ID: 1161888663

View in Genome Browser
Species Human (GRCh38)
Location 19:7017758-7017780
Sequence CCGGACCCCCAAGATGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161888663_1161888672 20 Left 1161888663 19:7017758-7017780 CCTTGAACATCTTGGGGGTCCGG No data
Right 1161888672 19:7017801-7017823 GCAGTTGAAAATCCGCATATAGG No data
1161888663_1161888674 25 Left 1161888663 19:7017758-7017780 CCTTGAACATCTTGGGGGTCCGG No data
Right 1161888674 19:7017806-7017828 TGAAAATCCGCATATAGGCCGGG No data
1161888663_1161888675 30 Left 1161888663 19:7017758-7017780 CCTTGAACATCTTGGGGGTCCGG No data
Right 1161888675 19:7017811-7017833 ATCCGCATATAGGCCGGGCACGG No data
1161888663_1161888673 24 Left 1161888663 19:7017758-7017780 CCTTGAACATCTTGGGGGTCCGG No data
Right 1161888673 19:7017805-7017827 TTGAAAATCCGCATATAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161888663 Original CRISPR CCGGACCCCCAAGATGTTCA AGG (reversed) Intergenic
No off target data available for this crispr