ID: 1161866673

View in Genome Browser
Species Human (GRCh38)
Location 19:6837399-6837421
Sequence CTGTGTCCTTGCCCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 405}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161866668_1161866673 16 Left 1161866668 19:6837360-6837382 CCAAATTGAGTTCTGTGGGAGCA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1161866673 19:6837399-6837421 CTGTGTCCTTGCCCTGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 405
1161866665_1161866673 28 Left 1161866665 19:6837348-6837370 CCTTCTGAGACACCAAATTGAGT 0: 1
1: 0
2: 1
3: 9
4: 191
Right 1161866673 19:6837399-6837421 CTGTGTCCTTGCCCTGCTCCTGG 0: 1
1: 0
2: 2
3: 48
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161866673 Original CRISPR CTGTGTCCTTGCCCTGCTCC TGG Intronic
900477935 1:2884729-2884751 CTTTGTCCTTTCCCTCCACCAGG - Intergenic
900626177 1:3609720-3609742 CTGTGTCCTGCCTCTGCACCTGG - Intronic
901490982 1:9596084-9596106 CTGTGTCCCTGCCCTGCCCCGGG + Intronic
902184967 1:14718078-14718100 CTTTGTGCTTGCCCTGCCGCTGG - Intronic
902254392 1:15178207-15178229 CTGTCTCCTGGCTCTGCCCCAGG - Intronic
903355689 1:22746070-22746092 CTGAGTCCCTGCCCTGGGCCAGG + Intronic
903652185 1:24929222-24929244 CGGTGTCCTTGCCCCTGTCCCGG + Intronic
904055038 1:27664444-27664466 CTGTGTCCCCGCCCAGCTCCAGG - Intergenic
905058777 1:35121641-35121663 GTGTGCCCTTCCCCAGCTCCTGG + Intergenic
905219742 1:36436809-36436831 CTGTGTCCTTGGGCTCCTCTTGG + Intronic
905770692 1:40636234-40636256 CTGACACCTGGCCCTGCTCCGGG + Intronic
905883464 1:41479207-41479229 CTGTGTCCTCGCACTGCCCAGGG - Exonic
906179194 1:43803866-43803888 GTGTGTCTCTGCCCAGCTCCAGG - Intronic
906206763 1:43991342-43991364 GTTTGTCCTTGCACTGCTTCCGG + Intronic
906247160 1:44284355-44284377 CTTTGTTCCTGCCTTGCTCCAGG - Intronic
906668656 1:47639182-47639204 CTGTGGGCTTGCCCATCTCCAGG + Intergenic
909562864 1:77024973-77024995 CTGTATCCTTCCCCCGCTCCAGG + Intronic
912387322 1:109278049-109278071 AAGTGTCCTTGCCCTGTCCCTGG - Intergenic
913405752 1:118488954-118488976 CTGTGTTTTTTCCCTGATCCTGG - Intergenic
915859885 1:159432817-159432839 CTGTGTCCTTGTTCTGCCCATGG + Intergenic
917834090 1:178927190-178927212 CTATGTGCTAGCCCTGCTCTAGG - Intergenic
918082213 1:181216530-181216552 CAGTTTCCTTCCCCTCCTCCAGG + Intergenic
919878671 1:201888621-201888643 CTGTGTCCTGGACCCGCCCCCGG - Intergenic
920881266 1:209882472-209882494 CTGCCCCCTTGCCATGCTCCAGG + Intergenic
921097874 1:211902373-211902395 CTGAGTTCTTGTCCTGCTCCAGG - Intergenic
924387037 1:243508604-243508626 GTGTGGTCCTGCCCTGCTCCTGG - Intronic
924424905 1:243941954-243941976 CTATGTGCTTGCCCTTCTCCTGG + Intergenic
924607147 1:245544590-245544612 CTGACTTCTTGCCCTGCTTCTGG - Intronic
924777347 1:247119346-247119368 CTGGGTCCTGGGCCTTCTCCTGG + Intergenic
924825218 1:247531686-247531708 CTATGAACTTGCCCTGCTCATGG + Exonic
1062923802 10:1299381-1299403 GGGTGTCCTTCCCCTGCCCCTGG + Intronic
1063073683 10:2692443-2692465 CTGAGTCCTGGCCCTGCACCAGG - Intergenic
1063218984 10:3948920-3948942 GTGTGTCCTCACCCTGCCCCGGG + Intergenic
1064303288 10:14141712-14141734 ATGTTTCCTTGCACTGCACCTGG + Intronic
1065821707 10:29531950-29531972 CTGTGTCATTGCCACGTTCCTGG + Intronic
1066412997 10:35192052-35192074 CTCTGTCCTGGCCCTGGCCCTGG + Intronic
1067231866 10:44417789-44417811 CTGTCTCCTTCCCATGATCCAGG - Intergenic
1067541309 10:47156573-47156595 CTATCTCCTTCCCCTGATCCAGG + Intergenic
1068919178 10:62465128-62465150 CCCTGGCCTTGTCCTGCTCCCGG + Intronic
1069766027 10:70861077-70861099 CTTTGTCCATTTCCTGCTCCAGG + Intronic
1071571680 10:86700649-86700671 CTGTGGCCTTGTCCTAGTCCTGG + Intronic
1072670798 10:97427534-97427556 CAGTGTCCTCGCCCTAGTCCTGG + Intronic
1073492437 10:103862396-103862418 GTGTGACTGTGCCCTGCTCCAGG - Intergenic
1073552832 10:104419058-104419080 CTGTGTCCCCGTCGTGCTCCTGG + Intronic
1073816547 10:107214028-107214050 CAGTGCCGTTGCCCTGCTGCTGG - Intergenic
1074577654 10:114685557-114685579 ATGTGCCCTTCCCCTGGTCCAGG + Intergenic
1075076771 10:119357275-119357297 CTGTGGCCTTCCCTTGCTCTAGG + Intronic
1075263811 10:120984099-120984121 GTGTGTCCTGCCCCTTCTCCTGG + Intergenic
