ID: 1161877103

View in Genome Browser
Species Human (GRCh38)
Location 19:6920181-6920203
Sequence GATCCAATCAGATCAAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 7, 2: 17, 3: 43, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161877103_1161877106 -2 Left 1161877103 19:6920181-6920203 CCAGGTCTTGATCTGATTGGATC 0: 1
1: 7
2: 17
3: 43
4: 149
Right 1161877106 19:6920202-6920224 TCCTGGATCCTGCTATGTGGTGG 0: 1
1: 0
2: 2
3: 9
4: 194
1161877103_1161877105 -5 Left 1161877103 19:6920181-6920203 CCAGGTCTTGATCTGATTGGATC 0: 1
1: 7
2: 17
3: 43
4: 149
Right 1161877105 19:6920199-6920221 GGATCCTGGATCCTGCTATGTGG 0: 1
1: 15
2: 22
3: 24
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161877103 Original CRISPR GATCCAATCAGATCAAGACC TGG (reversed) Intronic
900790918 1:4680142-4680164 CATCCAATCAGATGAAGGCCTGG - Intronic
911161590 1:94687245-94687267 GCTCCAATCAGATCAAGCTCTGG - Intergenic
913273954 1:117120364-117120386 GATCGAAGGAGATCAAGAACAGG + Intronic
914794296 1:150906967-150906989 GATCTAACCAGAGTAAGACCAGG + Intergenic
916078066 1:161214627-161214649 AAACCACTCAAATCAAGACCTGG + Intergenic
918263157 1:182815060-182815082 GACCCAATCAGATCAATTACTGG - Intronic
918758024 1:188361443-188361465 GCTCCAATCAGATCATGTCCTGG + Intergenic
921685899 1:218088817-218088839 GAGCCCATGAGTTCAAGACCAGG + Intergenic
922714081 1:227857397-227857419 GCTCCAATCAGATTAAGCCCCGG + Intergenic
922907553 1:229185896-229185918 GATCCAATCAGATGGAGCTCCGG + Intergenic
1063435013 10:6022410-6022432 GATTTAATCAGAACAAGACATGG - Intronic
1063883031 10:10550657-10550679 GATCCAATCAGATGGAGTCCTGG - Intergenic
1064415635 10:15146877-15146899 GATCCCAGGAGTTCAAGACCAGG + Intronic
1064555418 10:16542525-16542547 GCTCCAATCACCTCAACACCTGG - Intergenic
1066199908 10:33134702-33134724 GATCCAATCAGATCGAGCCCTGG + Intergenic
1066260290 10:33723398-33723420 GATCCAATCAGATCAAGCCCTGG + Intergenic
1066266738 10:33783196-33783218 GATCAAATCAGATGGAGCCCTGG - Intergenic
1067554241 10:47256978-47257000 GATCCAATCAGAGGAAGCTCTGG + Intergenic
1068028913 10:51683669-51683691 GTTCCAATCAGATCAAGCCGTGG - Intronic
1068760565 10:60703928-60703950 CATCCTATCAGATCAAAAGCCGG - Intronic
1069220358 10:65875823-65875845 GATACAATCATAGCCAGACCTGG - Intergenic
1069375268 10:67786945-67786967 GATCCAATCAGATCAAGCCCTGG + Intergenic
1069441685 10:68434432-68434454 GAGCCCATGAGTTCAAGACCAGG + Intronic
1070706612 10:78643686-78643708 TATCCAATCAGTTGAAGGCCTGG - Intergenic
1071437445 10:85660452-85660474 TATCCAAACATATCCAGACCTGG + Intronic
1073155779 10:101345367-101345389 GAGCTAAGGAGATCAAGACCAGG - Intergenic
1078836003 11:15030541-15030563 GATCCGAACAGCACAAGACCTGG + Intronic
