ID: 1161879113

View in Genome Browser
Species Human (GRCh38)
Location 19:6934935-6934957
Sequence CTGGATATACAAATAGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 4, 2: 25, 3: 103, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161879113_1161879118 30 Left 1161879113 19:6934935-6934957 CCCTTGTCTATTTGTATATCCAG 0: 1
1: 4
2: 25
3: 103
4: 363
Right 1161879118 19:6934988-6935010 TCAACTCCCTTCTCCTGACCTGG 0: 1
1: 1
2: 2
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161879113 Original CRISPR CTGGATATACAAATAGACAA GGG (reversed) Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
900930857 1:5736461-5736483 ATGGATAGATAGATAGACAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905122878 1:35695322-35695344 CTGGACCTTCAAATACACAAAGG + Intergenic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
906941051 1:50255731-50255753 CTGGATCTATAAATAAACATGGG - Intergenic
908168946 1:61485818-61485840 ATGGATTAAAAAATAGACAATGG + Intergenic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908965162 1:69752385-69752407 CTGGAAAGAGAAAGAGACAAAGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909101564 1:71355672-71355694 CTGGAGATACAAAAAGATAGAGG - Intergenic
910154616 1:84200550-84200572 CTGGACATAAGAATGGACAAAGG - Intronic
911441136 1:97927055-97927077 AGTGATATACAAATAGATAAAGG + Intergenic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914779496 1:150772132-150772154 ATGGATTTAGAAATAAACAAAGG - Intergenic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
916599634 1:166279575-166279597 CTTGATTTAAAAATAGGCAAAGG - Intergenic
917026132 1:170644510-170644532 CTGTATATAAAACTAGAGAAAGG - Intergenic
917592523 1:176491184-176491206 CTGGAGATTCAAATATACATGGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918814795 1:189168837-189168859 CTAGATCTATAACTAGACAAAGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063549456 10:7016100-7016122 TTGGATATAGAAAGAGATAAAGG - Intergenic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1065835546 10:29654911-29654933 CTGGATAGAAAAAAAGACAGGGG - Intronic
1066214725 10:33275045-33275067 TTGGAAATAAAAATATACAATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067788350 10:49269565-49269587 CTGGACATACAGATAGGCAGTGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068695910 10:59968024-59968046 CTGTATATACGAATATACACTGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1069467200 10:68651848-68651870 CGAGTTATACAAAAAGACAAAGG + Exonic
1070229632 10:74551091-74551113 AAGGATGTACTAATAGACAAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1073522486 10:104146672-104146694 CTGGATATACATGCAAACAAGGG + Intronic
1073807485 10:107113970-107113992 CTGGTAATACAAAAATACAAAGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1078039231 11:7842837-7842859 CTGGATATATATATACCCAAAGG + Intergenic
1078151644 11:8764665-8764687 CTGGATAAAGAATTAGAAAAGGG + Intronic
1078641005 11:13096163-13096185 CTTGATATAAAAATAGACTGAGG - Intergenic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079621724 11:22563909-22563931 CTGGACATAGGAATGGACAAAGG - Intergenic
1080845051 11:36019736-36019758 CTGGATACAGAAAGAAACAAAGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081668817 11:44932092-44932114 ATGGATAGAGACATAGACAAGGG - Exonic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1082641957 11:55672615-55672637 CTGGACATACACAAAGGCAATGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1086091610 11:83010101-83010123 CTCTATATACCAATAGAGAAGGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087013678 11:93536576-93536598 CTGTATACACAAATACACTATGG - Intronic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088302234 11:108371593-108371615 CAGTATATACACATACACAATGG - Intronic
1089168556 11:116496865-116496887 CTGGATTTAAAAATTGGCAAAGG - Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1091176903 11:133567196-133567218 CTGGATATACAAAAAAAAATAGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091541466 12:1466288-1466310 CTGGACATACAGAAAGACACTGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093911225 12:24749591-24749613 CTGGATGTACAAGAAGACACAGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1098057204 12:66520619-66520641 CTGGATATACACACAGATAGTGG + Intronic
