGAGGTGGAGGG + Intergenic
1195921410 X:109987552-109987574 CAGAAGAATGGAGAAATGGAAGG + Intergenic
1197106081 X:122717824-122717846 TTGAAAAATGCAGAGGTGGATGG + Intergenic
1198141018 X:133803479-133803501 CTGAAGAATGCAGAGAGCAATGG - Intronic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1198763998 X:140062627-140062649 CTGAAAAATGTAAAGGTTGAAGG - Intergenic
1199053599 X:143266222-143266244 CTCAAGATTGCAGAGCTGGTCGG - Intergenic
1199244796 X:145590795-145590817 CTTAAGAAGGCCGAGGTGGGCGG - Intergenic
1199279970 X:145990317-145990339 CTGGGGAATGCAGAGGTTAATGG - Intergenic
1199453409 X:147998848-147998870 CGGAAGAAACCAAAGGTGGAGGG + Intronic
1199730139 X:150623637-150623659 CTGAAGAAGGCAGAGGGGGATGG + Intronic
1200375606 X:155776591-155776613 CTGACGAATTCAGAGATTGAGGG + Exonic
1201575939 Y:15461289-15461311 GTGAAGGAAGCAGAGATGGAGGG - Intergenic