ID: 1161894467

View in Genome Browser
Species Human (GRCh38)
Location 19:7069818-7069840
Sequence GCGGAAACCCGGCTCCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161894467_1161894473 -8 Left 1161894467 19:7069818-7069840 CCTCCCGGGAGCCGGGTTTCCGC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1161894473 19:7069833-7069855 GTTTCCGCCCCTGAGGCCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1161894467_1161894472 -9 Left 1161894467 19:7069818-7069840 CCTCCCGGGAGCCGGGTTTCCGC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1161894472 19:7069832-7069854 GGTTTCCGCCCCTGAGGCCTCGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161894467 Original CRISPR GCGGAAACCCGGCTCCCGGG AGG (reversed) Intronic