ID: 1161892274

View in Genome Browser
Species Human (GRCh38)
Location 19:7049003-7049025
Sequence ATGGAATTGTCGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161892274_1161892283 30 Left 1161892274 19:7049003-7049025 CCGCACCCGGCCGACAATTCCAT No data
Right 1161892283 19:7049056-7049078 TTTGAGAGAATGGGAGGAAAAGG No data
1161892274_1161892282 24 Left 1161892274 19:7049003-7049025 CCGCACCCGGCCGACAATTCCAT No data
Right 1161892282 19:7049050-7049072 AAGATGTTTGAGAGAATGGGAGG No data
1161892274_1161892281 21 Left 1161892274 19:7049003-7049025 CCGCACCCGGCCGACAATTCCAT No data
Right 1161892281 19:7049047-7049069 TCAAAGATGTTTGAGAGAATGGG No data
1161892274_1161892280 20 Left 1161892274 19:7049003-7049025 CCGCACCCGGCCGACAATTCCAT No data
Right 1161892280 19:7049046-7049068 TTCAAAGATGTTTGAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161892274 Original CRISPR ATGGAATTGTCGGCCGGGTG CGG (reversed) Intergenic
No off target data available for this crispr