ID: 1161895929

View in Genome Browser
Species Human (GRCh38)
Location 19:7080297-7080319
Sequence CCTTCTTTTCCCCCACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161895929 Original CRISPR CCTTCTTTTCCCCCACAAGA TGG (reversed) Intronic
901809160 1:11756596-11756618 TCTTTTTTTCCCCCCCGAGATGG - Intergenic
901936672 1:12631516-12631538 CCTTCTCTTCACCCACAGCATGG - Intergenic
902245839 1:15119901-15119923 CCTTCTTTACCCTCAGGAGATGG - Intergenic
904654681 1:32035514-32035536 CTTTTCTTTCCTCCACAAGAGGG - Intronic
905101827 1:35531000-35531022 CCCTCTTGTCTCCCACAAGTAGG - Intronic
907883780 1:58575308-58575330 CTTTTTTTTCCCCCAGAAGTGGG - Intergenic
910210577 1:84788710-84788732 CCTTCTTTTCCCCCAGCTAAGGG + Intergenic
910528612 1:88210227-88210249 CCTTCTCTTCCCCCAGCAGATGG + Intergenic
910573946 1:88737440-88737462 CCTCTTTTTCCCCCAGTAGATGG + Intronic
910602067 1:89043024-89043046 CCTTCTTGTTGCCCACAACATGG + Intergenic
911134180 1:94421630-94421652 GTTTCTTTTCCCTAACAAGAAGG - Intronic
911621912 1:100074573-100074595 CTTTCTTTTTCCCCCCGAGATGG - Intronic
912013664 1:105005020-105005042 CCTTCTTATCGCCTGCAAGATGG + Intergenic
913320744 1:117586896-117586918 CCTTCTTGTCCACAACAGGATGG - Intergenic
915185034 1:154098319-154098341 CCTTCTCTTCACCCACAACGTGG + Intronic
915318854 1:155044943-155044965 CCTTCCTTCCCTCCACAAGCTGG - Intronic
917671271 1:177275814-177275836 CCTTGTTTTCTCACCCAAGAGGG + Intronic
919264069 1:195238254-195238276 CCTTCTCATCACCCACAACATGG - Intergenic
921761026 1:218915122-218915144 CTTTTTTTTTCCCCCCAAGATGG - Intergenic
922572624 1:226642957-226642979 CCTGCCTTTCCCCCACAATACGG - Intronic
923204901 1:231749733-231749755 TCTTCTTTGCACCAACAAGATGG - Intronic
1063690988 10:8286802-8286824 TCTCTTTTGCCCCCACAAGAAGG - Intergenic
1064027151 10:11857936-11857958 TTTTTTTTTCCCCCCCAAGATGG + Intronic
1064761186 10:18622703-18622725 CCATCTTTTTCCCCCCAAGGCGG - Intronic
1065407948 10:25389670-25389692 CCTTCTTGTCACCCACAATATGG - Intronic
1067929160 10:50542134-50542156 GTTTCTTTTCCCCCATGAGAAGG - Intronic
1068279819 10:54854315-54854337 CCTTCTCTTCACCCACAATATGG + Intronic
1068300398 10:55131434-55131456 CCTTCTTGTCACCCACAACGTGG + Intronic
1068348531 10:55814216-55814238 TCTTCTTGTCACCCACAACATGG - Intergenic
1069156334 10:65035156-65035178 CCTTCTTGTCACCCACAATGTGG - Intergenic
1069440238 10:68421816-68421838 CTTTTTTTTTCCCCCCAAGATGG + Intronic
1071021403 10:81061212-81061234 CCTTCCTTCCCTCCCCAAGAAGG - Intergenic
1071166726 10:82816150-82816172 CCTTCTTGTCACCCACAATGTGG + Intronic
1071313344 10:84365598-84365620 TATTCTTTTCCCCCACAAACTGG + Intronic
1071723405 10:88170183-88170205 CCTTTTTTTCCCCCAACAAATGG - Intergenic
1071921575 10:90356584-90356606 CTTTCTTTCCCCCTGCAAGAAGG + Intergenic
1071970129 10:90896678-90896700 CCTTCTTCTCCCTCACCAGAAGG + Intronic
1072420249 10:95285084-95285106 CCCTCCTATCCCCCACAAGCAGG + Intronic
1072587895 10:96798855-96798877 CCTTCTGTTCTCCCTAAAGAGGG + Intergenic
1072663779 10:97379716-97379738 CCCTCATTTCCCCCACACGGCGG - Exonic
1072871230 10:99123523-99123545 CCTTCTTGTTGCCCACAACAAGG + Intronic
1073055053 10:100694603-100694625 CTTTTTTTTTCCCCCCAAGACGG + Intergenic
1073580910 10:104664804-104664826 CCATCTCTTCCACCACATGAGGG - Intronic
1074035373 10:109733280-109733302 CTTTTTTTTCCCCCCCAAGATGG + Intergenic
1074955175 10:118381661-118381683 ACTTTTTTTCCCCCACATGCTGG - Intergenic
1075216710 10:120542826-120542848 CCATCTTTTGCCCCACAATCAGG - Intronic