1080298039 11:30752643-30752665 GATCCAATCAGATTGAGCCCTGG - Intergenic
1081242625 11:40725546-40725568 GATCCAGTCAGCTGAAGACAAGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083574180 11:63777489-63777511 GATCCAGTGAGATTTAGACCTGG - Intergenic
1086061341 11:82702785-82702807 AATCCTGTCAGATCAAGACAAGG + Intergenic
1088257559 11:107915658-107915680 GATCCAATCAGATCAAGCCCTGG + Intronic
1094173039 12:27514489-27514511 GATCCAATCAAATCGAGTTCTGG + Intergenic
1097129598 12:56801925-56801947 GATCCAATCAGATTGAACCCTGG - Intergenic
1097964904 12:65568619-65568641 GATCCAATGAAATAATGACCTGG + Intergenic
1098881851 12:75925449-75925471 GATCCAATCAGATTGAGTTCTGG + Intergenic
1099694815 12:86004966-86004988 AATTCAATTAGATCAAGTCCTGG + Intronic
1100420257 12:94425330-94425352 GATCCAATCAGATCAAGCTCTGG + Intronic
1100961724 12:99969395-99969417 GAGCCAAGGAGTTCAAGACCAGG - Intronic
1101578888 12:106023703-106023725 GATTCAATCAGATCAAACCCTGG + Intergenic
1101812230 12:108117613-108117635 GGTCCAATCAGATTGAGCCCTGG - Intergenic
1103185660 12:118954950-118954972 GATCCAATCAGATCGAGCTCTGG - Intergenic
1103637812 12:122322563-122322585 GAGCAAATCAGAGCAAGAACTGG - Intronic
1104423678 12:128657512-128657534 GATCCAATCAGATTGAGCCCCGG - Intronic
1104423687 12:128657551-128657573 GATCCAATCAGATCGAGCCCTGG - Intronic
1104594586 12:130112482-130112504 GTTCCAATCATGCCAAGACCAGG + Intergenic
1105466163 13:20642714-20642736 GATCCAAGCTGATCATGAACTGG - Intronic
1106171304 13:27290885-27290907 GATCCAATCAGATCAAGCTCTGG - Intergenic
1107839043 13:44436840-44436862 GCTCCACTCAGCTCTAGACCAGG + Intronic
1108374114 13:49797322-49797344 GATCCTATCAGATCAAGCCCAGG + Intergenic
1110041495 13:70765618-70765640 GATCCAATCAGATCGAGCCCTGG - Intergenic
1111344701 13:86935721-86935743 GATCTAACCAGATCAAGCTCTGG + Intergenic
1112766482 13:102751158-102751180 GATCCAATCAGTTAAAGGCCTGG + Intronic
1113361260 13:109633686-109633708 CATCCAATCAGATCAAACCCTGG - Intergenic
1114888123 14:26880742-26880764 AATCCAATCAGATAAAGCTCTGG - Intergenic
1115291357 14:31776526-31776548 GATCCAATCAGATCAAGTCCTGG - Intronic
1115292055 14:31783253-31783275 AATCCAATCAGATTGAGCCCTGG - Intronic
1117295095 14:54371806-54371828 CATCCAATCAGTTGAAGGCCTGG + Intergenic
1117575664 14:57094680-57094702 CATCCAATCAGCTGAGGACCTGG - Intergenic
1117658786 14:57983308-57983330 GATCCAATCAGATCAAGCCCTGG - Intergenic
1117756962 14:58985071-58985093 CATCCAATCAGTTGAAGTCCTGG + Intergenic
1123401042 15:19986796-19986818 GATTCAATCAGATCTGGACAGGG + Intergenic
1124398267 15:29324293-29324315 GATCCCAAGAGTTCAAGACCAGG - Intronic
1124606666 15:31174517-31174539 GAGCCAATCAGTTACAGACCTGG - Intergenic
