ID: 1161868317

View in Genome Browser
Species Human (GRCh38)
Location 19:6850897-6850919
Sequence ATGCTCTTAATGATGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161868314_1161868317 14 Left 1161868314 19:6850860-6850882 CCTCCAGTGGCACTACAGTGCAA 0: 1
1: 0
2: 1
3: 5
4: 90
Right 1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG 0: 1
1: 0
2: 0
3: 14
4: 167
1161868311_1161868317 17 Left 1161868311 19:6850857-6850879 CCCCCTCCAGTGGCACTACAGTG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG 0: 1
1: 0
2: 0
3: 14
4: 167
1161868315_1161868317 11 Left 1161868315 19:6850863-6850885 CCAGTGGCACTACAGTGCAAGTG 0: 1
1: 0
2: 3
3: 10
4: 108
Right 1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG 0: 1
1: 0
2: 0
3: 14
4: 167
1161868312_1161868317 16 Left 1161868312 19:6850858-6850880 CCCCTCCAGTGGCACTACAGTGC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG 0: 1
1: 0
2: 0
3: 14
4: 167
1161868310_1161868317 18 Left 1161868310 19:6850856-6850878 CCCCCCTCCAGTGGCACTACAGT 0: 1
1: 0
2: 1
3: 4
4: 142
Right 1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG 0: 1
1: 0
2: 0
3: 14
4: 167
1161868313_1161868317 15 Left 1161868313 19:6850859-6850881 CCCTCCAGTGGCACTACAGTGCA 0: 1
1: 1
2: 0
3: 19
4: 107
Right 1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161868317 Original CRISPR ATGCTCTTAATGATGAACAA TGG Intronic
903574457 1:24329898-24329920 ATGCTCTTAACCACAAACAAAGG - Intronic
904891347 1:33781974-33781996 ATGCTTTCAATGAGGAAGAAAGG + Intronic
905247774 1:36626863-36626885 ATGCTCGTAATTATGAAGAGAGG + Intergenic
907589073 1:55648450-55648472 AGGCTATTGATGATGAAAAATGG + Intergenic
907950405 1:59178077-59178099 ATGTTCTTAAGGGAGAACAATGG - Intergenic
908349211 1:63267726-63267748 ATGCTAATAATGATGGAAAAAGG + Intergenic
911262202 1:95700206-95700228 ATGATATTTATGATAAACAATGG - Intergenic
913975097 1:143449689-143449711 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
914069489 1:144275305-144275327 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
914109666 1:144691049-144691071 ATGCAGTTAAGGATGAAGAAGGG - Intergenic
916262733 1:162858739-162858761 ATTATTTTAATGATGAACAAAGG + Intronic
921066838 1:211629314-211629336 ATTCTCTGAATGGTGAAAAAGGG + Intergenic
921656872 1:217749875-217749897 ATGCTCATATTGAGGAGCAAAGG - Intronic
921752492 1:218812047-218812069 ATGGTCTTAAGGATGAGGAATGG - Intergenic
921929107 1:220739861-220739883 AAGATCATAATGATGAAGAAGGG - Intergenic
1063206801 10:3839897-3839919 ATTCTCTTGTTAATGAACAATGG + Intergenic
1065830727 10:29611526-29611548 ATGCTCTTTATCTTAAACAAGGG - Intronic
1066136885 10:32456620-32456642 ATGCTCTTAATGAGGGAATATGG - Intronic
1066193433 10:33076732-33076754 CTGCTCTTCATGAAGAACAGAGG - Intergenic
1068496866 10:57793866-57793888 ATGCTCTCAATCATAATCAAGGG + Intergenic