1075632505 10:124009700-124009722 CCTTTTTTTCCCCCTAGAGATGG - Exonic
1076379831 10:130017337-130017359 CAGACTTTTCCCCCACAAAATGG - Intergenic
1078059366 11:8033330-8033352 CCTGCTGTGCCGCCACAAGATGG + Intronic
1078631407 11:13007994-13008016 CCTTCCTTGCCCCTCCAAGATGG + Intergenic
1078874381 11:15378805-15378827 CCTTCTTGTCACCCACAACATGG - Intergenic
1080165684 11:29233422-29233444 TTTTCTTTTCCCCAACAATAAGG + Intergenic
1080191227 11:29551715-29551737 CCGTCTTTTCCCCCAGAATATGG + Intergenic
1080629320 11:34058944-34058966 CATTCATTTCCCCCAGAAAAAGG - Intronic
1081538004 11:44009320-44009342 CCTTCTCTACCCACACAGGAGGG + Intergenic
1082078946 11:47997044-47997066 ACTTCTTTTCCTCCAGAACATGG + Intronic
1082750036 11:57005519-57005541 CCTTCTCTTCACCCACAACATGG + Intergenic
1082783634 11:57304536-57304558 CCTTCTTTTGCCCCACCCCAGGG - Intronic
1083906480 11:65675184-65675206 TTTTTTTTTCCCCCACAAGACGG + Intergenic
1085064151 11:73476577-73476599 CCTGTTTTTCCCCCACAAATGGG - Intronic
1085100682 11:73797392-73797414 CCTTCTCTTCACCCACAACCTGG - Intronic
1088187844 11:107193318-107193340 CCTTATTTACCTCCAAAAGAAGG + Intergenic
1089127132 11:116184568-116184590 CCTTCTTTTCCCCCATCATTTGG + Intergenic
1091155319 11:133366575-133366597 CCTTCTTCTCCCCATCATGAAGG - Intronic
1091382197 12:69078-69100 TGGTCTTTTCCCCCACATGAGGG + Intronic
1092271966 12:7030701-7030723 CCTTCTTGTCACCCACAATGTGG + Intronic
1093504604 12:19850498-19850520 CCTTGTTTTCACACACATGAAGG - Intergenic
1093742675 12:22706337-22706359 CCTTCTTTTCTCCATGAAGAAGG + Intergenic
1094323643 12:29212688-29212710 CATCCTTTTCCCCCATAAAACGG + Intronic
1095444009 12:42267171-42267193 CCTTCTTGTCGCCCACAACGTGG + Intronic
1095780126 12:46049651-46049673 CCTTCTTTTCTCCCAATAGCAGG - Intergenic
1095976375 12:47943217-47943239 CCTTCCTTTCCTCCTCAGGAGGG - Intergenic
1096222607 12:49841260-49841282 CCTCCTTTTCCCCCACACAGTGG - Intronic
1096631262 12:52928092-52928114 CCTTCTTTTCCCCAGCACAAAGG - Intronic
1097417461 12:59329287-59329309 AATTTTTTTCTCCCACAAGATGG - Intergenic
1097491920 12:60281976-60281998 CCTTCTTGTCACCCACAACCTGG + Intergenic
1097572840 12:61355574-61355596 CCTTCTCTTCACCCACAATGTGG + Intergenic
1098135156 12:67394354-67394376 TTTTTTTTTCCCCCAGAAGAAGG + Intergenic
1098539534 12:71638940-71638962 CTTTCTTTTGCTCCACAAGAAGG - Intronic
1098597769 12:72294158-72294180 CCTTCTCTTTTCCCACAACATGG + Intronic
1098802920 12:74985064-74985086 CCTTCTTGTCACCCACAACATGG + Intergenic
1100366453 12:93925361-93925383 CCTTCCTTTCTCCCCCAAGTTGG + Intergenic
1100672746 12:96834729-96834751 CCTTCTTTTCTCCTGCAACATGG + Intronic
1103000656 12:117383197-117383219 CTTTCTCATCCCCCACAAAAGGG - Intronic
1103111015 12:118278292-118278314 CCTTCTTTCCACCCTCAAGTAGG + Intronic
1105541114 13:21318306-21318328 CCTTCATTTTCTCCACAAAATGG + Intergenic
1105723713 13:23140977-23140999 CCTTCATTTCCCCCCTCAGATGG + Intergenic
1106185509 13:27406456-27406478 TCTTTTTTTCCACCACAAGATGG + Intergenic
1106321162 13:28640588-28640610 CCTTCATTTCCTCCACAGCATGG + Intergenic
1106759236 13:32851403-32851425 CCTTCTTTTTCCCCATATGATGG + Intergenic
1106779106 13:33038784-33038806 TCATTTTTTCCCCCACAGGATGG - Intronic
1106999517 13:35527047-35527069 CCTTCTTATCTCCCACAACATGG + Intronic
1107679913 13:42837409-42837431 CCTTCTCATCCTCCAAAAGAGGG - Intergenic
1107799894 13:44095825-44095847 CCTCCTTCTCCCCCACAATCTGG - Intergenic
1108016944 13:46086212-46086234 CCTTCTTGTCACCCACAACGTGG + Intronic