1125495846 15:40193061-40193083 GATCCCAGGAGTTCAAGACCAGG - Intronic
1130120713 15:81045322-81045344 GATCCCATCAGATTGAGCCCTGG - Intronic
1130685341 15:86032232-86032254 GATCCAGTCAGATTGAGCCCTGG + Intergenic
1132209433 15:100009051-100009073 GATCCCAGGAGTTCAAGACCAGG - Intronic
1133970613 16:10565362-10565384 CATCCAATCAGTTGAAGGCCTGG + Intronic
1135069927 16:19342937-19342959 GATCCAATCAAATTGAGCCCTGG + Intergenic
1135347889 16:21704902-21704924 GATCCAATCAGAATGAGTCCTGG - Intronic
1136089331 16:27907097-27907119 GGGCCAATCAGAGCTAGACCTGG + Intronic
1136509598 16:30728529-30728551 GCGCCAATCAAATCCAGACCAGG - Intronic
1139327272 16:66162163-66162185 GATCCAATCAGATCGAGCCCTGG + Intergenic
1139605331 16:68014182-68014204 GATAGAGTCAGATAAAGACCTGG - Intronic
1139919038 16:70447385-70447407 GAGCCAAGGAGTTCAAGACCAGG + Intergenic
1142209071 16:88799272-88799294 GAGCCAATCAGATCCTGTCCTGG - Intergenic
1142329834 16:89444728-89444750 GAGCCCATGAGCTCAAGACCAGG + Intronic
1147245672 17:39118800-39118822 GAGCCAATCAGATCACCACCCGG + Intronic
1148953836 17:51337239-51337261 TGTCCAATCAGCTCAAGGCCAGG + Intergenic
1149796533 17:59525911-59525933 GATCCACTCAGAACAAGAATGGG + Intergenic
1150071771 17:62157064-62157086 GATCCCAGGAGTTCAAGACCAGG - Intergenic
1153497308 18:5712594-5712616 GAGACAACCATATCAAGACCTGG + Intergenic
1153607833 18:6853003-6853025 GATCTAATCAGATTGAGCCCTGG - Intronic
1153846854 18:9057964-9057986 GATCCAATCAGATCTAGCTGTGG + Intergenic
1153846872 18:9058056-9058078 GATCCAATCAGATCTAGCTGTGG + Intergenic
1155623311 18:27806537-27806559 GAGCCCATTAGTTCAAGACCAGG + Intergenic
1157611074 18:48956024-48956046 GATGGAATCAGCTAAAGACCTGG + Intergenic
1158424796 18:57329320-57329342 GATCCAATCATATGGAGCCCTGG - Intergenic
1158989546 18:62854628-62854650 TATGCCATCAGGTCAAGACCTGG - Intronic
1160195434 18:76751351-76751373 GATCCAGGCAGTTCATGACCAGG - Intergenic
1161755219 19:6128479-6128501 TATCCAATCAGCTCGAGCCCTGG + Intronic
1161877103 19:6920181-6920203 GATCCAATCAGATCAAGACCTGG - Intronic
1162000257 19:7740170-7740192 GATCCAATCAGATTGAGCCCTGG - Exonic
1162004665 19:7769803-7769825 GATCCAATCAGATTGAGTCCTGG + Intergenic
1164779319 19:30879899-30879921 TATCCAATCAGATCAAACACTGG - Intergenic
1166517677 19:43459779-43459801 CTTCCAATCAGATGAAGGCCTGG - Intergenic
1166651059 19:44575516-44575538 GAGCCAATCAGATCAAGCCCTGG - Intergenic
1166655235 19:44606355-44606377 GATCCAATCACATTGAGCCCTGG + Intergenic
1168385358 19:55958762-55958784 GAGCCCAGGAGATCAAGACCAGG - Intronic
926233549 2:11022806-11022828 GATCCAATCAGATTGAGCCCTGG - Intergenic
926515877 2:13845268-13845290 GATTCAGTCAGATCAAGCTCTGG - Intergenic