1075476960 10:122744450-122744472 CTGTGTACCTACCATGCTCCAGG - Intergenic
1075669134 10:124251330-124251352 CTGTGTTTTTGCCCTGCTTTTGG - Intergenic
1076029773 10:127147531-127147553 CTCTGTCCTTACCCTCATCCCGG + Intronic
1076076091 10:127534891-127534913 CTGTGGGATGGCCCTGCTCCAGG + Intergenic
1076366347 10:129922984-129923006 CTGTGTGCCTGCCCCTCTCCGGG + Intronic
1076434434 10:130430496-130430518 CTGTGCACTGGCCCTGCTCAAGG + Intergenic
1076541258 10:131216557-131216579 GTTTGTCCTTGTCCTGTTCCTGG - Intronic
1076598142 10:131638448-131638470 CTGTGTCACTGCCCTGCAGCTGG + Intergenic
1076827327 10:132975576-132975598 GTGAGTCCTTGCCCTGCTGCAGG + Intergenic
1077029184 11:456049-456071 CTGTGTCCGTGCCCCGGGCCAGG - Intronic
1077200635 11:1305770-1305792 CTGACTCCTTGTCCTGCTTCTGG - Intronic
1077417458 11:2431373-2431395 CTGTGTCGTTGCCCTACAGCAGG + Intergenic
1077422442 11:2459296-2459318 CTTTGTCTCTGCCCAGCTCCAGG - Intronic
1077490815 11:2860168-2860190 CTCTGTCCTTCCCATCCTCCAGG - Intergenic
1077809858 11:5626092-5626114 CTGTGTCTCTGCCTTACTCCTGG + Intronic
1078801077 11:14644336-14644358 CTTTGTCCTCGCCCTGCTGCTGG + Exonic
1079127023 11:17724399-17724421 CTGGGGCATTGCCCTGCACCAGG + Intergenic
1079299868 11:19268397-19268419 TTTTTTCCTTGTCCTGCTCCTGG + Intergenic
1080111618 11:28574481-28574503 CTCTGTCCTTGCTCTGTTTCTGG + Intergenic
1081044190 11:38251022-38251044 CTCTGGCCTCTCCCTGCTCCAGG - Intergenic
1081759398 11:45566699-45566721 CTGTGTCCTCACCCTACACCTGG - Intergenic
1082989348 11:59194016-59194038 CGGTGTCCAGGCCCTCCTCCAGG + Intronic
1083260659 11:61521088-61521110 CTGTGGGCCTGCCCTGCTCTGGG + Intronic
1083482848 11:62960775-62960797 CTGTGTCCTGGCCCTCGTCTAGG - Intronic
1083641063 11:64145582-64145604 CTGGGACCCTGACCTGCTCCTGG + Intronic
1084779653 11:71399907-71399929 CTGTGTCCCTTCCCTGCCTCAGG - Intergenic
1085044961 11:73347332-73347354 CTGTGTGCAGGCCCTGTTCCAGG + Intronic
1088815084 11:113415273-113415295 ATCTGCCCTTGCCCGGCTCCTGG + Intronic
1089065440 11:115659121-115659143 CTGTGTCCTTCCCCTCCCCCTGG - Intergenic
1089085710 11:115815323-115815345 CTAGGTCCTTGCCCTGCCCCAGG + Intergenic
1089156972 11:116410052-116410074 CTGTGGCCTGGCCCTGCCCCAGG - Intergenic
1089165654 11:116474126-116474148 GTGTCTCCTTGCCTTCCTCCTGG + Intergenic
1089167581 11:116488944-116488966 CTGTCTCCCTTCCCTGCCCCTGG + Intergenic
1089772820 11:120815623-120815645 CAGTGGGCTTGCCCTGCTCCAGG + Intronic
1090239822 11:125174154-125174176 CTGTCTCCCTGCCCTGGACCTGG - Intronic
1091711313 12:2742462-2742484 CTGTTTTCCTGCCCTGATCCTGG + Intergenic
1091751034 12:3021246-3021268 CTGTCACCTTGGCCTCCTCCAGG - Intronic
1091803019 12:3336692-3336714 CTGTTTCCCTGCCCTGGGCCTGG + Intergenic
1092174429 12:6393534-6393556 CTCTGTCCTTGGCCTGCTAATGG + Intergenic
1094048829 12:26196694-26196716 CTGTGTGCTCGCCCTGCTAGAGG + Intronic
1094474065 12:30827823-30827845 CTCTTTCCCTGCCCTGTTCCTGG - Intergenic
1095174626 12:39077438-39077460 CTTTGTCCTCCCACTGCTCCTGG - Intergenic
1096217868 12:49808525-49808547 CTGCGTCCTTACCCTTCTCTAGG + Intronic
1096264213 12:50110822-50110844 CTCTGCACTTGCCTTGCTCCAGG + Exonic
1097107666 12:56634944-56634966 CTGCGGCCCGGCCCTGCTCCAGG - Intronic
1097124913 12:56766370-56766392 CTCTGTACTTGCCATGTTCCAGG + Intronic
1097194733 12:57237120-57237142 CTCTGTCCTCTCCCTCCTCCTGG + Exonic
1098107867 12:67089712-67089734 CTGTGGCCTTGAACTCCTCCTGG - Intergenic
1098507824 12:71275005-71275027 CTGTGTGCTTGCTCTGTGCCAGG - Intronic
1101433292 12:104644654-104644676 CTGAGTCCTGGCCCTGGCCCTGG + Intronic
1101718964 12:107334694-107334716 CTGTGACCTTGCCCACCTCATGG - Intronic
1101845843 12:108362415-108362437 CTCTGGCCTTGCCCTTCCCCAGG - Intergenic
1102636704 12:114330971-114330993 TTGTTTCCTTGCCCTGATCAAGG - Intergenic
1102654414 12:114469484-114469506 CATTCTCCTTACCCTGCTCCTGG + Intergenic
1103012025 12:117465181-117465203 CTGTGTCCCAGCCCTGGGCCTGG - Exonic
1103368968 12:120403796-120403818 CAGTGTCCAGGCACTGCTCCAGG + Intergenic
1103724791 12:122992224-122992246 TTCTGCCCTTTCCCTGCTCCGGG + Intronic