1108510263 13:51149074-51149096 CCTTCTTGTGCTCCACAAGAAGG + Intergenic
1110420257 13:75299570-75299592 CCTTCTTTTCCTCTGCAGGAAGG - Exonic
1111485763 13:88896391-88896413 CCTTCTTGTCACCCACAATATGG - Intergenic
1111505776 13:89186113-89186135 TCTTCTCTTCACCCACAAGGTGG - Intergenic
1111595607 13:90405759-90405781 GCTTCTTTTCCACCAGAAAATGG - Intergenic
1112304086 13:98257763-98257785 TTTTCTTTTCCCCCTCAAGATGG - Intronic
1113244117 13:108376292-108376314 CCTTATTTTCCCCCAAACAAAGG + Intergenic
1113341071 13:109426522-109426544 CCTTCCTTCCCCCCACATCATGG + Intergenic
1113858256 13:113461737-113461759 CCCTCTTTTCCCACACGGGAAGG + Intronic
1114271249 14:21101642-21101664 GTATGTTTTCCCCCACAAGATGG - Intronic
1114948735 14:27719617-27719639 CTTTTTTTTCCCCTACAGGAAGG + Intergenic
1115208604 14:30941628-30941650 CTTTTTTTTTCCCCCCAAGATGG + Intronic
1115773156 14:36687378-36687400 CCTTCTTCTCACCCCCGAGATGG - Intronic
1116159692 14:41253190-41253212 CCTTCTTGTCACCGACAATATGG + Intergenic
1116520216 14:45837300-45837322 GCTTTTTTTCCCCCAGAATAAGG + Intergenic
1118095193 14:62528743-62528765 ACTTCTTTGCCCCCACATAAAGG + Intergenic
1118317911 14:64737019-64737041 CCTCCATTCCCCCCAGAAGAGGG + Intronic
1118371630 14:65142031-65142053 CCTTCGTTTCCTCCACAAGGTGG + Intergenic
1119823583 14:77639392-77639414 CCTTCTTGCCCCCAGCAAGAAGG + Intergenic
1120182004 14:81353576-81353598 CCTCCCCTTCCCCCACAAGTCGG + Intronic
1120566326 14:86062919-86062941 TCTTGTTTTCCCACACTAGAGGG + Intergenic
1121824579 14:97000038-97000060 CCTTCTCTTCACTCACAACATGG + Intergenic
1121851412 14:97224366-97224388 CCTTCTTTCCCCAAACAAGGAGG - Intergenic
1122830618 14:104393843-104393865 CCTCAGTTTCCCCCACTAGAAGG - Intergenic
1123215698 14:106807459-106807481 CCTTCTTTTCCTTCACAGCATGG - Intergenic
1124366114 15:29072640-29072662 CCATCCTTCCCCCTACAAGAGGG - Intronic
1125381516 15:39091925-39091947 CCTTCTCTTCACCCACAACGTGG + Intergenic
1126193029 15:45898866-45898888 ACCTCTCTTCACCCACAAGAGGG - Intergenic
1126235078 15:46374202-46374224 GCTTTTTTTCCCCCTCAAAAAGG - Intergenic
1126316612 15:47376751-47376773 ACATATTTTACCCCACAAGAAGG - Intronic
1127525838 15:59791509-59791531 CCTTCTCTTCACCCACAAAATGG + Intergenic
1127629508 15:60813947-60813969 CCTTGTTCTCCCCCATAACATGG - Intronic
1127649399 15:60992510-60992532 TCTTCCTATCCCCCACAAGTGGG + Intronic
1127925864 15:63540606-63540628 ACTTCATTTCCCTCCCAAGATGG + Intronic
1129639170 15:77356102-77356124 CATTCTTATCCCTCACCAGAGGG - Intronic
1130227750 15:82072753-82072775 CCTTCTCTTCACCCACAATGTGG + Intergenic
1130804291 15:87302431-87302453 CCTTCTTTTGCAGCTCAAGATGG - Intergenic
1131865493 15:96704289-96704311 CCTTCTTTTCCACAATAAAAAGG - Intergenic
1132305395 15:100808206-100808228 CCTTCTCTTCACCCACAATGTGG - Intergenic
1132347424 15:101116675-101116697 CCTTTTTTTCCTACAGAAGATGG - Intergenic
1132490017 16:222996-223018 TATTTTTTTCCCCCTCAAGATGG - Intronic
1133771726 16:8870322-8870344 ACTTTTTTTCCCCCCCGAGACGG - Intergenic
1134078362 16:11308119-11308141 CCTTCTCTTCACCCACAATATGG + Intronic
1136032750 16:27515488-27515510 CCTTCTTCTCCCCACCAAGTTGG + Intronic
1136383939 16:29911219-29911241 CCCTCTGTACCCCCAGAAGACGG + Intronic
1136705662 16:32186084-32186106 GCTTCTTTTTCCTCTCAAGAGGG - Intergenic
1136762251 16:32743323-32743345 GCTTCTTTTTCCTCTCAAGAGGG + Intergenic
1136805848 16:33127063-33127085 GCTTCTTTTTCCTCTCAAGAGGG - Intergenic