927612820 2:24558868-24558890 GATCCAACGAGATCAAGCCCTGG - Intronic
927752144 2:25678920-25678942 GAGCCTATCAGTTCAAGACCAGG + Intergenic
932913456 2:75829778-75829800 GAGCCAATCAGATAAAGAGCTGG + Intergenic
932943816 2:76203247-76203269 CATCCAATCAGCTGAAGGCCTGG - Intergenic
933547764 2:83736908-83736930 AATCCAATCAGATGAAACCCAGG - Intergenic
935239124 2:101163208-101163230 GATCCAATCAGATTGAGCTCTGG + Intronic
935487674 2:103677933-103677955 GTTCCAATCAGATTAAGCTCTGG - Intergenic
937344093 2:121112702-121112724 GATCCAATCAGATGGAGCCCTGG + Intergenic
940225391 2:151395858-151395880 GATCCAATCAGATTGAGCCCTGG - Intergenic
942112093 2:172692728-172692750 GATCCAATCAGATCACGCCCTGG - Intergenic
943300505 2:186191737-186191759 GATTAAATCAGATCAAGCCCTGG + Intergenic
943515223 2:188877205-188877227 GGTCAAATCAGTTCAAGAGCCGG - Intergenic
945958393 2:216107403-216107425 GATCCCAGGAGTTCAAGACCAGG + Intergenic
946006455 2:216529372-216529394 GATCCAATCAGATTGAGCCCTGG + Intronic
947359032 2:229328454-229328476 GAACCAATCAGATCATCAGCTGG + Intergenic
1169463645 20:5818811-5818833 GATCCAATCAGATTGAGCCCTGG - Intronic
1170275039 20:14576252-14576274 CATCAAATCACATCAAAACCTGG - Intronic
1170592469 20:17781320-17781342 GATCCAATCAGATCAAGCTCTGG + Intergenic
1170641366 20:18156623-18156645 GAACCAATCCTATCAACACCTGG - Intronic
1172603470 20:36199358-36199380 GACCAAATCACATAAAGACCAGG + Intronic
1173097047 20:40044186-40044208 GATCCAATCAGATCAAGACTTGG + Intergenic
1173386134 20:42589739-42589761 GATCAAAACAGATCAGGAGCTGG - Intronic
1175228196 20:57457399-57457421 GATCCAATCAGATTGAGCCCTGG + Intergenic
1176376686 21:6090254-6090276 GATATAATCAGGTCAAGACCTGG + Intergenic
1177961645 21:27674047-27674069 GATCCAATCAGATCAAGCCCTGG - Intergenic
1179746789 21:43447990-43448012 GATATAATCAGGTCAAGACCTGG - Intergenic
949635109 3:5974103-5974125 GATCCAATTAGATTGAGCCCTGG - Intergenic
950512642 3:13440994-13441016 CATCCAATCACCTGAAGACCTGG - Intergenic
951588295 3:24237151-24237173 GACCCACTCAGATTAATACCTGG - Intronic
953399938 3:42604238-42604260 AATTCAATCAGATCAAAATCTGG - Intronic
954901729 3:54025924-54025946 GATCCAATCAGATCGAGCTCTGG - Intergenic
956162377 3:66368802-66368824 GATGCAAGGAGTTCAAGACCAGG + Intronic
957631941 3:82727359-82727381 GATCCAGAAAGATCAAGGCCAGG + Intergenic
959605835 3:108241364-108241386 GATCCAATCAGATAGAGCTCTGG + Intergenic
960624671 3:119670221-119670243 GATCCAGTCAAGTCAATACCAGG + Intronic
960774457 3:121232900-121232922 GATCCGATCAGATAGAGCCCTGG - Intronic
970420262 4:15899271-15899293 GATCCAATCAGATCAATCCCTGG - Intergenic
971440908 4:26684382-26684404 GATTCAATCAGATCAAGCCCTGG - Intronic
