ID: 1161871960

View in Genome Browser
Species Human (GRCh38)
Location 19:6877118-6877140
Sequence CCTACCACAGGCAGGGTATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161871960_1161871970 9 Left 1161871960 19:6877118-6877140 CCCGATACCCTGCCTGTGGTAGG No data
Right 1161871970 19:6877150-6877172 GGGCCTCCTCTCCCTCCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161871960 Original CRISPR CCTACCACAGGCAGGGTATC GGG (reversed) Intergenic
No off target data available for this crispr