1104016906 12:124967627-124967649 CTCTGTCCTTGCTCTGCTTATGG - Intronic
1104580344 12:130006865-130006887 TTGTGTCCTTCCCCTTCTTCAGG + Intergenic
1105851540 13:24340254-24340276 CTGTGTCGCTGCCCTGTCCCCGG + Intergenic
1106594140 13:31122676-31122698 GGGTCCCCTTGCCCTGCTCCAGG - Intergenic
1107884691 13:44865703-44865725 CTGTCTCCTTGCGATGGTCCAGG + Intergenic
1109024852 13:57143701-57143723 CAGTGTCCTTGGCTTCCTCCTGG + Exonic
1109025839 13:57150271-57150293 CAGTGTCCTTGGCTTCCTCCTGG + Exonic
1109026829 13:57156844-57156866 CAGTGTCCTTGGCTTCCTCCTGG + Exonic
1109027821 13:57163415-57163437 CAGTGTCCTTGGCTTCCTCCTGG + Exonic
1109028807 13:57169980-57170002 CAGTGTCCTTGGCTTCCTCCTGG + Exonic
1113016368 13:105832774-105832796 CTGTCTTCTTTCTCTGCTCCTGG - Intergenic
1113650877 13:112033461-112033483 CTGTCTGCCAGCCCTGCTCCAGG - Intergenic
1113693703 13:112329647-112329669 CAGTGTACGTGCCCTGCCCCTGG - Intergenic
1113731400 13:112644297-112644319 CGGCTTCCCTGCCCTGCTCCCGG + Intergenic
1113737663 13:112689998-112690020 CTGGCTCCTGCCCCTGCTCCGGG - Intergenic
1113804095 13:113103632-113103654 CTGTGACCGTGCCCTTCCCCAGG + Intergenic
1113839982 13:113353585-113353607 CCGTGTCCTTGCCCAGCCCCTGG - Intronic
1114916691 14:27276289-27276311 TTGTGTTTTTGCTCTGCTCCAGG + Intergenic
1115246935 14:31305203-31305225 CTTTGTGCTTGCTCTGCTTCTGG + Intronic
1115964580 14:38873360-38873382 TTGTTTCCTTACCCTGCACCAGG + Intergenic
1118050476 14:62020993-62021015 CTATGTCGGTGCCCTGCTCATGG + Intronic
1119159537 14:72441573-72441595 GTGTGTCCTGGCCCTGCTGAGGG - Intronic
1119302936 14:73585250-73585272 CTGTGACCTTGCCCTGACCTAGG - Intergenic
1119376231 14:74195823-74195845 CTTTATCCTTGCTCTGCTGCAGG - Intronic
1119851187 14:77867731-77867753 CCCTGTCTGTGCCCTGCTCCCGG + Intronic
1120860962 14:89254665-89254687 CAGTGTGCTGGCTCTGCTCCCGG + Intronic
1120922422 14:89766956-89766978 CTTTGTGCTTGCCATGCACCGGG - Intergenic
1121259674 14:92557148-92557170 CTGAGTACTTGCTTTGCTCCAGG + Intronic
1121325119 14:93015357-93015379 CTGAGTCCCTGCCCTGTGCCAGG - Intronic
1122302425 14:100738716-100738738 CTGTGTCCTAGCCCCTCTCTTGG - Intergenic
1122599127 14:102912562-102912584 CTGTGTCCTGGGGCAGCTCCCGG - Intergenic
1122626445 14:103087662-103087684 CTGGGCCCTTGGCCTCCTCCAGG - Intergenic
1122884094 14:104702911-104702933 CGGTGTCCTGGCCCTGCTCCTGG - Intronic
1123428558 15:20193832-20193854 CTGTGTCCCAGCACTGCTCATGG - Intergenic
1124632333 15:31344905-31344927 CTGGAACCTTGGCCTGCTCCTGG - Intronic
1124707186 15:31975842-31975864 CTGTGTTCTTGCCATGTGCCTGG + Intergenic
1126284935 15:46999674-46999696 CTGTCACCTTGCTCTGCACCTGG + Intergenic
1126698011 15:51341852-51341874 CACTGTCCTCGCGCTGCTCCCGG - Exonic
1126956015 15:53934722-53934744 CTGTGTCGGTGCCTTGCTCTGGG - Intergenic
1127966239 15:63924804-63924826 CTGTGCCCTTACCGTGATCCAGG + Exonic
1128328630 15:66741443-66741465 TTGGGTCCTTTTCCTGCTCCTGG + Intronic
1128553670 15:68615384-68615406 CTGTGTGATTGCCCTACACCAGG - Intronic
1128898056 15:71393787-71393809 CTGTGACCTTGAGCAGCTCCAGG + Intronic
1129349979 15:74950270-74950292 CTTGCTCCTTGCCCAGCTCCTGG - Intergenic
1130693203 15:86104316-86104338 CTGTGTCATGGCCCTGCTGTTGG + Intergenic
1131507380 15:93030251-93030273 CTGTGGGCTGGTCCTGCTCCAGG + Intergenic
1131629827 15:94164959-94164981 CTGTGTCCATTCCCAACTCCGGG + Intergenic
1132804611 16:1769690-1769712 CTGTGTCCTAGGACTGATCCCGG - Exonic
1132815197 16:1822494-1822516 CTGCCAGCTTGCCCTGCTCCAGG + Intronic
1133031550 16:3013611-3013633 CTGTGTCATTGCCCTCCTGCTGG + Exonic
1133055744 16:3144669-3144691 CTGGGTCCCTGCCCAGCTCCTGG - Intronic
1133108920 16:3534002-3534024 CTGTGTCCATGCCGCCCTCCAGG + Intronic
1133316189 16:4885495-4885517 CTGTGACCTTCTCCTGCGCCCGG + Exonic
1133716710 16:8457267-8457289 CAGTGTCCAAGCCCTGCTTCTGG - Intergenic
1133717764 16:8465861-8465883 CTGTGCCCATGCCTTGCTCTAGG - Intergenic
1134034653 16:11020556-11020578 CTCTCTCCCTGCCCTGCTCCTGG + Intronic
1134043983 16:11088139-11088161 ATGTGGCCTTGCCCTGTGCCAGG + Intronic
1134634047 16:15778759-15778781 CTGTATCCTTTCCCTGAGCCTGG - Exonic
1136169790 16:28482104-28482126 CTGGGCCCTGGCCCTGCTGCAGG - Exonic
