ID: 1161861601

View in Genome Browser
Species Human (GRCh38)
Location 19:6802024-6802046
Sequence TAGGAGAGGCATTATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161861601_1161861604 -9 Left 1161861601 19:6802024-6802046 CCGTCCTCATAATGCCTCTCCTA 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1161861604 19:6802038-6802060 CCTCTCCTACGTTTGTTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 80
1161861601_1161861607 20 Left 1161861601 19:6802024-6802046 CCGTCCTCATAATGCCTCTCCTA 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1161861607 19:6802067-6802089 ATTCTCAGCAAACTATAGCAAGG 0: 79
1: 5564
2: 7814
3: 4269
4: 1626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161861601 Original CRISPR TAGGAGAGGCATTATGAGGA CGG (reversed) Intronic
900568943 1:3348936-3348958 TTTGAGAGGCATTAAGAGAAGGG + Intronic
902599877 1:17533696-17533718 TAGGACAGGCATTTTGAGGGGGG - Intergenic
904955442 1:34279799-34279821 GAGGAGAGGCCATATGAAGATGG - Intergenic
905646823 1:39630688-39630710 TTTAAGAGGCATTCTGAGGATGG - Intronic
905768004 1:40619210-40619232 TAGGAAAGTCATTGTGAGGCAGG + Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
908209716 1:61887774-61887796 AAGGTGTGGCATTATGAGTAGGG + Intronic
908802635 1:67896455-67896477 ATGCAGAGGGATTATGAGGAGGG - Intergenic
909295359 1:73940714-73940736 TAGGTGAGGCATGATGAGAGAGG + Intergenic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
911647975 1:100355893-100355915 TAGGAGAGGCATTCACAGGCAGG + Intronic
912248897 1:107990733-107990755 TATGAGAGGCATTATGAGCAAGG + Intergenic
913162342 1:116155622-116155644 TAGGAGAGGCAACATGGGGCAGG + Intergenic
913256014 1:116954245-116954267 TGGCAGAACCATTATGAGGATGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916161855 1:161924662-161924684 TAGGAAAGGAATTGTTAGGAAGG + Intronic
916599941 1:166282999-166283021 CAGAAGAGGCATTTTGAGGAAGG - Intergenic
916875287 1:168962257-168962279 TAGAAGATGCAGTTTGAGGATGG + Intergenic
918927775 1:190809879-190809901 TAGGTGGGTCATGATGAGGAAGG - Intergenic
919758995 1:201085221-201085243 CAGGGGAGGCGCTATGAGGATGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063831337 10:9956995-9957017 TCAGAGAGGAATTATAAGGATGG - Intergenic
1066237715 10:33502503-33502525 TACGAGATGAACTATGAGGAGGG - Intergenic
1068636157 10:59350495-59350517 TAGGAGAGTCATGCTGGGGAGGG - Intronic
1069592511 10:69650805-69650827 TAGGACAGGCCTGATGAGGCTGG + Intergenic
1069796135 10:71053135-71053157 TAGGAGAGGCCCTGGGAGGAAGG + Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1073090054 10:100928618-100928640 TTGGAGAGGCAGTATAAGCAAGG + Intronic
1073546523 10:104353945-104353967 TAGGAGAGGGACAATGGGGAGGG - Intronic
1076126477 10:127978134-127978156 TAGGAAAGGCATTCTGCAGATGG - Intronic
1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG + Intronic
1077858603 11:6154939-6154961 TAGGAGAGTCAATATCTGGAGGG - Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1083680049 11:64347489-64347511 TCAGAGACCCATTATGAGGATGG + Intronic
1083796987 11:65022631-65022653 CAGGACAGGCATGATGAGCAAGG + Intronic
1084778926 11:71396279-71396301 CAGGACAGACATCATGAGGAAGG - Intergenic
1086909497 11:92456185-92456207 TAGGAGAGACCTTATGAAGTAGG - Intronic
