ID: 1161887046

View in Genome Browser
Species Human (GRCh38)
Location 19:7005159-7005181
Sequence TTTTCAACAACGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161887043_1161887046 -3 Left 1161887043 19:7005139-7005161 CCATGGTATCATCACATATTTTT 0: 1
1: 0
2: 2
3: 30
4: 400
Right 1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG 0: 1
1: 0
2: 2
3: 4
4: 104
1161887037_1161887046 23 Left 1161887037 19:7005113-7005135 CCTGCAGCCCAGGATCTGATAGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG 0: 1
1: 0
2: 2
3: 4
4: 104
1161887042_1161887046 1 Left 1161887042 19:7005135-7005157 CCGGCCATGGTATCATCACATAT 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG 0: 1
1: 0
2: 2
3: 4
4: 104
1161887039_1161887046 16 Left 1161887039 19:7005120-7005142 CCCAGGATCTGATAGCCGGCCAT 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG 0: 1
1: 0
2: 2
3: 4
4: 104
1161887040_1161887046 15 Left 1161887040 19:7005121-7005143 CCAGGATCTGATAGCCGGCCATG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG 0: 1
1: 0
2: 2
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161887046 Original CRISPR TTTTCAACAACGATGGGACA TGG Intergenic
905988022 1:42305560-42305582 TTTTCAACATGGATGGAACTGGG + Intronic
908170491 1:61499879-61499901 TTTTCTACAAAGAAGGGAAATGG - Intergenic
910488792 1:87745653-87745675 TTTTCAAATATGATGGAACAAGG + Intergenic
911265012 1:95733199-95733221 TTTTAAACAGTCATGGGACAGGG - Intergenic
912630215 1:111240319-111240341 TTGGCAACAAGAATGGGACATGG + Intronic
913018049 1:114759098-114759120 TTTTGAACAGAAATGGGACACGG - Intergenic
919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG + Intronic
921221474 1:212976990-212977012 TTTTCAAAAACGATGAGAAGTGG + Intronic
922135083 1:222816929-222816951 TTCTCAAAAACCATGGGAAAAGG - Intergenic
1063172170 10:3518585-3518607 CTTTAAAAAAAGATGGGACAGGG - Intergenic
1064306502 10:14171988-14172010 ATTTCAACAACATTTGGACAGGG + Intronic
1064431786 10:15277647-15277669 TTCTCAACCACTATGAGACATGG + Intronic
1066062233 10:31734552-31734574 TTTTCTCCAAGAATGGGACATGG - Intergenic
1071290067 10:84182169-84182191 TTTTCAGCAACGATGATACCAGG + Intronic
1074173653 10:110973008-110973030 TTTTCTGCAACTAAGGGACATGG - Intronic
1074471585 10:113732040-113732062 TTCTCAACAACGATGAGAATTGG - Intergenic
1074992571 10:118723276-118723298 TTTTCAACTATAATGTGACAAGG - Intronic
1076545390 10:131242069-131242091 TTTTCAACACCGAAGGGATCTGG + Intronic
1080689117 11:34541207-34541229 GTTTCAACAACGATAGAATAAGG + Intergenic
1086816690 11:91380772-91380794 TTATAAACTACTATGGGACAAGG - Intergenic
1090102208 11:123810886-123810908 TTTTCAACAGGGAAAGGACAGGG - Intergenic
1093247595 12:16759564-16759586 TTTTCAACAAAGATTGGTGAAGG - Intergenic
1095134331 12:38580741-38580763 TTTTCAGCAAGTATGGAACATGG + Intergenic
1097063403 12:56302341-56302363 TTCTCAACACTGATGGGACCTGG + Intronic
1097443324 12:59638280-59638302 TCTTCAAGAAAGAAGGGACAGGG + Intronic
1101835204 12:108290126-108290148 TTTTCAAAAATGATGCAACATGG - Exonic
