ID: 1161889178

View in Genome Browser
Species Human (GRCh38)
Location 19:7021746-7021768
Sequence ATGGAATTGTCGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161889169_1161889178 30 Left 1161889169 19:7021693-7021715 CCTTTTCCTCCCATTCTCTCAAA No data
Right 1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG No data
1161889171_1161889178 21 Left 1161889171 19:7021702-7021724 CCCATTCTCTCAAACATCTTTGA No data
Right 1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG No data
1161889172_1161889178 20 Left 1161889172 19:7021703-7021725 CCATTCTCTCAAACATCTTTGAA No data
Right 1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG No data
1161889170_1161889178 24 Left 1161889170 19:7021699-7021721 CCTCCCATTCTCTCAAACATCTT No data
Right 1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161889178 Original CRISPR ATGGAATTGTCGGCCGGGTG CGG Intergenic
No off target data available for this crispr