1089069039 11:115684529-115684551 CAGGAGAGAAATTATGATGAGGG + Intergenic
1089074982 11:115730971-115730993 TAGCACAGGCATTATGTGAAAGG + Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1095285184 12:40402401-40402423 TGGGAGAGGTATGATGAGTATGG + Intronic
1099455534 12:82858301-82858323 AAGGAGAGGCATTGAGCGGACGG + Intronic
1100807615 12:98303818-98303840 TAGCAAAGGCACTATGTGGAGGG - Intergenic
1102945537 12:116984497-116984519 TAACAGAGGCTTTAGGAGGATGG + Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1104266533 12:127238473-127238495 TGGCAGAGTCATTGTGAGGAAGG - Intergenic
1108428943 13:50334515-50334537 GAGGAGAGGCAGTTTGAGTAAGG + Intronic
1110045593 13:70825750-70825772 TACGAGAGATATTCTGAGGAAGG - Intergenic
1111301388 13:86355295-86355317 TAGGAGATGGATTTTGGGGAGGG - Intergenic
1111363929 13:87215321-87215343 TAGGAGAGGCTGTATGTGGTGGG + Intergenic
1113282128 13:108799900-108799922 GAGGAGAGGCAATAAGAGCAAGG + Intronic
1113605546 13:111602663-111602685 GAGGAGAGGCATCTGGAGGAGGG - Intronic
1115448111 14:33515292-33515314 TAAGAGTGGCATTATCATGAGGG + Intronic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1118570092 14:67186225-67186247 AAGGAGAGAGATTATGAGAAAGG + Intergenic
1119071983 14:71595755-71595777 AAGGAGAGCAATGATGAGGAGGG - Intronic
1120010416 14:79407057-79407079 AAGGAGAGTCATTATCAGCAGGG - Intronic
1120087322 14:80288057-80288079 CAAGAGAGGCCTTAAGAGGAAGG + Intronic
1121740569 14:96249225-96249247 TGGTAGTGTCATTATGAGGAGGG - Intronic
1122630873 14:103107254-103107276 TGGGAGAGGCATTCTGGGAAAGG + Intronic
1122898370 14:104771671-104771693 TAGGACAGGCATTCAGGGGAGGG + Intronic
1123205323 14:106707140-106707162 TAGGCTAGGCATTAGGAAGAAGG - Intergenic
1123210367 14:106754407-106754429 TAGGCTAGGCATTAGGAAGAAGG - Intergenic
1123771854 15:23537079-23537101 CAGGTGAGACATAATGAGGAAGG - Intergenic
1124367190 15:29080465-29080487 CAGCAGAGGCATTGTGAGGAAGG + Intronic
1125130423 15:36278501-36278523 TGGGAGGGGCTTTATGAGGCAGG + Intergenic
1129579716 15:76794798-76794820 TAGAAGAGGGATTATTATGAGGG - Intronic
1133775131 16:8889716-8889738 TATGGGTGGCATTGTGAGGAAGG - Intergenic
1137465570 16:48705904-48705926 TGGGAAAGGCATTAGGGGGAGGG - Intergenic
1138335118 16:56246786-56246808 GAGGAGAGGCATTCTGGGAAAGG - Intronic
1138509003 16:57497194-57497216 TAGGAGAGGTTAAATGAGGATGG + Intergenic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1140022766 16:71254344-71254366 TAGGAGTGGTATTAGGAGGAGGG - Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1143950181 17:10626193-10626215 TAAGAGAGGCTCTCTGAGGATGG + Intergenic
1144114738 17:12077004-12077026 TAGGAAAGTCATTCTGAGGCAGG + Intronic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1146127931 17:30243687-30243709 TGGCAGAGGCAGTAGGAGGAGGG + Intergenic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1149514373 17:57269046-57269068 TAGGAACAGCATTTTGAGGAAGG + Intronic
1151357697 17:73570240-73570262 TAGGAGATGCATGTTGAGGCCGG - Intronic
1157531676 18:48426478-48426500 GGGGAGAGGCAATTTGAGGATGG - Intergenic
1159395186 18:67846811-67846833 GAGGAGCGGCATCATGGGGATGG - Intergenic
1159599060 18:70411346-70411368 GAGGAAAGGCCCTATGAGGACGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926755221 2:16229043-16229065 TGGGAGAGGCTTCATGAAGAAGG - Intergenic