1099026752 12:77474015-77474037 CTGTATATATATATACACAATGG + Intergenic
1099702864 12:86110348-86110370 CTATATATACACATAGTCAAGGG + Intronic
1101361343 12:104030706-104030728 CTTGATTTAAAAATAGGCAAAGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107374790 13:39791165-39791187 CTAGATATACATATAGAAAGTGG - Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108598531 13:51970953-51970975 CTGGAAATCCAAATAGGCAATGG - Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111329978 13:86752723-86752745 AAGGATATAGAAATAGATAAAGG + Intergenic
1111598186 13:90437208-90437230 CTGGATATAGAATTATACATAGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113370587 13:109721688-109721710 CTGGATTAAAAAATAGACTATGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115167369 14:30464102-30464124 GTGGATAGAAAAATAGAAAAGGG - Intergenic
1115209228 14:30948430-30948452 CTGGGTATACAAACAACCAAAGG + Intronic
1115268747 14:31527963-31527985 CTGGACATACAAGGAGATAACGG - Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116487973 14:45474425-45474447 CTGGATATACAAATATGAAGTGG - Intergenic
1116811992 14:49548076-49548098 CTGGAAATACATGTACACAAAGG + Intergenic
1118335136 14:64847066-64847088 GTGGAGCTACACATAGACAAGGG - Intronic
1119451603 14:74716636-74716658 GGGGATATACAAATACACAAGGG - Intronic
1120138056 14:80893817-80893839 TTGGATAGACAAATAAACTAGGG + Intronic
1120290071 14:82556929-82556951 CAGGATATACAAAAAGCCAATGG - Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1124044235 15:26133616-26133638 GGGGATAGACAAATAGACGAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1126168863 15:45677236-45677258 ATGGATAGATAGATAGACAAAGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133410031 16:5560529-5560551 CAGGAGATTCAAACAGACAAAGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133954594 16:10430296-10430318 CTGGATAAAAAAATAGTGAATGG + Intronic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1135055240 16:19226617-19226639 ATGGAGTTACAAATAGACAAGGG + Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136638804 16:31544196-31544218 CTGGATGTATAGATAGACTATGG - Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1138174819 16:54887380-54887402 CGGGATATAGCATTAGACAAAGG + Intergenic
1138414496 16:56863621-56863643 CTGGAGGTACACATAGACATTGG + Intergenic
1140630214 16:76843276-76843298 CTGGATATACAAACAAATTAAGG - Intergenic
1141306849 16:82872751-82872773 CTGGAGATAGAAATAGGGAATGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144067330 17:11636360-11636382 CTGGATAAACCAATAAACAAAGG - Intronic
1146431495 17:32800180-32800202 CTGGATATATACATACCCAAAGG + Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150769217 17:68027247-68027269 CTTGGTATACAAACATACAATGG + Intergenic
1150976666 17:70095230-70095252 CTGAATATACAAATAAATACTGG + Intronic
1152164844 17:78696313-78696335 CTGGATATACTAGTAAACATTGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153455540 18:5278033-5278055 CTGGATCTAATAACAGACAAAGG + Intergenic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156604015 18:38644160-38644182 GTGGTTATAAAAATAGACACTGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157085849 18:44580265-44580287 CTGGTTCTAAAAATACACAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157989535 18:52478109-52478131 CAGGATATACATATAGACCAGGG - Intronic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158585585 18:58730927-58730949 CTTGATTTAAAAATAGGCAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160098635 18:75900166-75900188 TTTGAAAAACAAATAGACAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1163229545 19:15991218-15991240 GTAGACATAGAAATAGACAAAGG + Intergenic
1163278150 19:16298767-16298789 CTGGAAATAGAAAGTGACAATGG + Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1164850589 19:31479965-31479987 CTGGAAATACCAAAAGATAAAGG - Intergenic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168251713 19:55145855-55145877 CTGGGCATATAAATAGAGAAAGG - Intronic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
