ID: 1161868302

View in Genome Browser
Species Human (GRCh38)
Location 19:6850830-6850852
Sequence ACCCCCTTTTCCCACATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 282}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161868296_1161868302 -3 Left 1161868296 19:6850810-6850832 CCCTGCACCTCCGCCTTGGGACC 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868292_1161868302 1 Left 1161868292 19:6850806-6850828 CCCTCCCTGCACCTCCGCCTTGG 0: 1
1: 0
2: 4
3: 40
4: 469
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868290_1161868302 17 Left 1161868290 19:6850790-6850812 CCAGAACCTAGGAGGACCCTCCC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868297_1161868302 -4 Left 1161868297 19:6850811-6850833 CCTGCACCTCCGCCTTGGGACCC 0: 1
1: 0
2: 1
3: 24
4: 277
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868294_1161868302 0 Left 1161868294 19:6850807-6850829 CCTCCCTGCACCTCCGCCTTGGG 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868298_1161868302 -10 Left 1161868298 19:6850817-6850839 CCTCCGCCTTGGGACCCCCTTTT 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868288_1161868302 25 Left 1161868288 19:6850782-6850804 CCAGCTTTCCAGAACCTAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868287_1161868302 26 Left 1161868287 19:6850781-6850803 CCCAGCTTTCCAGAACCTAGGAG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282
1161868291_1161868302 11 Left 1161868291 19:6850796-6850818 CCTAGGAGGACCCTCCCTGCACC 0: 1
1: 0
2: 3
3: 37
4: 304
Right 1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161868302 Original CRISPR ACCCCCTTTTCCCACATTCA GGG Intronic