927516128 2:23672570-23672592 TGCTAGAGGCCTTATGAGGAAGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
927749698 2:25656569-25656591 TATGAGCGTGATTATGAGGAAGG - Intronic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
931418933 2:62107860-62107882 ATGGAGAGCTATTATGAGGAAGG - Intronic
931907802 2:66861617-66861639 TAGGAGATGCAATTTTAGGAAGG - Intergenic
932197788 2:69799041-69799063 GAGGAGGGGCCTCATGAGGAGGG + Intronic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933476234 2:82794391-82794413 TGTGTGAGGCATTATGAGGAGGG - Intergenic
936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG + Intronic
938758552 2:134402593-134402615 TAGGAGAGGAAGTTTGGGGAAGG - Intronic
943831571 2:192470817-192470839 TAGGGGAGGCAAGATGATGATGG + Intergenic
945698785 2:213143817-213143839 TAGAAGAGTTATTATGAGGGTGG - Intronic
946007572 2:216538722-216538744 TGGGAGAGGCGTCATTAGGATGG - Intronic
948627088 2:239275935-239275957 GAGGAGAGGCCTTAAAAGGATGG + Intronic
1169136612 20:3201626-3201648 TAGGGGAGGCATTAGGAGAGAGG + Intronic
1170341118 20:15328133-15328155 TAGGACAGGCCTCATTAGGAAGG + Intronic
1171035924 20:21713013-21713035 CAGGAGGGGCCCTATGAGGAAGG + Intronic
1171937364 20:31287708-31287730 CAGGAGAGACATCATGATGAGGG - Intergenic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1175893791 20:62327191-62327213 TGGGGGAGGCACTTTGAGGATGG - Intronic
1178813331 21:35904747-35904769 TTGGAAAGAGATTATGAGGAAGG + Intronic
1179199462 21:39203073-39203095 TAGGCCAGGAATTATGAGAAAGG + Intronic
1183232565 22:36592146-36592168 AATGGGAGGGATTATGAGGATGG + Intronic
1184578610 22:45396142-45396164 TAGAAGAGGCATTTTGTGCAAGG - Intronic
1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG + Intergenic
1185202506 22:49516826-49516848 TAAGAGTGGCATTGTGATGACGG + Intronic
949863863 3:8531231-8531253 TATGAAAGGCATGATGAGTAGGG - Intronic
950388091 3:12675552-12675574 AAGAAGAGGCATTCTGGGGATGG - Intergenic
950487333 3:13281491-13281513 GAGGAGGAGCATTGTGAGGATGG - Intergenic
951051461 3:18098758-18098780 TTGGAGAGGCTTTATGGTGAAGG - Intronic
953376215 3:42430669-42430691 TAGGAGAGGGATGAAGAGGCTGG - Intergenic
956961184 3:74402998-74403020 AATGAGAGGCATTGTGAGGTAGG + Intronic
958932948 3:100226988-100227010 TTGCAGAGGCATTAAGAAGAAGG + Intergenic
958945694 3:100359590-100359612 TGAGAGAGGCAGTATGAGCAAGG - Intergenic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
960898672 3:122532386-122532408 TGGGAGAGGCATTGTGGGGAGGG - Intronic
961931507 3:130538824-130538846 TAGGAGAGAAATTCTGAGCAGGG - Intergenic
962027407 3:131562907-131562929 CAGGAGAGGAATTATCAGCAAGG + Intronic
962330691 3:134475401-134475423 TAGGACTGGCATTATAAGCAAGG - Intergenic
963320771 3:143807012-143807034 TCGGAGAGCCAGTATGAGGAAGG - Intronic
963399723 3:144782547-144782569 TAGATCAGGCAATATGAGGATGG + Intergenic
963882462 3:150544337-150544359 TAGGAAAGTCATTCTGAGGCAGG + Exonic
968309697 3:197673315-197673337 TGGGAGAGGCATTAAGGTGATGG - Intronic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
970360139 4:15301034-15301056 TAGGACACACAGTATGAGGAAGG + Intergenic
970478163 4:16445729-16445751 AAGGATAGGCCATATGAGGATGG - Intergenic
