ID: 1161887737

View in Genome Browser
Species Human (GRCh38)
Location 19:7010058-7010080
Sequence TTCAGATTCTTACAGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161887737_1161887741 -7 Left 1161887737 19:7010058-7010080 CCAGTCCCCTGTAAGAATCTGAA No data
Right 1161887741 19:7010074-7010096 ATCTGAAATCCTCTATGCCCTGG No data
1161887737_1161887747 9 Left 1161887737 19:7010058-7010080 CCAGTCCCCTGTAAGAATCTGAA No data
Right 1161887747 19:7010090-7010112 GCCCTGGGGCTCTGCATCTGGGG No data
1161887737_1161887746 8 Left 1161887737 19:7010058-7010080 CCAGTCCCCTGTAAGAATCTGAA No data
Right 1161887746 19:7010089-7010111 TGCCCTGGGGCTCTGCATCTGGG No data
1161887737_1161887745 7 Left 1161887737 19:7010058-7010080 CCAGTCCCCTGTAAGAATCTGAA No data
Right 1161887745 19:7010088-7010110 ATGCCCTGGGGCTCTGCATCTGG No data
1161887737_1161887742 -6 Left 1161887737 19:7010058-7010080 CCAGTCCCCTGTAAGAATCTGAA No data
Right 1161887742 19:7010075-7010097 TCTGAAATCCTCTATGCCCTGGG No data
1161887737_1161887743 -5 Left 1161887737 19:7010058-7010080 CCAGTCCCCTGTAAGAATCTGAA No data
Right 1161887743 19:7010076-7010098 CTGAAATCCTCTATGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161887737 Original CRISPR TTCAGATTCTTACAGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr