ID: 1161900238

View in Genome Browser
Species Human (GRCh38)
Location 19:7113092-7113114
Sequence TTTCTCTCCTTCACAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161900238_1161900241 -10 Left 1161900238 19:7113092-7113114 CCACCCACTGTGAAGGAGAGAAA 0: 1
1: 0
2: 2
3: 33
4: 268
Right 1161900241 19:7113105-7113127 AGGAGAGAAATGATTAGCACTGG 0: 1
1: 0
2: 5
3: 15
4: 308
1161900238_1161900243 14 Left 1161900238 19:7113092-7113114 CCACCCACTGTGAAGGAGAGAAA 0: 1
1: 0
2: 2
3: 33
4: 268
Right 1161900243 19:7113129-7113151 ACTACAGCACATCCATTTACCGG 0: 1
1: 0
2: 1
3: 8
4: 114
1161900238_1161900242 -9 Left 1161900238 19:7113092-7113114 CCACCCACTGTGAAGGAGAGAAA 0: 1
1: 0
2: 2
3: 33
4: 268
Right 1161900242 19:7113106-7113128 GGAGAGAAATGATTAGCACTGGG 0: 1
1: 0
2: 1
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161900238 Original CRISPR TTTCTCTCCTTCACAGTGGG TGG (reversed) Intronic
901068172 1:6504460-6504482 TCCCCCTCCTCCACAGTGGGGGG + Intronic
902827797 1:18989033-18989055 TTGGCCTCCCTCACAGTGGGTGG + Intergenic
906510811 1:46409599-46409621 TTTCTCTCCTGTAAAGTGGGTGG + Intronic
908986433 1:70029167-70029189 TTTCTCTCTCTCACAGTGTTTGG - Intronic
909508107 1:76418054-76418076 TTTCTCTCCTTAAGATTGAGTGG - Intronic
910883834 1:91945802-91945824 TTTCCATCCTTCACAGTGATTGG - Intergenic
911674866 1:100647514-100647536 ATTCACTCCTTCTCACTGGGTGG + Intergenic
912952963 1:114133308-114133330 TCCCTCTCCTTCACTGTGGCAGG - Intronic
913069850 1:115288844-115288866 CTTCTTTCCATCACAGTGTGTGG + Intronic
913164178 1:116169733-116169755 TTTCTCTGTTTCACAGAGGAGGG + Intergenic
913255215 1:116946997-116947019 TTGCTTACTTTCACAGTGGGAGG + Intronic
913570460 1:120114818-120114840 TGTCTCTCCTCCACAGAGTGGGG - Intergenic
913685624 1:121229025-121229047 TTGTTCTCCTTCACATTGAGGGG + Intronic
914037469 1:144016628-144016650 TTGTTCTCCTTCACATTGAGGGG + Intergenic
914151984 1:145051304-145051326 TTGTTCTCCTTCACATTGAGGGG - Intronic
914747803 1:150512336-150512358 TCTCTCTGGTCCACAGTGGGAGG + Exonic
915289981 1:154877056-154877078 CTGCTCTTGTTCACAGTGGGAGG + Intergenic
916052688 1:161047566-161047588 CTTCTCTCTTTGACTGTGGGAGG - Exonic
918232135 1:182545635-182545657 TCTCTCTCCTTCACAGTTGAAGG + Intronic
918415885 1:184308377-184308399 TATTTCTCCTTCACATTGGAAGG + Intergenic
920338731 1:205262189-205262211 TTGCTCTCCTTCCCCGTGGAGGG - Intronic
920472945 1:206247582-206247604 TTGTTCTCCTTCACATTGAGGGG + Intronic
920873555 1:209814118-209814140 TTTCTCCTCTTTACAGTGAGGGG + Intergenic
922455248 1:225769011-225769033 TTTTTCTCTCTCACAGTGGCTGG + Intergenic
923946624 1:238895190-238895212 TTTCTCTGGAGCACAGTGGGAGG + Intergenic
1062830404 10:601745-601767 GTTCTCTCCTTCACAGGGAAGGG + Intronic
1063255180 10:4320007-4320029 TTGCTCTCCTTCCCTGTGGTAGG - Intergenic
1064544800 10:16439291-16439313 TTTCTGTCCTTCACAGGGAAGGG - Intronic
1064878880 10:20027367-20027389 CTTCTCTCCTTCTCATTGTGAGG + Intronic
1065479494 10:26178023-26178045 TCTCTCTTCTTCACAGCAGGAGG - Intronic
1066230147 10:33424234-33424256 TGTCTCTGCTTCACAGTGTCTGG - Intergenic
1069804562 10:71111533-71111555 TTACTCTCCTTCACATTTGAAGG + Intergenic
1071977346 10:90968161-90968183 TTTCTCCCCTTCCCAGGTGGAGG + Intergenic
1072797490 10:98367070-98367092 ATTCTCTCCTGCACAGAGAGTGG - Intergenic
1072894594 10:99356115-99356137 TATCTCTGCTTCACAGTGTCTGG + Intronic
1073299529 10:102462332-102462354 TTTCTCTGCTTCACAGATGTAGG + Intronic
1074633843 10:115290712-115290734 TTTCTCTCCTGCAGAGAGAGAGG + Intronic
1076862251 10:133143735-133143757 TCTCTCTCCCCCACTGTGGGCGG + Intergenic
1076884866 10:133257671-133257693 TTGCTCTCCTTCCCACTGGAGGG + Intergenic
1079458602 11:20659799-20659821 TTTCTCTCCTTTTGAGTGGGTGG + Intergenic
1080171141 11:29304493-29304515 TTTCTCTCTTTCCAAGTGGTAGG - Intergenic
1081447697 11:43146227-43146249 TTTCTCTCCTTCACTAAGGAGGG - Intergenic
1083374644 11:62209571-62209593 TTCCTCTCCCTTACAGTGGGAGG + Intronic
1084562237 11:69911525-69911547 ATTCTCTCCTCCCAAGTGGGGGG + Intergenic
1086745968 11:90427239-90427261 TTTCCCTCCTACACAGAGGATGG + Intergenic
1088017037 11:105073352-105073374 TTGAGCTCCTTGACAGTGGGAGG + Intronic
1088019585 11:105103252-105103274 TTGAGCTCCTTGACAGTGGGAGG + Intergenic
1089136360 11:116252425-116252447 TTTCTCTCCTTCAGACAGTGAGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090049256 11:123362901-123362923 TTTCTCTCCTTCCCAGGGACTGG - Intergenic
1090311929 11:125748584-125748606 TTTCTCCCCTCCACAGGGGATGG + Exonic
1090842324 11:130501961-130501983 TTTCTTTCCTTCACACTGGCTGG + Intergenic
1091542510 12:1474853-1474875 TTTCTTCCCTGCACAGTGGTAGG + Intronic
1092225796 12:6747641-6747663 TTTCTTTCCTGCACTCTGGGTGG - Intergenic
1092274202 12:7046946-7046968 TTTCTCTCCTTGACCCTGGGAGG + Intronic
1092336341 12:7637454-7637476 ATTTTCTCATTCACAGTTGGAGG - Intergenic
1092595840 12:10003965-10003987 TTTCCCTCAATCACACTGGGTGG - Intronic
1094215258 12:27933947-27933969 TTTCTCTCCTTTTCGGTTGGGGG - Intergenic
1095501504 12:42845075-42845097 TTTCTCTCCTTCACTGAGGAAGG + Intergenic
1096003592 12:48149945-48149967 TTTCTCTGCTGCATAGTGGAGGG + Exonic
1096320342 12:50606558-50606580 TTTCTCACCTTCAAAGGAGGTGG + Intronic
1096833178 12:54330474-54330496 TCCCTCTTCTTCACAGTGGTGGG + Intronic
1101202478 12:102451585-102451607 TTTCTTTCCTTCCCAATGGTTGG - Intronic
1107194786 13:37637333-37637355 TTTCTCTGCTTCTCCCTGGGCGG + Exonic
1107531610 13:41287763-41287785 TTCCTCTTCTTCACAGGAGGTGG + Intergenic
1107955663 13:45508816-45508838 TTTCTGACCTTCCCAGTGGTGGG + Intronic
1110113906 13:71786979-71787001 TTTCTCTCTCTCACAGTGGCTGG - Intronic
1110173527 13:72530717-72530739 TGGCTCTGCTTCACTGTGGGAGG + Intergenic
1111258668 13:85706283-85706305 TTACTCTGCTTCACAGAGGTAGG - Intergenic
1111477227 13:88766355-88766377 TTTCTCTGCTTCTCAATGGCTGG + Intergenic
1112608370 13:100930274-100930296 TTTCTCTCTGTCACAGAGGCTGG + Intergenic
1113793543 13:113043362-113043384 CTTCTCTCCTTCACTCTAGGAGG + Intronic
1113870697 13:113558155-113558177 TTTCCCTGGTTCCCAGTGGGCGG + Intergenic
1114628000 14:24141755-24141777 TTTCTGTGCTTCACAATGGTGGG - Intergenic