1137600121 16:49750681-49750703 CTGTCTTTTTCCCCACTAGAGGG - Intronic
1139157846 16:64465745-64465767 CCTTTTTTTGACCCTCAAGATGG - Intergenic
1139318761 16:66095906-66095928 CCTTCTTTTATTCAACAAGAAGG + Intergenic
1139630572 16:68229745-68229767 CCTCCCTATCCCCTACAAGAGGG + Exonic
1140194431 16:72845071-72845093 CCCTCTTTTCCGCCACACGGAGG - Intronic
1141302478 16:82830089-82830111 CTTTTTTTTCCCCCAGATGAGGG + Intronic
1141374383 16:83516847-83516869 CCTTGCTTTCCCCAACAAGGTGG - Intronic
1141657844 16:85425492-85425514 CCCTTTTTGCCACCACAAGATGG - Intergenic
1203064408 16_KI270728v1_random:1003642-1003664 GCTTCTTTTTCCTCTCAAGAGGG + Intergenic
1143266429 17:5641515-5641537 TTTTTTTTTCCCCCCCAAGACGG - Intergenic
1144828052 17:18117543-18117565 CCTCCTCTTCCTCCTCAAGATGG - Intronic
1146627531 17:34445641-34445663 CCTTCTCTGCACCCTCAAGAGGG + Intergenic
1148727557 17:49805176-49805198 CATTCTTTTCTTCCACAGGATGG - Intronic
1148790407 17:50169456-50169478 TCTACCTTTCCCCCACAAGAGGG + Intronic
1149329927 17:55570285-55570307 CCTTCTCTTCACCCACAACGTGG - Intergenic
1149990497 17:61380618-61380640 GCTTCTTTTGTCCCTCAAGAGGG + Intronic
1152246206 17:79185901-79185923 GCTTGGTTTCCCCCACTAGACGG - Intronic
1153420228 18:4897001-4897023 CCTTCATATCCCCCATAAGTTGG - Intergenic
1153427911 18:4987132-4987154 CCTTCTTGTCACCCACAACATGG + Intergenic
1154346536 18:13547849-13547871 CCTTCTTGTCACCCACAACATGG + Intronic
1154357431 18:13632640-13632662 CCTTCTTGTCCCCCACAGTGTGG + Intronic
1157972114 18:52282804-52282826 CCTTCTTTCTCTCCATAAGAAGG + Intergenic
1159774218 18:72585206-72585228 CCCTCTTGTCACCCACAACATGG + Intronic
1160659007 19:289779-289801 CCTTCTGCTCCCACACAGGAGGG + Intronic
1161780290 19:6287198-6287220 CCTTCTCTTCACCCACAACATGG - Intergenic
1161895929 19:7080297-7080319 CCTTCTTTTCCCCCACAAGATGG - Intronic
1163601353 19:18251128-18251150 CTTTTTTTTCCCCCCCGAGATGG + Intronic
1163652748 19:18528124-18528146 CCTTTTTTTTCCCCCCGAGACGG - Intergenic
1164768314 19:30788536-30788558 CCTGCTTTTCTCCCCCTAGAGGG - Intergenic
1165482848 19:36075448-36075470 GCTTTTTTTCCCCCCCAAGACGG + Intronic
1167391205 19:49196422-49196444 TCTTCTCTTCCCCCACAGGACGG + Exonic
1168355775 19:55698749-55698771 CCTTTTTTTTCCCCCCTAGAAGG + Intronic
925515394 2:4675270-4675292 CCTTCTTGTCACCCGCAACATGG - Intergenic
926070438 2:9884336-9884358 CCTTCTCTTTGCCCACAACATGG + Intronic
927389250 2:22574750-22574772 CCTTCTTTTTCCTCACAAAATGG - Intergenic
927746359 2:25625356-25625378 TCTTTTTTTCCAACACAAGAAGG + Intronic
929156679 2:38794570-38794592 GCTTATTTTCCCCCACATGCAGG + Intergenic
929538819 2:42804001-42804023 CTTTCTTCTTCCCCACAAGGTGG + Intergenic
929993798 2:46812303-46812325 CCTTCTTTTCACCCCTAAGGAGG + Intergenic
930163738 2:48183360-48183382 CCTACTTTTCTCCAACTAGAGGG + Intergenic
931511735 2:63004428-63004450 TCCTTTTTTCCCCCACAATATGG + Intronic
932381518 2:71287950-71287972 CCTTTTTTTCTCCCAAAAGTAGG + Intronic
932591060 2:73068005-73068027 CCATCTTTCTCCCCATAAGATGG - Intronic
932843908 2:75115291-75115313 CATTATTTTCCCCCATCAGATGG + Intronic
933261690 2:80138267-80138289 CCTTTTTTTCCACCCCAAGAAGG - Intronic
933433635 2:82216268-82216290 CCTTATCTTGCCCCACTAGAAGG + Intergenic
933606463 2:84389440-84389462 CCTTCTCATCACCCACAACATGG + Intergenic
935658045 2:105441656-105441678 CATTCTTCTCCCCCATAACAGGG - Intergenic
936174681 2:110209526-110209548 CCTCCTTTTCTCCCCCAATATGG - Intergenic
937851089 2:126637120-126637142 CCTTCCTTTTCCCCACACAATGG - Intergenic