1136779180 16:32886235-32886257 CCTTGTCCCTGCCCTCCTCCCGG + Intergenic
1136855759 16:33655900-33655922 CTGTGTCCCAGCACTGCTCATGG + Intergenic
1136891437 16:33975283-33975305 CCTTGTCCCTGCCCTCCTCCCGG - Intergenic
1137683528 16:50370573-50370595 TTGTGGCATTGCCTTGCTCCAGG + Intergenic
1137729198 16:50677455-50677477 CTGGGTCCTTGCCGTGCACTGGG + Exonic
1138201005 16:55088420-55088442 ATGTGGCCCTGCCCTCCTCCAGG + Intergenic
1138416218 16:56872809-56872831 CTGTGTCCTGGCACTGCACAGGG + Intronic
1139741448 16:69038621-69038643 CTGTACCCTTGCCTGGCTCCTGG - Intronic
1140227970 16:73093954-73093976 GTGAGTCCTGGCCCTGCTCCTGG + Intergenic
1140701211 16:77583212-77583234 CTATGTCCTTCCCCTCCTCCTGG + Intergenic
1141750548 16:85955219-85955241 CTGTGGCCTTGCCCCGCTCTCGG - Intergenic
1203081594 16_KI270728v1_random:1148323-1148345 CCTTGTCCCTGCCCTCCTCCCGG + Intergenic
1203117344 16_KI270728v1_random:1504381-1504403 CTGTGTCCCAGCACTGCTCATGG + Intergenic
1142990094 17:3724447-3724469 CTCTGGCCTCGCCCTGCCCCGGG + Exonic
1144185155 17:12789793-12789815 CTCCGTCCTTCCCCAGCTCCCGG + Exonic
1144813224 17:18015381-18015403 CAGTGGCCTTGCCCTGCTCTGGG + Intronic
1144835219 17:18153339-18153361 CTGTTTCCGTGGACTGCTCCTGG + Intronic
1144855145 17:18263387-18263409 GTGTTTCTTTGCCCTGTTCCTGG + Intronic
1144995521 17:19265553-19265575 TTGTGTCCCTGCCCTGCTCTTGG + Intronic
1144996863 17:19275652-19275674 CTGAGTCCTGGGCCTACTCCTGG + Intronic
1146065378 17:29630950-29630972 CAGTGTGCATGCCCAGCTCCAGG - Exonic
1146617147 17:34366070-34366092 CTTTGTTCTTCCCCTCCTCCTGG + Intergenic
1147142758 17:38468540-38468562 CTGTGTCTTCCCCCTGCCCCAGG - Intronic
1147445499 17:40472825-40472847 CTGTGTCCAAGCCCTGCCTCTGG + Intergenic
1147769130 17:42855809-42855831 CTGAGTCCTTTCCAGGCTCCAGG + Intronic
1148779714 17:50114428-50114450 CTGTGTGCAGGCCCAGCTCCTGG - Exonic
1148817782 17:50343011-50343033 CTGTCTGCTGGCCCTGATCCTGG - Intergenic
1148983963 17:51604771-51604793 CTGTGTCAATGCAGTGCTCCAGG - Intergenic
1150484060 17:65532013-65532035 CTGTGTCCCTGTCCTACCCCAGG + Intronic
1151372280 17:73655823-73655845 CTGTGGGCTTGCCGTGCCCCTGG + Intergenic
1151539836 17:74759250-74759272 CTGTTTCCTTCCCCTGCACTGGG - Intronic
1151954618 17:77374110-77374132 CTGTGTCCGTTCGGTGCTCCCGG - Intronic
1152230059 17:79109895-79109917 CTGTGTCCTGGCCCCACTCATGG - Intronic
1152631131 17:81411157-81411179 CTGTGTCCTGTCTCTGCCCCAGG + Intronic
1153619643 18:6965276-6965298 CTGTGTCCCTACCTTGCTTCCGG + Exonic
1154414692 18:14170731-14170753 CTGTGGCCCTGCCCTGCTTCTGG - Intergenic
1155258592 18:24020050-24020072 ATGTGTCTCTGCCTTGCTCCTGG + Intronic
1155736337 18:29226933-29226955 CTGGGTCTTTGTCCTGATCCAGG + Intergenic
1155787199 18:29915487-29915509 CTGTGTCCTTGTCCTGCATCGGG - Intergenic
1157286902 18:46383091-46383113 CTAGGCCCTTGGCCTGCTCCTGG - Intronic
1158559921 18:58505161-58505183 CGGTCTCCCTGCCCTGCCCCTGG - Intronic
1160035538 18:75298326-75298348 CCCTTTCCTTGCCCAGCTCCTGG + Intergenic
1160596915 18:79982197-79982219 CTGCTTCCTTGCCCTGGTGCTGG - Intronic
1161214237 19:3085316-3085338 CTGTGTCCTGGCCCAGTTCCCGG + Intergenic
1161417125 19:4153648-4153670 CTGTGAGCTTGCCCGGCCCCAGG + Exonic
1161805384 19:6440503-6440525 CTGTCTCCTTGCCAGCCTCCAGG + Exonic
1161866673 19:6837399-6837421 CTGTGTCCTTGCCCTGCTCCTGG + Intronic
1162069362 19:8144534-8144556 CTCTGTCCTTCACATGCTCCAGG + Intronic
1163533570 19:17864337-17864359 CTGTGTCCTTGCCCTGAGTGTGG - Intergenic
1163704402 19:18803943-18803965 CTGTGGCCGTGCCCTGGCCCTGG - Intergenic
1165408727 19:35645378-35645400 CTGTGTCCCTGCCCTGTGTCGGG + Intergenic
1165591421 19:36972994-36973016 CTGTGTGTTTGCCCAGTTCCTGG + Intronic
1165635332 19:37335178-37335200 CTGAGACTTTGCCCTTCTCCAGG + Exonic
1166282149 19:41801229-41801251 CTGTGGCCTGGCCCACCTCCGGG + Intronic
1166339965 19:42131464-42131486 CTGAGTGCTTGCCATGTTCCAGG + Intronic
1166789668 19:45391378-45391400 CTGTGCCTGTGCCCTGCCCCGGG - Intronic
1166816158 19:45547510-45547532 ATGTGGCCTTGGCCTGTTCCTGG - Intronic
1167395092 19:49223252-49223274 CTGGGTTCTTACCCTTCTCCAGG + Intergenic