925263060 2:2544847-2544869 CTGTGTATACAAATAGGCTATGG - Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925848217 2:8052791-8052813 ATGTATATACAAATATACACAGG - Intergenic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
931107704 2:59074942-59074964 CATGATATACACATAGACCAGGG - Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932271024 2:70410050-70410072 CTGGATATATATACACACAAAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933681968 2:85109941-85109963 CTGGATATAAAAATCAACATGGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
935948456 2:108307189-108307211 CTGGTTATCCAAAGAGAAAAGGG - Intronic
936560334 2:113532961-113532983 CTGGTTTTAAAAAGAGACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938235596 2:129703952-129703974 CTGGACTTAAAAATAGGCAAAGG - Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941811541 2:169760385-169760407 CTGGGTATACATATACCCAAAGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
943395999 2:187335322-187335344 TTTGATATAAAAATACACAATGG + Intergenic
943551497 2:189345712-189345734 CTGGTTGTTCAAATAGAGAAGGG + Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945850393 2:214999224-214999246 CTGGATCTAGAACTAGGCAAAGG + Intronic
946511626 2:220364022-220364044 CTGGATATACATACACACCATGG + Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
947454993 2:230245874-230245896 CTTGCTATACAAATAGATGAAGG + Exonic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169537875 20:6565404-6565426 CTGGGGTTACAAAGAGACAATGG - Intergenic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171094712 20:22320731-22320753 CTGGCTAAACACATAGCCAAGGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172545899 20:35761305-35761327 ATGGATATACATATACACATGGG + Intergenic
1173128696 20:40365895-40365917 CTGGACATAAAAATAAAAAATGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174714049 20:52737837-52737859 CTAGATAAACAAACAGACAGAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175683124 20:61005860-61005882 CTGGGGAGACAAAGAGACAAGGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177556094 21:22690543-22690565 GTGGATATAGAAACAGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178183681 21:30194213-30194235 CTGGACATATAAGTGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178343409 21:31805110-31805132 CTGGATAGAAAAAGAAACAAAGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178956199 21:37024332-37024354 CTGGACATAGGAATAGGCAAAGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179224065 21:39437012-39437034 GAGGATATAGCAATAGACAAAGG - Intronic
1179433341 21:41340939-41340961 CTGTATATAAAAATATACATAGG - Intronic
1179606657 21:42520613-42520635 GTCGATATAGAAATAGAGAAGGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1183106468 22:35618658-35618680 CTGGATAGACAAAGAGATGATGG - Intronic
1183603745 22:38856057-38856079 TAGGATATACAAAGAGTCAAAGG - Intergenic
949100823 3:143019-143041 ATGGATATACAAATATGGAAAGG - Intergenic
949270429 3:2210092-2210114 TTGGATAGACAAATAGATACAGG - Intronic
949647249 3:6109995-6110017 CTGGATATACTAATATGCTATGG - Intergenic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952938636 3:38422376-38422398 CTGGAAGTACAAATAAGCAAGGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954506486 3:51080799-51080821 CTGGATATAAAATAAAACAACGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956049431 3:65231620-65231642 CAGGAGATAGAAATAGACCATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956809519 3:72850855-72850877 ATGGATGTAGAAATAGAAAAGGG - Intronic
957617525 3:82550331-82550353 CTGTATTGACAAATAGCCAATGG - Intergenic
957670813 3:83300305-83300327 CTAGATATACATATAAACATTGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958706325 3:97661089-97661111 CTGGATTTACAAAAAGAGCAGGG - Intronic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
959737063 3:109671456-109671478 CTGGATATAAAGACAGACATAGG + Intergenic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