938031691 2:128000011-128000033 CCTCCTTTTTCCCCAGTAGAAGG + Intronic
938580754 2:132644412-132644434 AATTCTTTTTCCCCACATGAGGG + Intronic
938745378 2:134273111-134273133 TCTTCATTTCCCCCAGAAGGTGG + Intronic
939426315 2:142041950-142041972 TCATCTTTTCCCCTACAACAAGG - Intronic
939451712 2:142382743-142382765 CTTTCCTTTCCCCCACCATATGG - Intergenic
939581077 2:143946637-143946659 CTTTCTTTTCGCCGACACGATGG - Exonic
941028238 2:160482687-160482709 GCTTCTTTTTCCCCAAAAAAGGG + Intronic
943064176 2:183069660-183069682 CCTTCTTGTCACCCACAACTTGG - Intergenic
943932237 2:193868663-193868685 CCTTCTTGTCATCCACAACATGG - Intergenic
943965642 2:194328459-194328481 CCTTCTTGTCACCCACAACATGG - Intergenic
944092329 2:195925569-195925591 CCTACTTCTCCTCTACAAGAAGG - Intronic
944300031 2:198113181-198113203 CCTTCTCTCCCACCTCAAGAAGG + Intronic
944452139 2:199853830-199853852 CTTTCTTCTGCCCCACAAAATGG + Intergenic
944571720 2:201051942-201051964 CCTTCTATTTCTCAACAAGATGG + Intronic
945217523 2:207450120-207450142 TATTTTTTTCCCCCACAAAATGG - Intergenic
945258270 2:207820526-207820548 CCTTCTTTGCTCCCAAAATATGG + Intergenic
945474679 2:210266986-210267008 CCTTCTCTTCTCCCACCAAAGGG - Intergenic
945710322 2:213286882-213286904 CATTAATGTCCCCCACAAGATGG - Intronic
946516841 2:220421449-220421471 CTTTTTTTTCCCCCATAAAAAGG - Intergenic
946992482 2:225350807-225350829 CCTTCTTTTCTCCCAGGAGTGGG + Intergenic
947043879 2:225954752-225954774 TCTTTTTTTCCCCCCCAAGACGG - Intergenic
947221920 2:227802074-227802096 CCTTCCTTGCCTCCACCAGAGGG - Intergenic
947426716 2:229990148-229990170 CCTTTTTTTCCTCTATAAGAGGG + Intronic
947461431 2:230307391-230307413 CCTTCTCTTCACCCACAATGCGG - Intronic
948170886 2:235901396-235901418 CATTCTTTTCCTCCAGGAGAAGG + Intronic
948434626 2:237944677-237944699 CCTTCTTGTTGCCCACAACACGG - Intergenic
948601627 2:239110949-239110971 CTTGGTTTTCCCTCACAAGAAGG - Intronic
1168822194 20:782237-782259 CCATTTTTTCCCCCCCAAGATGG - Intergenic
1169702450 20:8462789-8462811 CCTTGCTTTCCTCCACAATAAGG + Intronic
1170446312 20:16431538-16431560 CCTTCTCTTCCCCTACAGTAGGG + Intronic
1171242278 20:23581569-23581591 CCCTCTTTTCCCATAAAAGAGGG + Intergenic
1172980935 20:38941083-38941105 CTTTCTTCTCCCCAACAACATGG - Intronic
1175001285 20:55632972-55632994 CCTTCTCTTCACCCACAATGTGG + Intergenic
1175312813 20:58023759-58023781 CCTTCTCATCACCCACAACATGG + Intergenic
1175362599 20:58425338-58425360 CCTTCTTTACCCCCACCAGCTGG - Intronic
1175488904 20:59365445-59365467 CCTTCTCTTCCCCCACCATCAGG + Intergenic
1176283003 20:64325755-64325777 TGGTCTTTTCCCCCACATGAGGG - Intergenic
1177323584 21:19554350-19554372 CCTTCATTGCCCCCAGCAGAAGG - Intergenic
1178412570 21:32377715-32377737 CCTTCTTCTCCCTCCCAGGATGG - Intronic
1178777889 21:35569506-35569528 CCTTCTTTTCCCCCAGAATCTGG - Intronic
1180101103 21:45586487-45586509 CCTTCCTTTCCCCCGAAAAACGG + Intergenic
1180647436 22:17351221-17351243 CCTTGCTTTTCCACACAAGAGGG + Intergenic
1182552294 22:31106952-31106974 TCTTCTTTCCCCCCAGGAGAAGG + Intronic
1182567919 22:31213296-31213318 CCATCTTTTCCCCCAGCAGTAGG + Intronic
1183144624 22:35978577-35978599 CCTTATTTTCTGCCACAAGAAGG - Intronic
1183562448 22:38586195-38586217 CGTTTGTTTCCCCCACAGGAGGG - Exonic
1184898095 22:47424098-47424120 CCTGCTTTTCCCCCACAACGTGG + Intergenic
949218480 3:1600635-1600657 CCTTCTCTTCCCCCTCAACATGG + Intergenic
949688210 3:6602453-6602475 CTTTCTTTTTCTCCACAAAATGG - Intergenic
950131966 3:10553598-10553620 CCTCAGTTTCCCCCACAACATGG - Intronic
950152911 3:10702192-10702214 ACTTCCTTTCCCCTACAAGGTGG - Intronic
951437688 3:22684060-22684082 CCTTCTTTTCCTTCCCCAGAGGG - Intergenic
951508827 3:23479506-23479528 CTTTCTCTTCACCCACAAGATGG + Intronic
952408618 3:33027036-33027058 TCTCCTTTTCCCCCACAACGTGG - Intronic
952836876 3:37610143-37610165 CCCTCTTTTTCCCCAAAACAAGG - Intronic
953526894 3:43698795-43698817 CCTTCTTTTTCCCCAAAAAATGG + Intronic
953596878 3:44324106-44324128 ACTTTTTTTCCCCAACAAAATGG + Intronic
953648753 3:44779909-44779931 CCCTCTTTTCTTCCAGAAGAAGG + Intronic
953955757 3:47230724-47230746 TTTTTTTTTCCCCCACAAGATGG - Intronic
955807436 3:62752129-62752151 CCAGCATTTCCACCACAAGAAGG - Intronic
957243308 3:77686717-77686739 CCTCCTTTTCCCACAGGAGATGG - Intergenic
957417959 3:79930051-79930073 CCTTCTCCTCGCCCACAACATGG - Intergenic
958675487 3:97264579-97264601 CCTTCTCTTAGCCCACAATATGG + Intronic
961142208 3:124565110-124565132 ACTTCCTTTCCTCCACTAGATGG + Intronic
961379900 3:126490281-126490303 GCTGCTTTGCCCCCACGAGATGG + Intronic
961635102 3:128328327-128328349 GCTCCTTTTACTCCACAAGATGG - Intronic
963016026 3:140824732-140824754 TGTTCTTCTCCCCCACTAGATGG + Intergenic
963148641 3:142020528-142020550 CTTTCTTTTCCCCCCCGAGACGG - Intronic
963389966 3:144648694-144648716 CCATCAATTCCCCCACCAGATGG + Intergenic
965788014 3:172356693-172356715 CCATCTTTTCCCCACCAAAAGGG + Intronic
966063841 3:175792858-175792880 TCTTCTTTTACCCCACCAGGAGG - Intronic
966840217 3:184081991-184082013 CCTTCTCTTCAGCCACAACATGG - Intergenic
967378830 3:188835086-188835108 CCTTCAATTAACCCACAAGAAGG + Intronic
968538565 4:1150527-1150549 CCTTCTCTTCCCCCATAGCATGG + Intergenic
970406532 4:15769397-15769419 TCTTCAGTTCCCCCACTAGAAGG - Intergenic
971046089 4:22806626-22806648 TATTATTTTCCCCCAGAAGATGG - Intergenic
971092485 4:23361333-23361355 CCTTCTCGTCACCCACAACATGG - Intergenic
971483229 4:27132918-27132940 CCTTTTTTTTCCCCACTAAATGG + Intergenic
971669751 4:29542191-29542213 CCTTCTCGTCACCCACAACATGG + Intergenic
972029573 4:34436683-34436705 CTTTTTTTTCCCCCACAAAAAGG + Intergenic
972630964 4:40841527-40841549 CCTCCCTCTCCACCACAAGAAGG - Intronic
972788259 4:42346971-42346993 CCTTCTTGTAGCCCACAACATGG - Intergenic
973787038 4:54341914-54341936 CCTTTTTTTCCCCCACAGCTTGG + Intergenic
977087406 4:92619897-92619919 TTTTTTTTTCCCCCACAGGAGGG + Intronic
977359162 4:95981643-95981665 CCTTCTCTTTGCCCACAACATGG - Intergenic
978229834 4:106385328-106385350 CCATCTCTTCACCCACAACATGG + Intergenic
978344451 4:107752390-107752412 TCTTCTTTTCCCCCCAGAGAAGG - Intergenic
978570160 4:110128099-110128121 CCTTCTCTGACCCAACAAGATGG - Intronic
979462933 4:121003956-121003978 CCTTCTCTTCACCCACATGGTGG - Intergenic
980574310 4:134665855-134665877 CCTTCTTGTTGCCCACAACATGG + Intergenic
981418540 4:144521576-144521598 CCTCCTTTTCCACCACACCAGGG + Intergenic
981452033 4:144909773-144909795 CCTTCTTTTCCCCAGCAAAGTGG - Intergenic
982611120 4:157575253-157575275 CCTTCTTGTCACCTACAATATGG - Intergenic
982616765 4:157647384-157647406 TTTTCTTTTCTCCCACAAAAGGG + Intergenic
984593953 4:181646274-181646296 CCTTCTTTTACCCTATATGAAGG + Intergenic
984808164 4:183770108-183770130 CCTTTTTTTCCCCCCCAAGAAGG - Intergenic
985784997 5:1888763-1888785 CCTTCTTTTCCTCCACCCGTGGG + Intergenic
986403889 5:7406420-7406442 CCTTCTGCTCTCCCAAAAGAAGG + Intronic
987293047 5:16525856-16525878 GCTTCTTTACATCCACAAGATGG - Intronic
988073695 5:26325673-26325695 CCTTCTTGTCACCCACAACGTGG + Intergenic
988346413 5:30042644-30042666 CCTTCTCTTCACCCACAACGTGG - Intergenic
989123887 5:38032370-38032392 CGTTCTTTTCCCCCACATGAAGG - Intergenic
989339227 5:40355091-40355113 CCTTCTTGTCACCCCCAACATGG - Intergenic
989730393 5:44641424-44641446 CCTTCCTGTCACCCACAACATGG + Intergenic
992863189 5:80932896-80932918 TTTTTTTTTCCCCCACCAGATGG + Intergenic
992886961 5:81168721-81168743 CCTTCTTTTTCCCCTCAATTTGG + Intronic
994692301 5:103034129-103034151 CCTTCTTGTCACCCACAACGTGG + Intergenic
995115321 5:108472130-108472152 CCCTTTTTTTCCCCTCAAGATGG + Intergenic
997005717 5:129814270-129814292 CCTTCACTTGCCCCACAGGATGG - Intergenic
997032233 5:130144275-130144297 GCTACTTATCCCCCACAAAAGGG + Intronic
998066594 5:139164298-139164320 CCATCCCTTCCCTCACAAGAGGG + Intronic
998310945 5:141130422-141130444 AATTTTTTTCCCCCCCAAGAAGG - Intronic
998387564 5:141766578-141766600 CCTTCCTTTCCCCAACAACCAGG + Intergenic
998956688 5:147446086-147446108 CTCTCTTTTCCCTCACAGGAAGG + Intronic
999184502 5:149696320-149696342 CCTTCTTTTCCCCCATTGAATGG - Intergenic
999960615 5:156752395-156752417 TCTTTTTTTCCCCCCCAAGATGG + Intronic
1002084667 5:176766357-176766379 CCTTCTTGTGCCACCCAAGAGGG - Intergenic
1003410487 6:5857826-5857848 CCTTCATTTTCTCCACAAAATGG - Intergenic
1004088424 6:12474249-12474271 CCTTATTTGCCCCCACATGTTGG + Intergenic
1004135946 6:12966619-12966641 AATTCTTTTCTCCCACAGGAAGG + Intronic
1004137317 6:12979915-12979937 CCTGCTTTTCACCCAGAAAATGG + Intronic
1006029337 6:31167945-31167967 CCTTTTTCTCCCCACCAAGACGG + Intronic
1006877975 6:37315057-37315079 CCAGCTTATCCCCCAGAAGAGGG - Intronic
1009341505 6:62560282-62560304 GCTTCATTTCCCCCCCAAGGGGG - Intergenic
1009671385 6:66756268-66756290 CCTTCCTTTCCCACTCAAAAAGG - Intergenic
1011446025 6:87441261-87441283 CCTTCTTTGCCCCTAGAATATGG - Intronic
1011530068 6:88312011-88312033 CCTTCTCTTCACCCACAACATGG + Intergenic
1011642815 6:89431759-89431781 CTTTTTTTTCCCCCTTAAGATGG - Intergenic
1011915806 6:92505423-92505445 CATTCATTTCTCCCAAAAGATGG - Intergenic
1012231113 6:96762215-96762237 CCTTCTTTTCGCCCACAACGTGG + Intergenic
1012373739 6:98536916-98536938 CCTTCTTTTGCCCCACATCTGGG + Intergenic
1012696410 6:102390423-102390445 CCTTCTCATCACCCACAACATGG + Intergenic
1014396596 6:120931432-120931454 CTTTCTTTTCCCCCACAATCTGG - Intergenic
1015255622 6:131176681-131176703 CTGTCATTTCCCCCAAAAGATGG + Intronic
1015865622 6:137723622-137723644 CCTTTTTTTCCCCCACAACTGGG + Intergenic
1016137770 6:140567425-140567447 CCTCCTTTCCTCCCATAAGAAGG + Intergenic
1016578337 6:145597722-145597744 CTTTCCTTTCACCCTCAAGAAGG + Intronic
1016816867 6:148311109-148311131 TCTTTTTTTTCCCCCCAAGACGG + Intronic
1018047361 6:159977609-159977631 CCTCATTTTCCTCCTCAAGAGGG + Intronic
1018098369 6:160413707-160413729 CCATCTTTGCTCCCACAAGAGGG - Intronic
1018143583 6:160863294-160863316 CCTTCCTTTCCCCCACTGGGGGG + Intergenic
1018162691 6:161062278-161062300 CTTTCTTTTCCCCCAGATGGTGG + Intronic
1019751255 7:2731432-2731454 CATTCTCTTCCTCAACAAGATGG - Exonic
1020586855 7:10079526-10079548 CCTTCTTGTCACCCACAACATGG - Intergenic
1021097319 7:16548350-16548372 CCTTCTTGTCACCCACAACGTGG - Intronic
1021269950 7:18573907-18573929 CCTTCTCATCGCCCACAACATGG + Intronic
1022472457 7:30690123-30690145 CCATCTTTCCCACCAGAAGATGG - Intronic
1023947197 7:44812559-44812581 CTTTTTTTTCCCCCCCGAGACGG + Intronic
1025271363 7:57521872-57521894 TTTTTTTTTCCCCCACAAAACGG - Intergenic
1027862215 7:83599303-83599325 CTTTCTTTTCCCCTTCTAGAGGG + Intronic
1028024664 7:85821877-85821899 GCTTCTCTTCACCCACAACATGG - Intergenic
1028527332 7:91800856-91800878 CCTTCTTCTTACCCACAACATGG + Intronic
1029186898 7:98745818-98745840 TGTTCTTTTCCCAAACAAGAGGG - Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1031836527 7:126686377-126686399 CCTTCTCTTCACCCACAACGTGG - Intronic
1032067806 7:128784718-128784740 TCTTCTTTTCACGAACAAGACGG - Intergenic
1032234170 7:130105440-130105462 ACTTCTTTTCCCCTAGAACAGGG + Intronic
1032780435 7:135161454-135161476 CCTTCTTTTCCACAGCATGATGG + Intronic
1033777007 7:144622472-144622494 CCTTTTTTTCCCCCACTAGCAGG - Intronic
1034895640 7:154874786-154874808 CCATCTTTTTCCCGGCAAGAGGG + Intronic
1035152010 7:156882423-156882445 CCTTTTTTTCCCCCTTGAGATGG - Intronic
1038847010 8:31239302-31239324 CCTGCTTTTCCCCAAGAAGTGGG - Intergenic
1041290073 8:56300381-56300403 CCTCCTTGCTCCCCACAAGAGGG + Intronic
1042912295 8:73840059-73840081 TCTTTTTTTTCCCCCCAAGAAGG + Intronic
1043373002 8:79613738-79613760 CATCCCTTTCCCCCACAAAAAGG + Intronic
1044076127 8:87823869-87823891 CCTTTTTTTCCCCCTTGAGACGG + Intergenic
1044320144 8:90792028-90792050 CTTTCTTTTCCCCGAAAGGAAGG + Intronic
1044524896 8:93241056-93241078 CCTTCTCTTCACCCACAATATGG + Intergenic
1045482930 8:102607256-102607278 CCTTCTCTTCCTCCAGTAGAGGG + Intergenic
1045942210 8:107752165-107752187 CCTTTTTTTCCCCCACTAATAGG - Intergenic
1046731994 8:117736044-117736066 CCTTTTTTTCCCCTCCTAGAAGG - Intergenic
1047750178 8:127874732-127874754 TCTTCTTCTTCCCCAAAAGAAGG + Intergenic
1048115404 8:131516197-131516219 CCTTATTTTCCCCCCAGAGAGGG - Intergenic
1048673831 8:136754252-136754274 TCTTCTTCTCCCCCGCAAGGGGG - Intergenic
1048874466 8:138826421-138826443 TCTTCTTTACCCCCATCAGAAGG + Intronic
1050044542 9:1529260-1529282 CCTTTTTTCCCCCCCAAAGAAGG + Intergenic
1051050179 9:12923325-12923347 CCTTCTCTTCTCAGACAAGAAGG + Intergenic
1051563269 9:18467230-18467252 TTTTCTGTTCCCCCACAAAATGG - Intergenic
1052955668 9:34251591-34251613 CCTTCTCTTTCCCCACAGGTGGG - Exonic
1057468636 9:95338284-95338306 CCTTCTCTTCCCCCACAATGTGG - Intergenic
1058143497 9:101383489-101383511 CCTTCTTTTCCAGCAGTAGAGGG + Exonic
1059134100 9:111787077-111787099 CTTTTTTTTCCCCCAAAAGTAGG - Intronic
1059392121 9:114005873-114005895 CCTTGTTTTCCCCCATAATTTGG - Intronic
1060012313 9:120054696-120054718 CCTTCTTTTCCTCCTTAAAATGG - Intergenic
1060557480 9:124516062-124516084 TCTTCCTTGCCCCCACAAGAGGG - Intergenic
1061174566 9:128986033-128986055 CTTTTTTTTCGCCCCCAAGATGG - Intronic
1061611601 9:131750218-131750240 GCTTGTTTTCCCCCCCAAGATGG - Intergenic
1186808109 X:13160527-13160549 TCTTCTCTTCTCCCACAATAGGG + Intergenic
1187277962 X:17832750-17832772 CCTTCTTTTCTCCCATATTAGGG + Intronic
1187889373 X:23919986-23920008 CCTACTTTTCCCCCAATAAATGG + Intronic
1188727682 X:33606475-33606497 CCTTCTTGTCACCCACAACGTGG + Intergenic
1190046022 X:47111997-47112019 CTTTTTTTTCCCCCCCAAGATGG - Intergenic
1190245630 X:48688715-48688737 CCTTGTTACCCCCCACAATAGGG - Exonic
1195127579 X:101823161-101823183 CCTTCTTTTGGCCCACAACATGG - Intergenic
1195283612 X:103360537-103360559 CCTTTTTTTCCTTCACAAGGAGG + Intergenic
1196915845 X:120534059-120534081 CTTTTTTTTTCCCCTCAAGACGG - Intronic
1199359950 X:146906601-146906623 CCTTCTCTTTGCCCACAAGGTGG + Intergenic
1201710036 Y:16980836-16980858 CTTTGTTTTACCCCTCAAGATGG - Intergenic