ID: 1161894560

View in Genome Browser
Species Human (GRCh38)
Location 19:7070349-7070371
Sequence CATTTTAGGGACCAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161894553_1161894560 30 Left 1161894553 19:7070296-7070318 CCAGCCAAATGAGTTAAGCAAGT 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1161894554_1161894560 26 Left 1161894554 19:7070300-7070322 CCAAATGAGTTAAGCAAGTCAGA 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161894560 Original CRISPR CATTTTAGGGACCAGATGGC TGG Intronic
900775856 1:4585113-4585135 CATTTTAGGGAGAAGAAGGGGGG + Intergenic
900966784 1:5964334-5964356 CTTTAAAGGAACCAGATGGCAGG + Intronic
905877731 1:41443670-41443692 CATTTTGGGAGCCAGATGGGTGG - Intergenic
907049142 1:51317987-51318009 CCTTTCAGGGACCATGTGGCAGG + Intronic
911769866 1:101726572-101726594 CATTTTAGAAACTAAATGGCAGG + Intergenic
912402058 1:109402228-109402250 TATTTTAGGGACCTGCTGCCTGG - Intronic
913055492 1:115154982-115155004 CATTTTAGGTACCAGACCGTGGG + Intergenic
913244058 1:116856051-116856073 CATAATTGGGACCAGCTGGCAGG - Intergenic
913520570 1:119641652-119641674 CATGGAAGGGACCAGATGGGAGG + Intronic
914938109 1:151998291-151998313 CATTTCAGAGACCACATGGATGG - Intergenic
916840439 1:168595148-168595170 CATTTTGGGGGTGAGATGGCTGG + Intergenic
920947665 1:210544847-210544869 CATTACATGCACCAGATGGCAGG + Intronic
1062819550 10:523925-523947 CATTTTAGGAACCTGAGGGGTGG + Intronic
1065115437 10:22478666-22478688 CATTTTGGTGGGCAGATGGCAGG + Intergenic
1066616761 10:37302667-37302689 AATTTTAGAGACCAAATGGTTGG - Intronic
1068941240 10:62683360-62683382 CAGTTTTGGGACCAGATGGTTGG - Intergenic
1069870831 10:71532006-71532028 CATTTTTGGGAGGAGCTGGCTGG - Intronic
1070046830 10:72846771-72846793 CCCTTTAGGGTCCAGATGGAGGG + Intronic
1071873324 10:89818229-89818251 CATTTGAGGGACCCTATGGGAGG - Intergenic
1074789186 10:116869103-116869125 CCTTTGGGGGACCAGATGGAAGG - Intronic
1078343495 11:10520943-10520965 CATTGTAAGGCCCTGATGGCAGG - Intronic
1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG + Intronic
1078765165 11:14289564-14289586 ATCTTAAGGGACCAGATGGCTGG + Intronic
1079038582 11:17041967-17041989 GATTTTAGGAACAAGATCGCAGG + Intergenic
1083117969 11:60482624-60482646 CATATTAGGGAACAGAGGGGAGG - Intergenic
1085896750 11:80648923-80648945 CATTTAAGGCATCAGATGGAAGG + Intergenic
1086118515 11:83281387-83281409 GATTTTATGGACTAGAAGGCAGG + Intronic
1091092047 11:132780518-132780540 CATTTTTGAAAGCAGATGGCAGG + Intronic
1091111914 11:132977592-132977614 CAATTCAAGGACCAGATGACAGG - Intronic
1091770050 12:3145693-3145715 CATTTTTCTGTCCAGATGGCTGG + Intronic
1094161493 12:27395614-27395636 CATTTTAGGAACCCCATGGAAGG - Intronic
1096079235 12:48822818-48822840 AATCTTAGGGGGCAGATGGCTGG + Intronic
1100564786 12:95785195-95785217 AGTTTTAGTAACCAGATGGCAGG - Intronic
1104001986 12:124865665-124865687 CACTTCAGGGACCAGAAGGCAGG - Intronic
1107435654 13:40378385-40378407 CATTTAAATGACCAGATTGCAGG - Intergenic
1107474352 13:40720875-40720897 CATGTGAGGGACCCGATGGGAGG + Intergenic
1110014898 13:70387597-70387619 CATTTTTGGGAGAAGATGACAGG + Intergenic
1110642036 13:77836365-77836387 CAATGTAGGGTCCAGATTGCTGG + Intergenic