1106764393 13:32899437-32899459 TTTTCAACAAAGAGGAGAAAAGG - Intergenic
1111821113 13:93216158-93216180 TTTTTAGCTAGGATGGGACAAGG - Intergenic
1112960722 13:105121935-105121957 TTCTCAACAACGATGGTAACAGG + Intergenic
1129577367 15:76764501-76764523 TTGACAACAACTGTGGGACAGGG + Intronic
1137930678 16:52584366-52584388 TTTTCATCAAGGCCGGGACAAGG - Intergenic
1143782300 17:9235391-9235413 TCTTCAACAACGCTGGAACAGGG - Intronic
1144168187 17:12632953-12632975 TTTTCAACAGCGATGAGACAAGG - Intergenic
1146482159 17:33213477-33213499 CTTGCAACAATGATGAGACAAGG + Intronic
1146621563 17:34402392-34402414 TTTTGAAAAACCAAGGGACAAGG + Intergenic
1146628839 17:34455603-34455625 TTTTAAGCAAAGAAGGGACATGG + Intergenic
1153820759 18:8829419-8829441 TTTTCAACAACCATACCACAAGG + Intronic
1159748216 18:72266619-72266641 TTTTCAACAAAAATGTGAAATGG - Intergenic
1160155454 18:76430199-76430221 TTTTCAAAAATGATGGAAGATGG - Intronic
1161570301 19:5026911-5026933 TCTTCTACAAGGATGGGGCAGGG + Intronic
1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG + Intergenic
1162323114 19:9981822-9981844 CTTTCAATATCGATGAGACAGGG - Intronic
1163122089 19:15224054-15224076 TTTTCAGCAGGGAAGGGACATGG - Intergenic
1164705419 19:30315708-30315730 TTTTCTCCATCGATGGGAGAAGG - Intronic
1165149544 19:33752943-33752965 TGTTCAACAAAGATGGGCAAAGG + Intronic
925479609 2:4255490-4255512 TTTTCAACAACACTGTGAGAGGG + Intergenic
930520212 2:52456476-52456498 TTTTCAACAAGGAAGGGAACAGG - Intergenic
942259297 2:174141650-174141672 TTTTAAACAACCAAGGGCCATGG - Intronic
944478048 2:200126985-200127007 TTTTCAACAGAGATGGCAGATGG + Intergenic
945017266 2:205532312-205532334 TGTTCAAAAATGATGGGACTAGG - Intronic
945083712 2:206110509-206110531 TGTTCTACAACAATGGGGCAAGG + Intergenic
947051654 2:226051129-226051151 TCTTCAACAGAGATGGGACAAGG - Intergenic
1174800036 20:53555783-53555805 ATTTCAACAAGGAGGGGACCAGG + Intergenic
1175425308 20:58861280-58861302 TTTTCAAGAGAGAAGGGACAGGG + Intronic
1176887030 21:14269381-14269403 TTTAGAACAACAAGGGGACATGG - Intergenic
1181880407 22:25974962-25974984 TTTTCTCCAACTCTGGGACATGG - Intronic
1182025878 22:27118802-27118824 TTTTCAACAAGGAAGCCACAAGG + Intergenic
1183373635 22:37449605-37449627 TTTTCAGCATCGAGGGGAGAGGG + Intergenic
1183843180 22:40517536-40517558 TTTGCAACAACTATGTGAGATGG - Intronic
949281339 3:2351422-2351444 TCTTCCTCAAAGATGGGACAAGG + Intronic
955085905 3:55702677-55702699 TTTGTAACAAGGATTGGACAGGG + Intronic
957588837 3:82169236-82169258 TTTTCACCAACAATGTGCCAGGG - Intergenic
961690169 3:128663743-128663765 TTTTCAACAATGATGGGGGCAGG - Intronic
966479050 3:180384481-180384503 TCATCAACAACTATGTGACAAGG + Intergenic
966597917 3:181742698-181742720 TTTTCAACAGAGCTGGGAAAAGG - Intergenic
967433078 3:189411097-189411119 TTTTCAACTATCATAGGACATGG - Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
980710665 4:136562791-136562813 TTTTCAAGAAAGAGGGGATAAGG - Intergenic