1071306295 10:84302013-84302035 ATGCTGTTTGTGATGGACAATGG - Intergenic
1074810738 10:117102760-117102782 ATTCTCTCAGTGATGAAAAAGGG + Intronic
1076284277 10:129277857-129277879 GTGCTCTTACTGAGGAACTAGGG + Intergenic
1080973514 11:37306204-37306226 ATGCTCTTTAAATTGAACAATGG + Intergenic
1081244032 11:40741846-40741868 ATGCTCTTCATTATAAACATTGG + Intronic
1094104003 12:26789437-26789459 ATTCTCATAATGGTGAAAAACGG - Intronic
1096874425 12:54616037-54616059 ATGCTCTTAGTGGGGAATAATGG + Intergenic
1098389756 12:69957115-69957137 ATCCTCTTGATGATGATTAATGG + Intronic
1099430768 12:82582516-82582538 ATGGGCTTCATGATGAACATCGG + Intergenic
1105334392 13:19452383-19452405 ATGCTATTAATGAATAACAGGGG + Intronic
1108948883 13:56061691-56061713 ATGCTTTTAATGTTGATCATGGG + Intergenic
1109238793 13:59857493-59857515 ATGCTCTTAATGGTAAAATATGG + Intronic
1110328721 13:74247209-74247231 ACGCTCTTGATGATGAAGATGGG + Intergenic
1110351682 13:74515796-74515818 ATCCTCTTAATTCTGAACAGAGG - Intergenic
1112769641 13:102781681-102781703 ATTGTCTTAATGATTAACATTGG - Intergenic
1115097610 14:29656789-29656811 ATGGTCTCAGTGATGAACGATGG + Intronic
1115469943 14:33758130-33758152 ATGCTATGAATGCTGTACAAAGG - Intronic
1115718648 14:36134925-36134947 ATGAGCATAATGATGAATAATGG - Intergenic
1117946574 14:61030808-61030830 ATGCTCTTAAGGAGGAATAAAGG + Intronic
1118388631 14:65278173-65278195 ATTTTCTTAAAAATGAACAAAGG + Intergenic
1119236244 14:73021855-73021877 ATGCTCTTAATTCTCAACTAAGG + Intronic
1120355366 14:83426794-83426816 ATCCTCTTTGTGATCAACAAAGG - Intergenic
1122057292 14:99110659-99110681 ATGCTCTCAGTGTTGAACAAGGG + Intergenic
1122242655 14:100379120-100379142 ATGCTCATCATCATGAACGAGGG - Intronic
1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG + Intergenic
1130126736 15:81100429-81100451 TTGCTTTAAATAATGAACAATGG + Intronic
1130158266 15:81372552-81372574 ATGCTTGTAATGATCAATAATGG + Intronic
1131617201 15:94029002-94029024 ATGCTCCTAGTGGTGAACAGGGG + Intergenic
1139045935 16:63060161-63060183 ATGCTTGCAAAGATGAACAAAGG - Intergenic
1139721937 16:68863174-68863196 ATGATCTAAAAGATGAAAAAAGG - Intronic
1141786047 16:86201524-86201546 GTGCTCTTATTGATGAACTGAGG - Intergenic
1144285740 17:13772161-13772183 ATTCTCTGAATGCTGTACAATGG - Intergenic
1145262387 17:21362164-21362186 ATGCTGTAAATGACGAAGAAAGG + Intergenic
1146193392 17:30790550-30790572 TTGCTGTTAATGATTCACAAAGG + Intronic
1146566983 17:33921936-33921958 ATGCTGAAAATGATTAACAATGG + Intronic
1148114381 17:45166718-45166740 AAGCTCTAAAAGATGAAAAAAGG + Intronic
1149081296 17:52660761-52660783 ATGCCTTTAATTATGCACAATGG + Intergenic
1150903570 17:69312150-69312172 ATGCTATTAATGATTAAACAAGG - Intronic
1155351625 18:24912976-24912998 ATCCTCTTAATGATGAAGGTGGG + Intergenic
1157968762 18:52241279-52241301 ATTCTGTTAATGAAGAAGAAGGG - Intergenic
1158117977 18:54017894-54017916 AGCCTCTTATTGATGGACAATGG + Intergenic
1159114430 18:64097833-64097855 ATGCTCTCAATGAAGAATAAAGG - Intergenic
1159306617 18:66651720-66651742 ATGATCTTAGTGATCAAAAAAGG - Intergenic
1161059232 19:2206811-2206833 ATGTTGTTAATGATGAACACGGG + Intronic
1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG + Intronic
1162229285 19:9252220-9252242 ATGATGTGTATGATGAACAAAGG - Exonic
1165138690 19:33686550-33686572 AGGCTCTACCTGATGAACAAAGG - Intronic
1165868371 19:38952993-38953015 ATGTTTTTAATGATTAACCATGG - Intronic
1166631859 19:44413707-44413729 ATGCTCTGCACGATTAACAATGG + Intergenic
926257002 2:11212974-11212996 ATGCTGTTAATAAAGAATAAAGG - Intronic
930423812 2:51187950-51187972 ATTCTTTTAATGAGGAAAAAAGG + Intergenic
930741929 2:54840610-54840632 ATGTTCTTACTGAGTAACAAGGG + Intronic
930921754 2:56763840-56763862 ATGCTTTTAATGATATACAGTGG + Intergenic
933147585 2:78873565-78873587 ATATTCTTCATTATGAACAATGG - Intergenic
933977257 2:87521479-87521501 TTGCTTTTAATGAAGGACAAGGG - Intergenic
933989498 2:87623997-87624019 ATGCTCATGATGATGAGAAAGGG - Intergenic
934179800 2:89610662-89610684 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
934290090 2:91684923-91684945 ATGCAGTTAAGGATGAAGAAGGG + Intergenic
936154778 2:110040622-110040644 ATGCTCTTTGTGAGGAACAAAGG + Intergenic
936189905 2:110330792-110330814 ATGCTCTTTGTGAGGAACAAAGG - Intergenic
936304344 2:111326829-111326851 ATGCTCATGATGATGAGAAAGGG + Intergenic
936316562 2:111429326-111429348 TTGCTTTTAATGAAGGACAAGGG + Intergenic
942617701 2:177811335-177811357 ATGCTCTTAAAGCTGAATAATGG - Intronic
942707427 2:178792336-178792358 ATGATCTTATTTATGAACATGGG - Intronic
946509680 2:220341493-220341515 GTGGGCTTAATGATGCACAAAGG - Intergenic
1170088813 20:12567419-12567441 AAGCTCTTAGTGAGGAAAAAGGG + Intergenic
1173598175 20:44273505-44273527 GTTCTCCTAATGATGAACCAGGG - Intronic
1178984740 21:37293205-37293227 AAGGTCTTTATGAAGAACAAAGG - Intergenic
1179421041 21:41237035-41237057 ATGCTGTTCATGATAAAGAATGG + Intronic
1179426904 21:41287858-41287880 ATGCTCTTAAGGAACAAAAAGGG - Intergenic
1181884142 22:26005973-26005995 CTGCTCTTAATTAAAAACAAAGG + Intronic
1182852049 22:33483666-33483688 ATGCTCTTAATTATAACCACAGG + Intronic
1184844979 22:47077143-47077165 ATTCTCTTATTGAAGAAGAAGGG + Intronic
949371673 3:3341404-3341426 ATGCTTTAAATAATGAATAATGG - Intergenic
950774358 3:15336871-15336893 GTGATTTTAATGATGGACAATGG - Intronic
952264149 3:31769099-31769121 ATGGTCTTAAGAATGAACAGAGG + Intronic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956301665 3:67779244-67779266 AAGTTCTTAGAGATGAACAAAGG - Intergenic
956594958 3:70957430-70957452 ATCCTCTTATTGTTGATCAAAGG - Intronic
957349555 3:79005361-79005383 ATGCTCTTAATGATCCCCAATGG + Intronic
957901094 3:86491511-86491533 ATAATCTAAATGATAAACAACGG - Intergenic
959800662 3:110491252-110491274 ATGCTTTTCAAGATGAAAAAAGG - Intergenic
960084884 3:113579847-113579869 TTGTCCTTAATGATGAAGAAAGG - Intronic
962748396 3:138414575-138414597 ATGCAAAGAATGATGAACAAAGG + Intergenic
963666409 3:148193302-148193324 ATTATATTAATGATGAAAAAGGG - Intergenic
964194870 3:154051513-154051535 ATGCAGATAATGATGAATAACGG - Intergenic
966564940 3:181367999-181368021 TTGCTATTAATGAAGAAAAAAGG - Intergenic
967403914 3:189095270-189095292 AGGTTTCTAATGATGAACAAAGG + Intronic
969459325 4:7320353-7320375 GTGGTTTTAATGATGGACAATGG + Intronic
969829479 4:9782960-9782982 ATGCAGTTAAGGATGAAGAAGGG - Exonic
969982643 4:11173979-11174001 ATCCTCAAAATTATGAACAAGGG + Intergenic
971292044 4:25352034-25352056 ACGTTCATAATGATGAACCAGGG - Intronic
972451703 4:39206651-39206673 ATGCGCTTAAGGATGAACCCAGG - Intronic
974330893 4:60477204-60477226 ATCCTATCAATGATGAAAAATGG - Intergenic
974674959 4:65077587-65077609 ATGCTCTAAATGTTGATCACAGG - Intergenic
975974263 4:80076984-80077006 GTGCTCTCACTGATGAAGAAGGG - Intronic
976004554 4:80413961-80413983 ATGCTTATAAAGATGAACATGGG - Intronic
980203776 4:129691195-129691217 ATGCTCTAGATGAAGAGCAATGG - Intergenic
980717887 4:136651892-136651914 AGGCACTGAAAGATGAACAAAGG - Intergenic
980874444 4:138646986-138647008 ATGATCATAAAGATGAAGAAAGG - Intergenic
981534322 4:145783524-145783546 ATTCTCTTTATGATGAACTCTGG + Intronic
982440917 4:155434904-155434926 CTTCTCTTAATGATGACCTATGG + Intergenic
983148696 4:164249167-164249189 AGGCTCTTAAAGATTAACAGAGG + Intronic
985026901 4:185747345-185747367 AGGCTTTAAACGATGAACAAGGG + Intronic
985067774 4:186139997-186140019 ATGCTTTAAATGCTGAAAAAAGG + Intronic
987808040 5:22796086-22796108 ATTCACTTATTGATGGACAAAGG + Intronic
988054195 5:26072123-26072145 ATAGTCTTAATGATGACCCATGG + Intergenic
990733572 5:58835414-58835436 AAGCTCTTCATAATGAAGAAGGG - Intronic
992825438 5:80545514-80545536 ATTCTCTTACTGATGAAAATTGG - Intergenic
994830869 5:104782480-104782502 ATGCTGTTAATTATATACAAAGG + Intergenic
997033412 5:130158364-130158386 CTGCTCTGAATGAAGAACAATGG + Intronic
1000226244 5:159264421-159264443 ACGGTCTTAATGATGAAATAAGG + Intronic
1003747688 6:9021753-9021775 ATGCTCTTAATGATGGACCTGGG - Intergenic
1005688423 6:28278282-28278304 ATGACGTAAATGATGAACAATGG - Intronic
1007031181 6:38628506-38628528 AGGTTCTTACTGTTGAACAAAGG + Intronic
1008901268 6:56619591-56619613 AATCTCTTAATCATGAAAAAGGG - Intronic
1009347751 6:62637633-62637655 ATTCTCTTAATGTAGGACAAAGG - Intergenic
1010359277 6:74973933-74973955 ATGCTCTTAAAGATAGAGAATGG - Intergenic
1013569859 6:111411168-111411190 TTTCTCTTAATGCTGAACTAAGG + Intronic
1016776076 6:147906121-147906143 ACGCTTTTAATGAAGAAAAAAGG + Intergenic
1018216789 6:161536112-161536134 TTTCTCTTAATAATGACCAAAGG - Intronic
