ID: 1161886118

View in Genome Browser
Species Human (GRCh38)
Location 19:6997169-6997191
Sequence CCACCATGGCACCACCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161886118_1161886128 29 Left 1161886118 19:6997169-6997191 CCACTAAGGTGGTGCCATGGTGG No data
Right 1161886128 19:6997221-6997243 TCCTGTGGATCATAACCAGCCGG No data
1161886118_1161886124 14 Left 1161886118 19:6997169-6997191 CCACTAAGGTGGTGCCATGGTGG No data
Right 1161886124 19:6997206-6997228 AGAGGACCAGCCTCCTCCTGTGG No data
1161886118_1161886121 -4 Left 1161886118 19:6997169-6997191 CCACTAAGGTGGTGCCATGGTGG No data
Right 1161886121 19:6997188-6997210 GTGGTCGTTACCCACTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161886118 Original CRISPR CCACCATGGCACCACCTTAG TGG (reversed) Intergenic
No off target data available for this crispr