1110774129 13:79386786-79386808 CATTTTAGTAACCAGAGGGATGG - Intronic
1111036294 13:82678364-82678386 CATGTAAGGGACAAGATGGAAGG - Intergenic
1111208937 13:85050895-85050917 CATTTTAGGAAACAGACTGCTGG - Intergenic
1111403907 13:87777356-87777378 CATTTTGGGGAAGAGAAGGCGGG - Intergenic
1111683683 13:91475673-91475695 CATTTTGGGGCCCAGATGAAGGG + Intronic
1114716596 14:24832636-24832658 GATTTTAATGACCAGTTGGCAGG - Intronic
1114821306 14:26022644-26022666 CATTTTAGTCACCAAATGACTGG + Intergenic
1116286801 14:42984963-42984985 CATTTGAGGGACCTGGTGGGAGG - Intergenic
1116352284 14:43878308-43878330 CCTTTTAGGGCTGAGATGGCTGG + Intergenic
1120912277 14:89678032-89678054 CATGGGAGGGACCAGATGGGAGG + Intergenic
1122142623 14:99671953-99671975 CATTTCAGGAATCAGACGGCAGG + Intronic
1125034218 15:35105352-35105374 CAATTTTGCGACTAGATGGCAGG + Intergenic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1128373647 15:67059696-67059718 CAGCTTAGGGAACAGAGGGCAGG - Intergenic
1131190053 15:90307604-90307626 CATTTTAGGGAACACTTGGATGG + Intronic
1131418699 15:92284815-92284837 AATTGTAGAAACCAGATGGCAGG + Intergenic
1131884863 15:96901470-96901492 TTTATTAGGGACCAAATGGCGGG - Intergenic
1133522126 16:6568717-6568739 CATTTCAGGGGCCAGTTGGGTGG + Intronic
1134268418 16:12711781-12711803 CATTTTAGGGTCTAGAAGACAGG - Intronic
1135669875 16:24366116-24366138 CATTTGAGGGACCAAATTTCTGG + Intergenic
1136476539 16:30517142-30517164 CATTTGAGGGTACAGAGGGCAGG + Intronic
1143156257 17:4838565-4838587 CATTTAGGGGACATGATGGCAGG + Intronic
1146379027 17:32314882-32314904 CATGCTAGGAAGCAGATGGCAGG - Intronic
1147219889 17:38922337-38922359 CATTTGAGGAACGAGATGACAGG + Intergenic
1147729561 17:42589873-42589895 CATTTTTAGGACCACATGGAAGG - Intronic
1149222673 17:54433556-54433578 TCTTTTAGGGACAACATGGCAGG - Intergenic
1159627364 18:70710177-70710199 CATTTTAGGCACCAGATGTAAGG - Intergenic
1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG + Intronic
1163334136 19:16660535-16660557 CATTTTAGAGCCCAGTTGGTTGG - Intergenic
1165227144 19:34362954-34362976 TATTTTGGTGACCAGATGGACGG - Intronic
1166496571 19:43307177-43307199 AATGTCAGGCACCAGATGGCAGG - Intergenic
1166913284 19:46176633-46176655 CATTTGAGAGCCCAGATGCCAGG + Intergenic
1167245238 19:48369209-48369231 CAGTTAAGGCACCAGCTGGCAGG - Intronic
928362399 2:30675975-30675997 CATGGGAGGGACCAGAGGGCAGG + Intergenic
931521763 2:63105904-63105926 CATTAGTGGGTCCAGATGGCTGG + Intergenic
934136455 2:89000665-89000687 TATTTTCCTGACCAGATGGCTGG + Intergenic
936933191 2:117811427-117811449 CATTGTAGAAAGCAGATGGCTGG - Intergenic
941863881 2:170313588-170313610 GATTCTAGGGTCCAGGTGGCTGG - Intronic
941988533 2:171531710-171531732 CATTTTAGAGACCAAATGTCTGG + Intronic
942771120 2:179521642-179521664 CTTTTTAGAGAGCAGATGGATGG - Intronic
946163430 2:217849419-217849441 CATTTTATGGACCAGGAGGCTGG - Intronic
946355326 2:219180985-219181007 CAGTTTAGGGACCAGTTGAATGG + Intronic
948642523 2:239384759-239384781 CATTTTAGGGATCAGAAGCAGGG - Intronic
948833383 2:240611917-240611939 CATTTTAGGGACCCAAATGCAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174048329 20:47749572-47749594 CTCTGTAGGGGCCAGATGGCTGG - Intronic
1178629852 21:34250007-34250029 CATTCTAGGGGCCAGACGGTGGG + Intergenic
1179020631 21:37637553-37637575 TGTTTCAGGGACCAGATGGTTGG - Intronic
1183116186 22:35694395-35694417 CATTTTAGGGACAATATCACAGG - Intergenic
1183117076 22:35700429-35700451 CATTTTAGGGACAATATCACAGG - Intergenic
957696959 3:83650925-83650947 CATGGGAGGGACCAGATGGGAGG - Intergenic
960697302 3:120408600-120408622 CATGTGAGGGAGTAGATGGCTGG + Intronic
966153993 3:176896319-176896341 CATGTTTGTGACCAGGTGGCTGG + Intergenic
968323104 3:197788866-197788888 AATTTTAGAGACCAGAGGGTGGG + Intergenic
968947691 4:3674286-3674308 CATTCTAGGGAGGAGATAGCCGG - Intergenic
970920302 4:21386330-21386352 CAATTTAGAGGCCAGATGACTGG - Intronic
975664245 4:76719102-76719124 CTTTTTAGGGAGAAGATGTCTGG - Intronic
980279669 4:130703531-130703553 CCTTTGTGGGACCAGATAGCAGG + Intergenic
985561116 5:586564-586586 CATTTGAGGGAGCAGTTAGCAGG + Intergenic
988850775 5:35178501-35178523 CATTATAGGGAAGAGATGGTTGG + Intronic
989042678 5:37245591-37245613 CATTTTTGGAAACAGATGCCTGG - Exonic
990533003 5:56692850-56692872 CATCTTGGGAACCAGACGGCTGG - Intergenic
996669271 5:126098147-126098169 CATTTCAGGAATCAGCTGGCTGG - Intergenic
997686010 5:135788514-135788536 GATATTACGGACCATATGGCGGG - Intergenic
997686099 5:135788827-135788849 GATATTACGGACCATATGGCAGG - Intergenic
998531272 5:142887240-142887262 CAGTGTAGGGACCAGAACGCTGG + Intronic
998934999 5:147225792-147225814 CATTTTTGGGACCAGATCCTAGG - Intergenic
1000643904 5:163738233-163738255 GCTTTTAGGCTCCAGATGGCAGG + Intergenic
1004082151 6:12405301-12405323 CATTTTGGGGCCCACATGGTAGG + Intergenic
1008070077 6:47090733-47090755 CATTTTGTAGACCAGAAGGCAGG - Intergenic
1012230072 6:96750775-96750797 GATTCTAGGGACCAAATGGAGGG - Intergenic
1013240781 6:108243683-108243705 CATTTTAGGAAGCCGAGGGCGGG + Intronic
1016788795 6:148044113-148044135 CATTCTAGGGACAAGATAACTGG - Intergenic
1023062244 7:36339341-36339363 CAGTTTTGGGACCAGAAGCCAGG - Intronic
1026623497 7:71972143-71972165 CATATCAGGGTCCAGATGTCTGG - Intronic
1033459064 7:141529044-141529066 CATTTTAGAGGCCAGAAGTCAGG + Intergenic
1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG + Intronic
1039132554 8:34283855-34283877 AATTTTGGGGACCAGGTGGGGGG - Intergenic
1039635810 8:39163427-39163449 TAGTGTAGGGACCAGATTGCTGG + Intronic
1040722542 8:50343930-50343952 CAATTTAGGAATAAGATGGCTGG + Intronic
1041130977 8:54699840-54699862 CCTTTTAGGGACCATATTGTTGG + Intergenic
1044233038 8:89800960-89800982 CATTTTAGGAAGCAGATAGAAGG - Intergenic
1045356559 8:101394677-101394699 CATTTTGGTGACCAGAAGGGTGG + Intergenic
1050028639 9:1362306-1362328 CATTTTAGGGATCTGATGAAAGG - Intergenic
1052375210 9:27711557-27711579 CATCTTAGGGACAAGAGGACTGG + Intergenic
1053476298 9:38384413-38384435 CATTCTAGGGATCAGAAGGCGGG - Intergenic
1055538239 9:77271700-77271722 CATTTTAGGGAATAGAACGCAGG + Intronic
1056291054 9:85144282-85144304 CACTTTGGAGACCACATGGCCGG - Intergenic
1056331808 9:85527453-85527475 CATTGGAGAGAGCAGATGGCTGG - Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1061491686 9:130948323-130948345 CATTTGAAGGACCACATGGGAGG + Intergenic
1186540247 X:10393034-10393056 GATTTGAGGGACCTGATGGGAGG - Intergenic