1020333950 7:7047156-7047178 TTGCTAGTAATGATGAACAAGGG - Intergenic
1023246623 7:38211778-38211800 ATTTTCTTACTGATGAAAAAGGG - Intronic
1028221976 7:88208030-88208052 ATGCCCTCAATGAAGAACATAGG + Intronic
1031125486 7:117768967-117768989 ATTCTCTTGTTGATGAACATTGG + Intronic
1032933553 7:136702317-136702339 ATTTTATTAATGATGAATAAAGG - Intergenic
1033425137 7:141237332-141237354 ATGATCTTAATGCTCAAAAATGG + Intronic
1038428420 8:27480571-27480593 ATGGTTTTATTGAGGAACAACGG + Intergenic
1038713830 8:29974021-29974043 ATGCTCTTAATACTAAACATAGG - Intergenic
1039147445 8:34464716-34464738 ATGCTCTGTAGGATGAACAGAGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041074108 8:54153315-54153337 AAGTTCTTAATGGGGAACAAGGG + Intergenic
1041159380 8:55022800-55022822 ATGGTATTAATGGTGAAAAATGG + Intergenic
1041310834 8:56514899-56514921 ATGCATTTAACGATGAACGATGG - Intergenic
1042095768 8:65214220-65214242 ATGCTATTAATGAAGAAAATGGG + Intergenic
1042235555 8:66609623-66609645 TTGCTGTTAATAATGATCAAAGG - Intronic
1042460448 8:69059219-69059241 ATGCTCTTAATGTTGGAGGATGG - Intergenic
1043551520 8:81378453-81378475 ATGCTCTTAAAGATAAGCCATGG + Intergenic
1044068935 8:87731521-87731543 ATAATTTTAATGATGAACAATGG + Intergenic
1045170149 8:99656783-99656805 ATGATTTAAATGATAAACAAAGG + Intronic
1047314154 8:123716764-123716786 ATCCTATTAACAATGAACAATGG - Intronic
1048551821 8:135440489-135440511 ATGTTCTGAATGAAGAACAGCGG - Intergenic
1051386406 9:16513820-16513842 ATACTATGAATGATGAACTAGGG + Intronic
1052467138 9:28842980-28843002 ATGTTCCTAATGATATACAATGG + Intergenic
1053532468 9:38896273-38896295 AAGCTCTGAATAATGAGCAAAGG - Intergenic
1054204693 9:62120694-62120716 AAGCTCTGAATAATGAGCAAAGG - Intergenic
1054633666 9:67467664-67467686 AAGCTCTGAATAATGAGCAAAGG + Intergenic
1055308713 9:74955845-74955867 ATGCTATTATGGAAGAACAAAGG - Intergenic
1057151460 9:92799600-92799622 AAGCTCTGAATGATGAGCAAAGG + Intergenic
1057922637 9:99110067-99110089 ATTTTCTTCATGATGAAGAAGGG - Intronic
1058191921 9:101927910-101927932 ATGCTTTCAATGGTGAATAAAGG + Intergenic
1058473793 9:105309055-105309077 ATGCTCTTAATATTGAAGACTGG - Intronic
1059813919 9:117890140-117890162 ATTATCTTAACAATGAACAAAGG - Intergenic
1186488323 X:9951241-9951263 ATTCTCCTACTGATGAACATCGG - Intergenic
1189563126 X:42211507-42211529 ATGCTATTAAAGATAAAAAATGG - Intergenic
1189621223 X:42840622-42840644 ATGCTATAAATGATAAAAAATGG - Intergenic
1189986925 X:46561858-46561880 CTTCTCTTCATGATGACCAAGGG + Intergenic
1191136913 X:57074730-57074752 ATGATCCCAATGATCAACAATGG - Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1199657433 X:150010523-150010545 ATGCTTTCAATGATGTATAAGGG - Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1202597416 Y:26555817-26555839 ATGCTATTAATGAATAACAGGGG - Intergenic