973288953 4:48450879-48450901 CATCCAATCATTTCAAGGCCTGG + Intergenic
976322706 4:83733892-83733914 GCTCCAAACAGATAAAGGCCAGG - Intergenic
976637344 4:87300061-87300083 CATCCAATCAGATAAAGAAGGGG + Intergenic
978252799 4:106653200-106653222 GATTTAATCAGATTGAGACCTGG + Intergenic
979613245 4:122711931-122711953 CATCCAATCAGCTGAAGGCCAGG + Intergenic
980712310 4:136585563-136585585 AATCCAATCAGATAGAGCCCTGG + Intergenic
984320678 4:178191639-178191661 GATTCAAGCAGATTAAGACAGGG + Intergenic
984364685 4:178783569-178783591 CATCCAATCAGTTGAAGGCCTGG + Intergenic
985270778 4:188192795-188192817 CATCCAATCAGGTGAAGGCCCGG - Intergenic
985767321 5:1786903-1786925 GATCAAATCAGGCCAAGCCCGGG - Intergenic
990824911 5:59888203-59888225 GATCCAATTAGAATAAGACAAGG + Intronic
992029152 5:72703178-72703200 GATTCAATCAGATCAAGCCCTGG + Intergenic
995746335 5:115407825-115407847 TGACCAATCACATCAAGACCTGG - Intergenic
998454130 5:142257586-142257608 CATTCAATCAGCTGAAGACCTGG + Intergenic
999564601 5:152843449-152843471 GGTCAAATCAGATGAGGACCAGG + Intergenic
1000122559 5:158211040-158211062 CATCCAATCAGCTGAAGGCCTGG - Intergenic
1000761238 5:165227348-165227370 GATACAATCAGATCAACAGCTGG - Intergenic
1003611714 6:7620302-7620324 CATCCAATCAGTGGAAGACCTGG - Intergenic
1003728363 6:8792096-8792118 GATCCAATCAGACTGAGCCCTGG + Intergenic
1004202276 6:13560153-13560175 GATCCAATCAGATCAAGCTCTGG + Intergenic
1005923227 6:30418584-30418606 GATCCAGTCAGGTGCAGACCCGG + Intergenic
1005937453 6:30534254-30534276 CATCCAATCAGTTGAAGACCTGG - Intergenic
1007870032 6:45024800-45024822 CATCCAATCAGTTGAAGACATGG + Intronic
1015490118 6:133815410-133815432 GATCCAACAAGATCCAGACCTGG + Intergenic
1015748285 6:136534342-136534364 AATCCAATCAGGTGAAGGCCTGG - Intronic
1017072965 6:150592685-150592707 GCACCAATCAGCTCGAGACCTGG + Intergenic
1017391625 6:153946222-153946244 ACTCAAATCAGAGCAAGACCAGG - Intergenic
1017794767 6:157834098-157834120 AATCCGATCAGATCAAGCCCTGG - Intronic
1018050511 6:160004999-160005021 GATCCAATCAGATAGAGCCCTGG - Intronic
1019903134 7:4040203-4040225 GATCCAATCAGATTCAGCTCTGG - Intronic
1019949585 7:4360646-4360668 GATCCAATCAGATCAAGCTCTGG - Intergenic
1019957155 7:4424570-4424592 GATCCAATGAGATTGAGCCCTGG - Intergenic
1020064497 7:5177070-5177092 GAAGCAATCAGATTAACACCTGG + Intergenic
1021358109 7:19678897-19678919 GATCCATTCATATCTAGAACAGG + Intergenic
1021402051 7:20220409-20220431 GATTCCATCAGATCAAGTACTGG + Intergenic
1021706091 7:23369291-23369313 GATCCAATCAGATTGAGCCCTGG + Intronic
1023910985 7:44556324-44556346 GATCCAATCAGATCAAGCTCTGG - Intergenic
1026054888 7:66975425-66975447 GATCCAATCAGATTGAGCCCTGG - Intergenic