1168077544 19:53989794-53989816 CTGTGACCTGGCCCTGTGCCGGG + Exonic
1168089996 19:54076137-54076159 CTGTCACCTCCCCCTGCTCCAGG + Intronic
1168271373 19:55251586-55251608 CTGTTTCCCTTCCTTGCTCCGGG + Intronic
924979035 2:203565-203587 CTGTGACCCTGCCATGCACCAGG + Intergenic
924993976 2:340467-340489 CTGTGCCCCTCCCCTGCCCCAGG + Intergenic
925731822 2:6924527-6924549 CTGGGTCTTTGCCCTGCTCTGGG - Intronic
925905895 2:8539600-8539622 CTCTGTCCTTGCCTGGGTCCAGG - Intergenic
926205322 2:10831252-10831274 CTGTGGCGCTGCCCTCCTCCCGG + Intronic
926340850 2:11903159-11903181 CAGTGTCCAAGCCCTGCTTCCGG - Intergenic
926820282 2:16844299-16844321 CCATGTTCTTGCCCTGCTCTTGG + Intergenic
926941119 2:18138235-18138257 CTGTGTCCTTGCCCATCAGCAGG + Intronic
927939483 2:27094759-27094781 GTGTCTCCTTGCCCTTTTCCTGG + Intronic
929565087 2:42979000-42979022 CTGTGGCCATGTGCTGCTCCGGG - Intergenic
930724613 2:54670527-54670549 CTTTGCCCTTGCCATGCTCAGGG + Intronic
931847665 2:66221493-66221515 CAGAGTACTTTCCCTGCTCCTGG - Intergenic
932338026 2:70942148-70942170 GTGGGTCCTTCCCCTGCACCGGG - Exonic
932412042 2:71553326-71553348 CTGTCCCCTTGCTCTCCTCCAGG + Intronic
934663202 2:96154040-96154062 CTGAGTCCTGCCCCTGCCCCTGG - Intergenic
936091401 2:109503845-109503867 CTGTGTCCTCGCCCCCCACCAGG - Intronic
936095406 2:109527360-109527382 TTGTGTCCTTCCCCTGCAGCGGG + Intergenic
936110521 2:109660809-109660831 CAGTTTCCTTCCCCAGCTCCTGG + Intergenic
936175894 2:110219460-110219482 TTGTGTTCTTGCCCTGCACTGGG - Intergenic
936556715 2:113503165-113503187 CCGAGTGCTTCCCCTGCTCCGGG + Intergenic
937555680 2:123152404-123152426 CTGTGTCCATGCCCAGCCCCAGG + Intergenic
938408201 2:131044367-131044389 CTCTGTCCTTCCCGTCCTCCAGG - Exonic
938410011 2:131055738-131055760 CTGTGTCCTCTCCCTGCGCCTGG - Intronic
938780933 2:134584147-134584169 AGCTCTCCTTGCCCTGCTCCAGG + Intronic
939142885 2:138376713-138376735 CTGTTTCCTGGCCCTCCTCCAGG - Intergenic
943133818 2:183888338-183888360 CTGTGGCCTTTCCCTGATCTCGG - Intergenic
943345738 2:186734931-186734953 GTCTGGCCTTTCCCTGCTCCCGG - Intronic
944364456 2:198900505-198900527 CAGTCTCCTTGCCCTACTCAGGG - Intergenic
945721218 2:213421206-213421228 GTCTGGCCTTTCCCTGCTCCTGG + Intronic
946025844 2:216671247-216671269 CTGTCTCCCTGCTCTGCTCCTGG + Intergenic
946225783 2:218263380-218263402 CTGTGCCCTTGCCTGCCTCCAGG - Exonic
947873913 2:233455715-233455737 CTGTGGCCTCGCCCTCCTCATGG + Intronic
947971587 2:234329310-234329332 CTGTCTCCCTGCCTTCCTCCTGG - Intergenic
948030054 2:234810027-234810049 CTGCGCCCTAGCCTTGCTCCTGG + Intergenic
948621100 2:239235245-239235267 AGGTGTCTTTGCCCTGCTCCGGG - Intronic
948777864 2:240299227-240299249 CTCTGCCCTTGGCCTCCTCCGGG + Intergenic
948869966 2:240792839-240792861 CTGTGTCCTTGCCTGGCCCAGGG - Intronic
948931617 2:241135886-241135908 CTGGGTCCTGGCCCTGCCACGGG + Exonic
1169425991 20:5497785-5497807 CTGTGTGCCTGACCTCCTCCAGG - Intergenic
1169527041 20:6440354-6440376 ATGTGTCCCTCCCCTTCTCCTGG - Intergenic
1169716772 20:8628338-8628360 CTGTGATCATGCGCTGCTCCAGG - Exonic
1171117142 20:22534708-22534730 CTTTGTTCTTTCCCTGCCCCTGG - Intergenic
1171299677 20:24049612-24049634 CTGTTTCCTTACCCTGTGCCTGG + Intergenic
1171333008 20:24357862-24357884 CTGTGACCATGACCTCCTCCAGG + Intergenic
1171460847 20:25297080-25297102 CTCTGTCCTGGCTCTGCACCTGG + Exonic
1171504142 20:25619735-25619757 ATGTGTCCTTGCACTGCTGTAGG - Intronic
1171795048 20:29560057-29560079 CTGTGTGCTAGCACTGTTCCTGG - Intergenic
1171853406 20:30324208-30324230 CTGTGTGCTAGCACTGTTCCTGG + Intergenic
1173037869 20:39429898-39429920 CTGTAGCCTTGTCCTGGTCCAGG - Intergenic
1173201104 20:40955643-40955665 CTGTGTCCAGGCCCTTCTCCAGG + Intergenic
1173853957 20:46237782-46237804 ATGAGTCCTTGCCCTTCTCTTGG + Intronic
1174063059 20:47845916-47845938 CTGGGCCCTGGCCCTGCTCCTGG - Intergenic
1174072664 20:47909758-47909780 CTGGGCCCTGGCCCTGCTCCTGG + Intergenic
1174202909 20:48819663-48819685 CTGAGGCCTTGCTCTGTTCCAGG - Intronic
1174253835 20:49239256-49239278 CTGCCTCCTTCCCCTTCTCCAGG - Exonic
1174775822 20:53342199-53342221 CTGCGTCATTTTCCTGCTCCAGG + Intronic