963769358 3:149373943-149373965 CTGGATGTACTAGTAGAAAATGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966264897 3:178027988-178028010 CTGGATATAAGAATAGAGAAAGG + Intergenic
966495982 3:180581324-180581346 CAGGATATCCAAATAGAAACTGG + Intergenic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967580997 3:191154012-191154034 ATGGAAATAGAAATAGAGAAGGG - Intergenic
967683761 3:192396316-192396338 CATGATATACAAATACTCAATGG + Intronic
968247746 3:197170797-197170819 CTGGATATAGGAACAGGCAAAGG - Intronic
968339028 3:197939288-197939310 CTTGAAATACAAATAAAAAAAGG + Intronic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970338136 4:15074508-15074530 CTGCATATACAGTTAGAAAAAGG + Intergenic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971462365 4:26914486-26914508 ACAGATATACAAATAAACAATGG - Intronic
971964415 4:33534168-33534190 ATTGATAAACAAATAGAGAAAGG + Intergenic
973020218 4:45195626-45195648 CAGGATTAACACATAGACAAAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
977531112 4:98201277-98201299 CTATATATATATATAGACAATGG + Intergenic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
980293314 4:130873100-130873122 CTTGATATAAAAATATATAAAGG + Intergenic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
983002764 4:162438951-162438973 GAAGATATACAAATAGCCAATGG + Intergenic
983387363 4:167082423-167082445 CTTTATTTACAAACAGACAATGG - Intronic
983782729 4:171692234-171692256 ATAGATATACAAATAAATAAAGG + Intergenic
984023166 4:174511013-174511035 CTGGATATTCACATAAACTATGG + Intronic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990762971 5:59150959-59150981 CCAGATATATAAATAAACAAAGG + Intronic
990817451 5:59802000-59802022 CAGGAGATACAAATAAAGAAGGG + Intronic
991166761 5:63571846-63571868 CTGTATTGACAAATACACAAAGG - Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
993299559 5:86190793-86190815 TTGCATCTACAAATAGGCAAAGG + Intergenic
993370099 5:87082500-87082522 AGGGATATACAAATACATAAAGG + Intergenic
993518615 5:88869552-88869574 CTGCATATGCAGATAGATAATGG - Intronic
995022135 5:107379030-107379052 CTGCATATATAAATAGCTAAAGG + Exonic
995027994 5:107446869-107446891 CAGGATATATAAATACACAAAGG + Intronic
995174571 5:109160379-109160401 ATTGATATACTAATAGAGAAAGG - Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997013875 5:129906988-129907010 TTGGATATAAAAATAAAGAATGG + Intronic
997715168 5:136037116-136037138 CTGCATTTACAAAGAGAGAAGGG + Intronic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999345390 5:150814321-150814343 CTGGACACACAAAAAGAAAATGG + Intergenic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999912236 5:156215498-156215520 CCTGATTTACAAATGGACAAAGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1001277986 5:170364813-170364835 CTTGATACACACATAGATAATGG + Intronic
1003651989 6:7969240-7969262 CTGGATAAATGAATAAACAAAGG + Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005184728 6:23152725-23152747 CTGGAGATATAAATATACAAAGG - Intergenic
1005315825 6:24601942-24601964 CTGGATATAAAAGCAGACAATGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1008378181 6:50814862-50814884 CTGGATTTATAAGTAGGCAAAGG - Intergenic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009819639 6:68783497-68783519 CTAGGTAAACAAAAAGACAAGGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011812119 6:91144792-91144814 CTGCTTCTACATATAGACAATGG - Intergenic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015208283 6:130666846-130666868 AAGCCTATACAAATAGACAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017349934 6:153428024-153428046 CTGGATATGTGAATGGACAATGG - Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020673336 7:11147739-11147761 AGGGACATACAAATAGAGAAGGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021041455 7:15867153-15867175 TTGGTTATACCAATAGTCAAAGG + Intergenic
1021602386 7:22377434-22377456 CTGGATTTACAACCAGACATGGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024086139 7:45893308-45893330 CATGATATACAAATTGACATAGG - Exonic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1029701704 7:102250735-102250757 ACGCATATACACATAGACAAGGG - Exonic