972775416 4:42235323-42235345 TATGAGAGGTAGTAAGAGGAAGG + Intergenic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977127211 4:93185016-93185038 TAGGAGAGTCATTTTGAAAATGG + Intronic
977623006 4:99158877-99158899 TAGGTCAGGCATTATTAGTAGGG - Intergenic
978091209 4:104718143-104718165 TAGAAAAGGAATTATGAGAAAGG - Intergenic
979738855 4:124125172-124125194 CAGGAGAGGTTTTCTGAGGAAGG + Intergenic
983057324 4:163113330-163113352 TAGGAGAGGAATTATGAAAGTGG - Intronic
985102755 4:186474725-186474747 TAATTGAGGCTTTATGAGGAAGG + Intronic
987807980 5:22794883-22794905 TAAGAGAGGAACTATGAGCATGG + Intronic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
989575883 5:42987648-42987670 TAGGACACACATTATTAGGAGGG + Intergenic
990901284 5:60752373-60752395 TAGGAGAGGTTGTATGATGAAGG + Exonic
993596914 5:89868897-89868919 AAGGAGAGAGATTATGGGGAGGG + Intergenic
995452314 5:112315166-112315188 TTGGACAGGCTTTATGAAGAAGG - Intronic
995484855 5:112629796-112629818 CTGGATAGGCATTATGTGGATGG - Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996425388 5:123308097-123308119 GAGGAGAGGTAATATGAGGAAGG - Intergenic
996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG + Intergenic
996981747 5:129504193-129504215 TAGAGGAGGCATTATGAGTGGGG - Intronic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998567590 5:143229889-143229911 TAGGCGAGGCTTTCTGAGTATGG + Intergenic
999063180 5:148656827-148656849 TAGGACTGGCATCATGTGGAGGG - Intronic
999258328 5:150222322-150222344 GAGGGGTGGCATGATGAGGAAGG - Intronic
999652214 5:153778584-153778606 AAGGAGGGAAATTATGAGGAAGG + Intronic
999702603 5:154241921-154241943 TAGAAGTGGCATTAAGAGAAAGG + Intronic
1000387799 5:160691712-160691734 TATGAGAAGAATTATGATGAGGG - Intronic
1004304673 6:14488848-14488870 TAGGTGAGGGATTAAGAGAAAGG - Intergenic
1004391061 6:15210207-15210229 CAGAAGAGCCATTCTGAGGAAGG + Intergenic
1005048626 6:21664952-21664974 GGGGAGGGGCATTAAGAGGAGGG - Intergenic
1005172736 6:23006690-23006712 TAGGAGAGGTATCATGCTGAAGG - Intergenic
1007998462 6:46334124-46334146 TAAGACAGGCCTTTTGAGGAGGG - Intronic
1008595737 6:53039944-53039966 AAGGTGAGGCATAATGGGGAGGG + Intronic
1008654282 6:53595720-53595742 TAGAAAAGGCATTATAAGCATGG + Intronic
1008665545 6:53712410-53712432 TAGAAGGGGCATGATCAGGAAGG + Intergenic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1011027137 6:82881404-82881426 GAGGAGGAGGATTATGAGGAGGG + Intergenic
1011259105 6:85453377-85453399 GAGGAGGGGAATTGTGAGGAAGG + Intronic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1014281409 6:119446013-119446035 TAGGAGAGGGCTGATGAGGTGGG - Intergenic
1014325563 6:119988429-119988451 TAGGAAAGGCAATATGACGATGG + Intergenic
1015441975 6:133259111-133259133 TAGGAAATGCATTAAGTGGAAGG - Intronic
1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG + Intronic
1016641374 6:146353245-146353267 TAGGAAAGGCATAATCAGAATGG + Intronic
1017685163 6:156906131-156906153 AGGGAGTGGCATCATGAGGAGGG + Intronic
1018791649 6:167153215-167153237 CTAAAGAGGCATTATGAGGATGG + Intronic
1023887725 7:44373268-44373290 TAGGAGATGCATTAGTAGGGAGG - Intergenic
1024261053 7:47573942-47573964 TGGGGAAGGCATTATGGGGAGGG + Intronic
1024959330 7:54958174-54958196 TAGGAGAGGTATTAAGGGGATGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028073608 7:86483408-86483430 TAGCTGAGGGATTATGAGCAAGG - Intergenic
1031395193 7:121265214-121265236 AAAGGGAGGCATTAAGAGGATGG + Intronic
1031867089 7:127049665-127049687 TAGGAGAGCCATGAGAAGGAGGG + Intronic
1031959171 7:127973476-127973498 TAGGAAGGGCACTAGGAGGAAGG + Intronic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1037578841 8:20232665-20232687 TAGGAGAGCAAATATCAGGAGGG + Intergenic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1040308454 8:46224261-46224283 TAGGAGAGGCCTTTTAGGGAGGG - Intergenic
1041362304 8:57066569-57066591 TAGGGGAGGCATTGTGTGGGAGG + Intergenic
1042876482 8:73444937-73444959 TAGGAGAAGCCTTCAGAGGAAGG + Intronic
1043107587 8:76134555-76134577 TAGGAAAGGGCTTGTGAGGAGGG + Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1045296350 8:100874717-100874739 GTGGAGAGGCATTTTAAGGATGG + Intergenic
1046011627 8:108555690-108555712 TAGGGGTGGCATTATTAGAAGGG - Intergenic
1046583870 8:116127112-116127134 TAGCATAGTCATTATGAGAAAGG + Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1050405351 9:5303785-5303807 TAGGAGAGTCATTAAGTGTAAGG + Intronic
1050408653 9:5338951-5338973 TAGGAGAGTCATTAAGTGTAAGG + Intronic
1055421527 9:76148390-76148412 AAGCAGTGGCATTAAGAGGATGG - Intronic
1055551880 9:77439142-77439164 TAGTCAAGACATTATGAGGATGG + Intronic
1055731970 9:79287642-79287664 TACAAGAGGCACTTTGAGGAAGG - Intergenic
1056497043 9:87167832-87167854 TATGTGAGGCATTCTGAGGGAGG - Intergenic
1057490948 9:95518964-95518986 CAGGAGTGGCATAATGAGGCAGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1060060186 9:120452918-120452940 TAGGAGAGGTATTATTCTGAGGG - Intronic
1062217185 9:135395607-135395629 TAGGAGACACTTTATGGGGAAGG - Intergenic
1062437087 9:136551137-136551159 GAGGAGAGACATCAGGAGGATGG + Intergenic
1185615315 X:1418552-1418574 GAGGAGAGGCATTCAGAGGTTGG + Intronic
1188495750 X:30781431-30781453 GGGGAGAGGCATCATGGGGAAGG - Intergenic
1189082296 X:37987613-37987635 AAGGAAAGGCTTTATTAGGAGGG + Intronic
1189221347 X:39374966-39374988 TAGGAGGGGCATTAAGGGGCTGG + Intergenic
1190169921 X:48104101-48104123 TAGGAGAGGCACTGTCAGGAAGG + Intergenic
1190175333 X:48144275-48144297 TAGGAGAGGCACTGTCAGGAAGG - Intergenic
1190187846 X:48251440-48251462 TAGGAGAGGCACTGTCAGGAAGG + Intronic
1190593966 X:52034496-52034518 TAGGCCAGGCATTAGGAGTAAGG + Intergenic
1190656728 X:52619207-52619229 TAGGAGAGGCACTGTCAGGAAGG + Intergenic
1190937780 X:55012288-55012310 TTGGAGAGGCTTTGTGAGTAAGG - Intronic
1191650220 X:63529232-63529254 GAGGAGAGGCATGAGTAGGAAGG + Intergenic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1193355191 X:80512221-80512243 GAGGAGGGGCCTCATGAGGAAGG + Intergenic
1195616959 X:106920198-106920220 CAGGAGAGGCCTTGTGGGGAGGG - Intronic
1195724566 X:107900992-107901014 TAGAGGAAGGATTATGAGGATGG + Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196187353 X:112758595-112758617 TGGGAGGGGGATTATGACGAAGG - Intergenic
1198164227 X:134037871-134037893 TAGGAGAGGCTTCATGAAGAAGG + Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198700045 X:139386980-139387002 TAGGAGATGGATGATGAGAAGGG + Intergenic
1201669450 Y:16501026-16501048 TAGAGGGGGCACTATGAGGAAGG + Intergenic