1175270952 20:57733929-57733951 CTGTGTCCTTGCCCTTTTTCAGG + Intergenic
1175525738 20:59632154-59632176 CTGTGTTCTACCACTGCTCCAGG + Intronic
1175919894 20:62445915-62445937 CTGTGTGCCTCCCCTGCTGCTGG - Intergenic
1176256162 20:64154290-64154312 GTGTGCCCTGGCTCTGCTCCTGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176348661 21:5772517-5772539 TTGACTTCTTGCCCTGCTCCTGG - Intergenic
1176355475 21:5893101-5893123 TTGACTTCTTGCCCTGCTCCTGG - Intergenic
1176384130 21:6128664-6128686 CCGTGCCCTTGCCGTGTTCCCGG + Intergenic
1176496166 21:7551938-7551960 TTGACTTCTTGCCCTGCTCCTGG + Intergenic
1176542982 21:8170587-8170609 TTGACTTCTTGCCCTGCTCCTGG - Intergenic
1176547105 21:8206793-8206815 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176555010 21:8251002-8251024 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176561933 21:8353632-8353654 TTGACTTCTTGCCCTGCTCCTGG - Intergenic
1176566056 21:8389840-8389862 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176573932 21:8434026-8434048 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176858329 21:13987523-13987545 CTGTGGCCCTGCCCTGCTTCTGG + Intergenic
1178158293 21:29880794-29880816 CTGAGCTCATGCCCTGCTCCTGG - Intronic
1179710545 21:43210739-43210761 CTGAGTTCTGGCCCTGCCCCTGG + Intergenic
1179739344 21:43409580-43409602 CCGTGCCCTTGCCGTGTTCCCGG - Intergenic
1180976355 22:19850947-19850969 CTGTGCCCTTTCCCTGCTGCTGG - Exonic
1180999250 22:19980375-19980397 CTGTGTCCCCACCATGCTCCGGG - Intronic
1181167599 22:20991940-20991962 AGGTGTCCTGGCCTTGCTCCTGG - Intronic
1181406227 22:22686818-22686840 CTGTCCCCAGGCCCTGCTCCAGG + Intergenic
1181749049 22:24976367-24976389 TTGTGTCCCTGCTCAGCTCCTGG - Intronic
1181762395 22:25067362-25067384 CTTTGTCCCTGCCCGCCTCCCGG + Intronic
1181892003 22:26071358-26071380 CTGTGCCCTTTCCCTGTTTCTGG - Intergenic
1182466052 22:30516984-30517006 CAGTGTCCAAGCCCTGCCCCTGG + Intergenic
1182561649 22:31164480-31164502 CTGTGTCCTTTTTCTGTTCCAGG + Intronic
1182702030 22:32248141-32248163 CTGGGTCCCTGCCCTTCACCTGG - Intronic
1183529172 22:38343470-38343492 TTGTGCCCTTGCTCTGCGCCTGG + Intronic
1183706914 22:39479859-39479881 CTGTGTACATTCCCTGCTCTAGG + Intronic
1184081958 22:42228150-42228172 CTCTGTCCTTGCCCCTCCCCTGG - Intronic
1184194309 22:42916484-42916506 CTCTCTCCTGCCCCTGCTCCGGG + Intronic
1184298539 22:43541502-43541524 CTGTGCCCATGCCCACCTCCTGG - Intronic
1184343560 22:43899460-43899482 CTGTCTCCTTCCCCTGGCCCCGG + Intergenic
1184376799 22:44118739-44118761 CTCTGTGCTTGCTCTGGTCCTGG + Intronic
1184476090 22:44722213-44722235 CTGGAGCCTGGCCCTGCTCCTGG - Intronic
1184612587 22:45614331-45614353 CTGTGCCATTGCCCTGCACAAGG - Intergenic
1185238060 22:49725965-49725987 CTGTGTCCTTGGTTTTCTCCAGG - Intergenic
1185380240 22:50504559-50504581 CTGGCTCCTTGCCCTGCAGCAGG + Exonic
1203247851 22_KI270733v1_random:86836-86858 TTGACTTCTTGCCCTGCTCCTGG - Intergenic
1203251980 22_KI270733v1_random:123078-123100 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1203260034 22_KI270733v1_random:168161-168183 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
950140083 3:10609309-10609331 CTGTGTCTCTGCCCTGCTGCTGG - Intronic
950429747 3:12943966-12943988 CTCTGTCATGGCCCAGCTCCTGG - Intronic
950436355 3:12982837-12982859 CTGTGTGCCTGCCATGCACCAGG + Intronic
950486871 3:13279035-13279057 CTGTGTGCCTGCCCTGCTTACGG - Intergenic
950635112 3:14308688-14308710 ATGTGTCCTTCAGCTGCTCCAGG - Intergenic
950950421 3:16992714-16992736 CTGAGTCCTTGCCCAGCCCTTGG - Intronic
951904673 3:27692880-27692902 GTGTGTCCTTGCCATGTTGCAGG - Intergenic
953326253 3:42014161-42014183 CCGTGTCCTTCCCCAGCCCCTGG - Intronic
954286915 3:49625732-49625754 CTGTGTCCTAGAGCTGCTCATGG - Intronic
955000749 3:54925174-54925196 CAGTGTGATTGTCCTGCTCCAGG - Exonic
955286614 3:57647693-57647715 TTGTGTGCTTACCCTACTCCAGG - Intronic
955701781 3:61688738-61688760 CTGTGTCCTTTGCCTGTTTCTGG + Intronic
960497627 3:118394637-118394659 CTGTCTCCTTGCCAGCCTCCAGG + Intergenic
960823314 3:121757484-121757506 CTGTATACTTGCCCTGCCCTGGG + Intergenic
960972338 3:123148882-123148904 CTGTCTGCTCGCCCTGCTTCTGG - Intronic