987996678 5:25291197-25291219 TTTTCAACAACAGTGGAAAATGG + Intergenic
990631038 5:57669390-57669412 TTTTTAAAAACTATAGGACAGGG - Intergenic
994361276 5:98851433-98851455 TTTTTAAAAATGATGGGGCAGGG + Intergenic
995399685 5:111726884-111726906 TTTTCACCAACAAAGGGCCAGGG - Intronic
996985945 5:129564666-129564688 TGTTCATCACTGATGGGACAAGG - Intronic
997863866 5:137443872-137443894 TTTTAAACAACGAAGGGACAGGG - Intronic
998156159 5:139788289-139788311 TTTTCCAAAATGAAGGGACACGG - Intergenic
998321058 5:141232030-141232052 TTTTCAAAAGCCATGGGAAAAGG + Intergenic
998834151 5:146187884-146187906 TTTTAAGCAAGGAAGGGACATGG + Intergenic
1003306490 6:4933615-4933637 TTTTAAACAAAGATGGGAGAAGG + Intronic
1005253906 6:23979223-23979245 TTTTAAACAAAAATGGGACTAGG + Intergenic
1008662377 6:53681640-53681662 GTTTCACCAACAATGAGACAAGG + Intergenic
1009806873 6:68610491-68610513 TTTTCAAAAATGAAGGGGCAAGG + Intergenic
1010571523 6:77478605-77478627 TTCTCAGCAAAGAGGGGACATGG - Intergenic
1011398388 6:86934697-86934719 ATTTCAACAACCCTGTGACATGG - Intergenic
1013039227 6:106417420-106417442 TTTTCAACAAGGCTGGGAATAGG - Intergenic
1014145716 6:117996000-117996022 ATTTCCACAAAGATGGGAAATGG - Intronic
1020668787 7:11080237-11080259 TTTTAAATAACGATGTGACAGGG - Intronic
1021994944 7:26170190-26170212 TTTTCAAGACTGATGTGACATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1028808201 7:95053578-95053600 TTTTGAACTATGATGGGAGAGGG + Intronic
1028821981 7:95222421-95222443 TCCTCAACAACTATGGGATATGG - Intronic
1029819373 7:103131242-103131264 TTTTAAACAATGAAGGGATAAGG + Intronic
1030081857 7:105785138-105785160 TTTTCAACAGCCCTGTGACATGG - Intronic
1033890811 7:146011068-146011090 TTTTGAACAAAGAAGTGACAAGG - Intergenic
1034144090 7:148853047-148853069 TTTTCCACAAAGAGGGGAGAGGG + Intronic
1035887875 8:3311157-3311179 TTTTCCACAACTATAGGCCAAGG - Intronic
1036190729 8:6668331-6668353 TTTTTAATAACAATGGAACATGG + Intergenic
1045323341 8:101098385-101098407 ATTTCAACATCCATGGGAGATGG + Intergenic
1046294137 8:112198155-112198177 GGTTCCACAAAGATGGGACATGG - Intergenic
1046701875 8:117410032-117410054 TTTTCCACAACAAAAGGACAAGG - Intergenic
1048113192 8:131490118-131490140 TATTCAAAAACGATGGGGAAGGG + Intergenic
1048486988 8:134857484-134857506 TTATCAAATGCGATGGGACAAGG + Intergenic
1051214043 9:14777486-14777508 TTTCCAGCAACTATGGTACATGG - Intronic
1055793571 9:79949674-79949696 TTTTGAACAAGGGTGGTACAAGG - Intergenic
1056790468 9:89622164-89622186 TTTGCAACAATGATAGGAAATGG - Intergenic
1056900703 9:90596905-90596927 ATGTCAACAATGAAGGGACAAGG + Intergenic
1060228448 9:121810072-121810094 TTTTTAAAAACGATGGCAAAAGG + Intergenic
1187665701 X:21607306-21607328 TTTTCAGCAGCCATGGGACCTGG + Intronic
1188309518 X:28599445-28599467 TTTCCAACCACAATGGCACAGGG + Intronic
1196642406 X:118077418-118077440 TATTCAAAAACGAGGGAACATGG + Intronic
1197777334 X:130127170-130127192 TTTTAAACAGGGAGGGGACATGG + Intergenic
1201145885 Y:11065415-11065437 GTTCCAGCAACTATGGGACACGG + Intergenic