1026504287 7:70969057-70969079 GATCCAATCAGATCCAGGCCTGG - Intergenic
1026688027 7:72529244-72529266 GATCCAATCAGATGAATCCCTGG + Intergenic
1026715019 7:72781312-72781334 GAGCCAATCAGATCATGTCTTGG + Intronic
1026723251 7:72851093-72851115 GATCCAATCAGATGAATCCTTGG + Intergenic
1026936378 7:74258718-74258740 AATCTAATCAGAGCAATACCCGG - Intergenic
1032110747 7:129073167-129073189 GATCCAATCAGATTGAGCTCTGG + Intergenic
1032422865 7:131797034-131797056 GAACCAATAAAATCAAGAGCAGG - Intergenic
1033232397 7:139610909-139610931 GATCCAATCAGATCGAGCTGTGG + Intronic
1034483316 7:151340516-151340538 AATGCAATCAGATCAAGCCCTGG - Intergenic
1035489190 7:159257473-159257495 GATCCAATCAGATCGAACCCTGG + Intergenic
1036166148 8:6435517-6435539 GATCCAATCAGATTGAGCCCTGG - Intronic
1036922482 8:12871162-12871184 GATCCAATCAGATTGAGTTCTGG - Intergenic
1038156070 8:24991770-24991792 GATCCAATCAGATTGAGCTCTGG - Intergenic
1039823873 8:41156815-41156837 GATCCAATCAGATTGAGCTCTGG + Intergenic
1044057423 8:87588462-87588484 GATCTATTAAGATCAACACCAGG + Intronic
1044844452 8:96366527-96366549 AATCCAATCAGATGGAGCCCTGG + Intergenic
1044854363 8:96459277-96459299 GATCCAATCAGATCGAGCTCTGG + Intergenic
1046291674 8:112170279-112170301 GATCCAATCAAATTGAGCCCTGG + Intergenic
1047775890 8:128070058-128070080 TACCCAATCAGAACAAGACAGGG - Intergenic
1048493219 8:134913654-134913676 GATTCAACCAGAACAAGCCCAGG - Intergenic
1048718442 8:137295567-137295589 AATCCAATCAGCTAAAGACCAGG + Intergenic
1048718700 8:137298223-137298245 AATCCAATCAGCTAAAGACCAGG - Intergenic
1050412971 9:5385518-5385540 GATCAAAACAGAACAAGACAGGG - Intronic
1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG + Intergenic
1056972908 9:91223249-91223271 CATCCAAAAAGATCAAGTCCTGG - Intronic
1057002667 9:91527040-91527062 GATCCCAGGAGTTCAAGACCAGG + Intergenic
1060627202 9:125124586-125124608 CATCCAATCATTTGAAGACCTGG - Intronic
1186145363 X:6619182-6619204 GATCCAATCAGATTGAGCCCTGG + Intergenic
1187921165 X:24203316-24203338 GATCCAATGAGATCAAAGCATGG - Intronic
1190766057 X:53476719-53476741 CATCCAATCAGTTGAAGGCCTGG + Intergenic
1194645613 X:96454851-96454873 GATGCAATCAGATTAAGATGAGG - Intergenic
1195754780 X:108190039-108190061 GCTCTAAACAGGTCAAGACCTGG - Intronic
1197207723 X:123804307-123804329 GAGGCAAACAGCTCAAGACCTGG + Intergenic
1198763913 X:140062012-140062034 GAGCCAATAGGATCAAAACCAGG + Intergenic
1200808430 Y:7457277-7457299 GATCCAATCAGATTGAACCCTGG + Intergenic
1201275515 Y:12294135-12294157 GAGCCAAGGAGTTCAAGACCAGG - Intergenic
1202346711 Y:23936784-23936806 GCTACAAGCAGATCAAAACCAGG - Intergenic
1202524060 Y:25733309-25733331 GCTACAAGCAGATCAAAACCAGG + Intergenic