961351398 3:126306921-126306943 CTGTCTCCTTGCCTTGCTTCAGG + Intergenic
961435961 3:126916823-126916845 CTGTGGCCTGGCCCACCTCCGGG - Intronic
961496398 3:127295188-127295210 CTGTTTCATTGGCCAGCTCCAGG + Intergenic
961498766 3:127315604-127315626 ATGTCTCCTTCCCCTGCTCTGGG + Intergenic
962195062 3:133354597-133354619 TTGTGTCCTTCTCCTGCTCAAGG - Intronic
966321978 3:178711014-178711036 CTGAGTGCTTGCTCTGTTCCAGG + Intronic
967631318 3:191745450-191745472 CTTTGTAGTTGCCCTGCTGCTGG + Intergenic
967948419 3:194822365-194822387 CCGTGTCCTGGCCCTGCTGCTGG - Intergenic
968440745 4:623346-623368 CTGTGGCTTTGTCCTGCCCCAGG - Intergenic
968453512 4:686170-686192 CTGTGCCCTTGCCCAGAGCCTGG - Exonic
969184660 4:5466199-5466221 CTCCGGCCTGGCCCTGCTCCTGG - Intronic
969589756 4:8115024-8115046 CTGAGTCCTTGACCTGCCCATGG + Intronic
969974187 4:11081321-11081343 CTGTGGCCTTGGCCAGCACCTGG + Intergenic
972740927 4:41885353-41885375 ATGTTTCCTTGCCCTGTGCCAGG - Intergenic
974080467 4:57206987-57207009 CTGGGTCCTTCCTCTGCTTCAGG - Intergenic
977181479 4:93880280-93880302 CTGTTTTCTTCCCCTGCTTCTGG - Intergenic
977785447 4:101028390-101028412 CTGTGTTCTAGCACTGCTCAAGG - Intronic
977926455 4:102705630-102705652 CTGTGCTGCTGCCCTGCTCCTGG - Intronic
980920941 4:139084594-139084616 CTGTGTCCTCGCGCGGCTCCCGG - Intronic
981405559 4:144363722-144363744 CTGTGGCCTTGCCCTCTCCCCGG - Intergenic
982179197 4:152734215-152734237 GTGTGTCCTTCCCCTCCCCCTGG - Intronic
983923523 4:173371546-173371568 CCGTGCCTTTGCCCGGCTCCTGG - Intronic
984534093 4:180951551-180951573 ATGTGTCCTTGAGCTGCTCAAGG - Intergenic
985335726 4:188891819-188891841 CTGGGTTCTTGCCATTCTCCTGG + Intergenic
987770007 5:22289869-22289891 CTGTGGTCTTGCCTGGCTCCAGG - Intronic
989170291 5:38466567-38466589 CTGAGTCCATGCCCTCCACCGGG - Intergenic
989793714 5:45440538-45440560 CTGTGTTCTTGCTCTCCCCCAGG + Intronic
991046091 5:62224248-62224270 CTGTGTCCCAGCACTGCTCATGG - Intergenic
992619016 5:78574292-78574314 CTGGGCCTTTGCCCTGCTGCTGG - Intronic
993357061 5:86927540-86927562 CTGTGTCCTTGGCCTGCCTCGGG + Intergenic
995565960 5:113433473-113433495 CTGTGTCCAGCACCTGCTCCGGG + Exonic
998156327 5:139788871-139788893 CCGTGGCCTTGCTCTCCTCCAGG + Intergenic
998172823 5:139882483-139882505 CTGTCTCCTTGGCCTGGTGCCGG + Intronic
999365431 5:151020678-151020700 CTGCCTGCTTTCCCTGCTCCTGG + Exonic
999367662 5:151033579-151033601 CTGTGTCCCTCCCTTGCTCCAGG - Intronic
1001050953 5:168414095-168414117 CAATGTCCTTGCCCTGTTCCTGG - Intronic
1001286682 5:170428803-170428825 CTATGTCCCTGCCCAGCTGCGGG + Intronic
1002194466 5:177494709-177494731 CTCTGGCCTTACCCTGCCCCTGG - Intronic
1002276578 5:178107934-178107956 CTGGGGCCTGGCCCAGCTCCAGG + Intergenic
1002719063 5:181246939-181246961 CCCTGTCCTCGCCCAGCTCCCGG + Intronic
1003181894 6:3799361-3799383 CTGTGCCCATGCCCTGCCCTGGG + Intergenic
1003535372 6:6971278-6971300 CTGTGGCTTTCCTCTGCTCCAGG - Intergenic
1003647328 6:7924412-7924434 CTCTTTCCTTCCCCTTCTCCAGG - Intronic
1005969764 6:30751809-30751831 CTGGGCCCTTTCCCAGCTCCCGG - Intergenic
1007418042 6:41703429-41703451 CTGGCTCCTGCCCCTGCTCCTGG + Intronic
1007628205 6:43258446-43258468 CTCTCTCCTTGGCTTGCTCCTGG - Intronic
1009884685 6:69611667-69611689 TTGTGTCCTTGGGCTCCTCCTGG - Intergenic
1013330503 6:109095230-109095252 CTTTTTCCTTCCCCTTCTCCAGG - Exonic
1013638865 6:112053931-112053953 ATCTGTGTTTGCCCTGCTCCGGG - Intergenic
1014913735 6:127120618-127120640 GTTTGTCCCTGCCCTGCCCCTGG + Intronic
1015004798 6:128266238-128266260 CTGTGTCCTTTCCCAGCCTCAGG - Intronic
1015399078 6:132768317-132768339 CTCTGTCCTGGCACTGCTCCGGG + Intergenic
1017211477 6:151862076-151862098 ATGAATACTTGCCCTGCTCCAGG + Intronic
1019427222 7:983429-983451 CCGTGTCCTGGCCCCCCTCCTGG + Intronic
1019484753 7:1284411-1284433 CTGAGCCCCTGCCCTGCTCAGGG + Intergenic
1019540147 7:1547659-1547681 CTGTGTCCGTGCCATTCTCGAGG - Intronic
1020112739 7:5456603-5456625 CTCTGCCCTTGGCCTGCCCCAGG - Intronic
1023168014 7:37362494-37362516 CTGAGTCCTTGTCTTTCTCCAGG + Intronic
1023609216 7:41957119-41957141 CTAGGTCCATGCCCTGCTCACGG + Intergenic