1030280780 7:107772905-107772927 CTGGATACAAAATTAGAAAATGG - Intronic
1030447362 7:109663954-109663976 CTGGATATACAGATAGATTCTGG + Intergenic
1031103282 7:117508159-117508181 CTAGGTAAACAATTAGACAAAGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031719473 7:125153310-125153332 CAGGATATAGAAACACACAAGGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032185966 7:129726627-129726649 CTGGATATACAGTGAGTCAAAGG + Intronic
1033197993 7:139343624-139343646 CTAGATATTCAAATAGAGAAAGG + Intronic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034088046 7:148338337-148338359 CTGGATTTTCTAATAGACACAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040742563 8:50596631-50596653 CATGAGATACAAATAGACCAAGG - Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041476253 8:58270055-58270077 CTGGATATAGAATTATACATTGG + Intergenic
1043134283 8:76501485-76501507 CTGGGTATACATATACCCAAAGG + Intergenic
1043194978 8:77280695-77280717 TTGGACATACAAAGAGACACAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046813346 8:118556660-118556682 CTGGTGATAGAAATAGACATGGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049892344 9:82386-82408 CTGGTTTTAAAAAGAGACAAGGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050688545 9:8199360-8199382 CTGGATAGACATATACACCATGG - Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051042969 9:12836813-12836835 CTGAATATACAAATACACTCTGG + Intergenic
1051581419 9:18680211-18680233 CTGATTATACCAATAGACATGGG + Intronic
1052764110 9:32622808-32622830 ATGGATAAACAAATACACATTGG - Intergenic
1053616185 9:39769057-39769079 ATGGATATACAAATATTAAAAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053733763 9:41083463-41083485 CTGGTTTTAAAAAGAGACAAGGG + Intergenic
1053874354 9:42528361-42528383 ATGGATATACAAATATTAAAAGG + Intergenic
1054237332 9:62573333-62573355 ATGGATATACAAATATTAAAAGG - Intergenic
1054267981 9:62938393-62938415 ATGGATATACAAATATTAAAAGG - Intergenic
1054551467 9:66607844-66607866 ATGGATATACAAATATTAAAAGG - Intergenic
1054719171 9:68586423-68586445 CTGTATATACATATATAAAATGG - Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058471879 9:105288117-105288139 CTGATTATACAAATATGCAAAGG - Intronic
1058911780 9:109526808-109526830 ATGGATAAATAAGTAGACAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060807001 9:126584098-126584120 CTGGAAAGACCAATAGCCAAGGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061749022 9:132762617-132762639 CTGGATAGCCACATAGAAAACGG + Intronic
1061771598 9:132927987-132928009 GTGGTTATACAAGTAGAAAAGGG - Intronic
1185877226 X:3711603-3711625 GTGGAAATACAACTCGACAATGG - Intronic
1186428270 X:9482703-9482725 CTGGCTATAGAGATAGAAAAAGG - Intronic
1186620366 X:11234438-11234460 CTGGAAATACAAACAAACATTGG - Intronic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188898931 X:35704869-35704891 TTGGATATATAAATATCCAACGG - Intergenic
1189353006 X:40291102-40291124 CTGGATTTACAAAGAAAAAAGGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1190898762 X:54648182-54648204 ATGGAAATACAAAGAGAAAAAGG - Intergenic
1192110804 X:68362041-68362063 CCTGATTTAAAAATAGACAAAGG - Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193199538 X:78672282-78672304 CTGGATATATTAATAGACTTGGG - Intergenic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194484139 X:94466160-94466182 CTGGACATAGAAACAGGCAAAGG + Intergenic
1195414029 X:104601057-104601079 CTGGATTTACTAATAAATAATGG - Intronic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1196998481 X:121410767-121410789 ATTGATATAAAAATAGATAATGG - Intergenic
1197618866 X:128724136-128724158 GTGGAAATATAAATAGTCAATGG - Intergenic
1197921669 X:131601198-131601220 CTGGATAAAGAAAAACACAATGG - Intergenic
1197936775 X:131747655-131747677 ATGGACATACAAAAAGAAAAGGG + Intergenic
1199084598 X:143614311-143614333 GTGTATATATAAATAGATAAAGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199353675 X:146834958-146834980 TAGGATATACATATAGAAAAGGG - Intergenic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic