ID: 1161864269

View in Genome Browser
Species Human (GRCh38)
Location 19:6822146-6822168
Sequence GTCCCCGCAGACCCCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161864269_1161864272 -2 Left 1161864269 19:6822146-6822168 CCTGCGCTGGGGTCTGCGGGGAC 0: 1
1: 0
2: 2
3: 28
4: 237
Right 1161864272 19:6822167-6822189 ACCCTGCTGTGATCTGGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 244
1161864269_1161864276 6 Left 1161864269 19:6822146-6822168 CCTGCGCTGGGGTCTGCGGGGAC 0: 1
1: 0
2: 2
3: 28
4: 237
Right 1161864276 19:6822175-6822197 GTGATCTGGGAGAGGTCCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 150
1161864269_1161864275 5 Left 1161864269 19:6822146-6822168 CCTGCGCTGGGGTCTGCGGGGAC 0: 1
1: 0
2: 2
3: 28
4: 237
Right 1161864275 19:6822174-6822196 TGTGATCTGGGAGAGGTCCAAGG 0: 1
1: 0
2: 0
3: 30
4: 303
1161864269_1161864270 -8 Left 1161864269 19:6822146-6822168 CCTGCGCTGGGGTCTGCGGGGAC 0: 1
1: 0
2: 2
3: 28
4: 237
Right 1161864270 19:6822161-6822183 GCGGGGACCCTGCTGTGATCTGG 0: 1
1: 0
2: 1
3: 8
4: 130
1161864269_1161864271 -7 Left 1161864269 19:6822146-6822168 CCTGCGCTGGGGTCTGCGGGGAC 0: 1
1: 0
2: 2
3: 28
4: 237
Right 1161864271 19:6822162-6822184 CGGGGACCCTGCTGTGATCTGGG 0: 1
1: 0
2: 1
3: 9
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161864269 Original CRISPR GTCCCCGCAGACCCCAGCGC AGG (reversed) Intronic