1024057312 7:45670210-45670232 CTGTGGCCTTGGGCTGTTCCTGG + Intronic
1024582311 7:50809956-50809978 CTGGGTCCTGTCCGTGCTCCAGG + Intergenic
1025007487 7:55365795-55365817 CTGTGCCTCTGCCCTGTTCCTGG - Exonic
1025231344 7:57204997-57205019 CTGGGCCCTCGCCCTGCTCCTGG + Intergenic
1027200350 7:76060311-76060333 CTGTGGCTTGGCCCTGCTCTCGG + Intronic
1029375960 7:100177138-100177160 CTGTGTCCCGGTCCTGGTCCCGG - Exonic
1033591630 7:142813257-142813279 CTCTCTCCTTGCCCTTCTCCTGG - Intergenic
1033629898 7:143147480-143147502 CTGTCTTGTTGCCCTGCTCCTGG + Intergenic
1033760453 7:144431392-144431414 ATGTGACCTGGCCCTGCTCAAGG + Intergenic
1034684631 7:152959130-152959152 CAGTGACCCTACCCTGCTCCTGG - Intergenic
1034925066 7:155114553-155114575 CTCTGTGCGTCCCCTGCTCCTGG + Intergenic
1035166492 7:156993422-156993444 CCGTGTCCTGGCCCGACTCCCGG - Intergenic
1035279390 7:157767791-157767813 CTGGGGCCTGGCTCTGCTCCAGG - Intronic
1036205816 8:6805211-6805233 CTGACTCTTTGCCCTGCCCCGGG + Intergenic
1036310355 8:7680549-7680571 CCGTGTCCTTCCTCTTCTCCAGG - Intergenic
1036507305 8:9367165-9367187 CACAGTCCTGGCCCTGCTCCAGG + Intergenic
1039477892 8:37850446-37850468 CTGCGTGCTTGCGCCGCTCCAGG - Intergenic
1039880231 8:41621081-41621103 CTGTGTCCTTTCCAGACTCCAGG + Exonic
1040889333 8:52299899-52299921 CTGGGTCCTGGCTCTGCTCTGGG + Intronic
1041076571 8:54175197-54175219 CTGTGGCCTGGCGCTGCACCCGG + Intergenic
1041613696 8:59881598-59881620 CTGTCTCCTTGGGCTCCTCCTGG - Intergenic
1044068106 8:87723129-87723151 CTGTGTCCTTCTCAGGCTCCTGG - Intergenic
1045010756 8:97956677-97956699 CTGTGTCCAAGCCCTGCCTCTGG + Intronic
1047206123 8:122803982-122804004 CTGAGTCCTTGCCAGGCACCAGG - Intronic
1048021604 8:130544689-130544711 TTGAGGCCTTGCCCTGCTACAGG - Intergenic
1048854329 8:138673657-138673679 CTGTATCCTGGCCCTGCCCTGGG + Intronic
1049076530 8:140400754-140400776 CTTCCTCCTTTCCCTGCTCCCGG - Intronic
1049212617 8:141393654-141393676 CTCTGCCTTTGCCCTCCTCCCGG + Intronic
1049216007 8:141408751-141408773 AAGTGTCGTTGCCCTGCCCCCGG + Intronic
1049270367 8:141692518-141692540 CTGTGTCCTTACCCAGGTGCTGG + Intergenic
1049516751 8:143063264-143063286 CTTTGGCCTTGCACTGCTCTGGG - Intergenic
1049896304 9:114173-114195 CCGAGTGCTTCCCCTGCTCCGGG - Intergenic
1050744632 9:8860831-8860853 CTGAGTTCTTGTCCTGCTTCTGG - Intronic
1054159621 9:61664713-61664735 CTGTGCCTCAGCCCTGCTCCAGG + Intergenic
1055914760 9:81389674-81389696 CTGGGTCCTTGCCATGCTGGAGG - Intergenic
1056955141 9:91075385-91075407 CTGTGTCCTGGGCCTGCCCTGGG + Intergenic
1057125507 9:92613020-92613042 CTCTGTTCTTGTCCAGCTCCAGG - Exonic
1057127950 9:92634006-92634028 CTGTGCCTCTGCCCTGCCCCTGG - Intronic
1057214616 9:93220939-93220961 CTGTGGTCCTGCCCTCCTCCTGG + Intronic
1057499601 9:95586056-95586078 CAGTGAGCTTGCTCTGCTCCAGG - Intergenic
1057857048 9:98609841-98609863 CAGTGTCCTGGCCCTGAGCCTGG - Intronic
1058388115 9:104462343-104462365 CTGTTTCCTTGCCATGCCTCTGG + Intergenic
1059308921 9:113375279-113375301 CTGTCTACTTGCCCTGCCTCAGG - Intronic
1060519540 9:124286635-124286657 CTGTTTCCTTGCAGTGCTCCTGG + Intronic
1061176613 9:129001531-129001553 GTGTGTCCTGGGCCTGCACCTGG + Exonic
1061272146 9:129549804-129549826 CTGCGTCACTCCCCTGCTCCCGG - Intergenic
1061570140 9:131473061-131473083 TTGTTTCCCTGCCCTGGTCCAGG + Intronic
1062278024 9:135739717-135739739 CTCTGGCTTTGCCCCGCTCCGGG + Intronic
1062281990 9:135756326-135756348 CTGTGTCCTTGCTGTTTTCCTGG + Intronic
1062294378 9:135816295-135816317 CTGTGCCTGTGCCCTGCTCACGG - Intronic
1203464252 Un_GL000220v1:70071-70093 TTGACTTCTTGCCCTGCTCCTGG - Intergenic
1203468383 Un_GL000220v1:106228-106250 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1203476204 Un_GL000220v1:150200-150222 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1186448848 X:9655300-9655322 CTGTGCCCCTGCCTGGCTCCTGG + Intronic
1188632321 X:32380152-32380174 CTGTGTCCTTGCCCTCTTCATGG + Intronic
1190129476 X:47733850-47733872 CTGTGTGATGGCCCTGCTCGTGG + Intergenic
1197159121 X:123303987-123304009 CAGTCTCCTTGGGCTGCTCCAGG + Intronic
1201936713 Y:19418450-19418472 GTTTGTCTGTGCCCTGCTCCCGG + Intergenic