1115698364 14:35924319-35924341 TTCCACTTGTTCACAGTGGGTGG + Intronic
1115812965 14:37130985-37131007 TCTCCCTCCTTCCCAGTGGTGGG - Intronic
1119951062 14:78745704-78745726 TTTATCTCATTCAGAGTGAGAGG + Intronic
1122455382 14:101846161-101846183 TTCAACTCCTTCACATTGGGTGG + Intronic
1123029660 14:105445651-105445673 TTTCTCCCTTCCACAGTGGGCGG + Intronic
1125678356 15:41514355-41514377 TTTCACCCCATCACAGTGAGAGG - Intergenic
1126222503 15:46230598-46230620 TGTCTCTGCTTCACAGTGACTGG + Intergenic
1126309734 15:47301850-47301872 TTTCTCTCCTTCAGAGTTTGGGG - Intronic
1132127454 15:99240699-99240721 TTTCTCTCTTTCAAAGTGAAAGG + Intronic
1133259684 16:4540196-4540218 TTCCTCTCCTTCACAGTCCTGGG - Intergenic
1134600358 16:15528887-15528909 TTTCTCCCTTTCACTGTGTGAGG + Intronic
1135942350 16:26833333-26833355 TATTTCTCCTTCACATTTGGAGG - Intergenic
1137273590 16:46918839-46918861 CTTCTCTCCATCCAAGTGGGTGG - Intronic
1137422939 16:48351566-48351588 TTTCTCTCCTTACAGGTGGGTGG + Exonic
1137651572 16:50124953-50124975 TCCCTCTCCTTCAGTGTGGGTGG - Intergenic
1137699810 16:50489378-50489400 GTTCTCTCTTTCACAGTGCCTGG + Intergenic
1138094519 16:54201531-54201553 TCTCTCTCCTGGCCAGTGGGTGG + Intergenic
1138407669 16:56810809-56810831 TTTCTCTTGTTGATAGTGGGTGG - Intronic
1139514940 16:67447292-67447314 TTTCTCTCCTGCCCAGTGAGGGG + Intronic
1139588429 16:67919245-67919267 TTTCTCACCTTCAGTGTGGGTGG + Intronic
1140118078 16:72060096-72060118 TTGCTCTCCTTGACAGTATGTGG + Exonic
1140120109 16:72076287-72076309 TTGCTCTCCTTGACAGTATGTGG + Exonic
1140245451 16:73244322-73244344 TCTGTCTTCTTCACAGTGGAAGG - Intergenic
1141991914 16:87615461-87615483 TTTCTTTCCTGCCCAGTGAGTGG + Intronic
1143466425 17:7139843-7139865 TCTCTCTCCTGCAGAGAGGGAGG + Intergenic
1144054073 17:11523313-11523335 TTCCTCTCCTTGTCTGTGGGAGG + Intronic
1146799978 17:35810375-35810397 TTTCTCTTCCACACAATGGGTGG - Intronic
1146829923 17:36059581-36059603 TTTCTCTCCTGTAGAGTGGAAGG + Intergenic
1146837489 17:36123998-36124020 GGTGTCTCCTTCACTGTGGGTGG + Intergenic
1147053753 17:37817988-37818010 ATTCTCTCCTCCAGAGTGGTAGG - Intergenic
1148191136 17:45679381-45679403 TTCCTCTCCTTGAGTGTGGGTGG + Intergenic
1149572383 17:57682328-57682350 TGGCACCCCTTCACAGTGGGTGG - Exonic
1150250887 17:63703908-63703930 TTTCTCTCATTCAAAGGGAGGGG + Intronic
1150593670 17:66584999-66585021 TCTCTCTCCTTCAGAGAGAGAGG + Intronic
1152433604 17:80262246-80262268 TATCTCTCCTTCAGAGTAGAAGG - Intronic
1153781477 18:8498946-8498968 ATCCTCTTCTTCACATTGGGTGG + Intergenic
1153845686 18:9047916-9047938 CTGCTCTCCTTCACAGCGGGTGG - Intergenic
1153996471 18:10446461-10446483 TTTCTTTCTGGCACAGTGGGAGG + Intergenic
1155536686 18:26825853-26825875 TTTCTCTCCTTCACAGAAGAAGG - Intergenic
1156890933 18:42188435-42188457 TTTCTCTATTTCACTGGGGGTGG - Intergenic
1158544097 18:58381242-58381264 GTTCTCCCCTTCACTGTGGGTGG - Intronic
1158825686 18:61216198-61216220 TTTCTCTTCCTCACCGTGGTGGG - Intergenic
1159922271 18:74237103-74237125 TCCCTCTCCCTCTCAGTGGGTGG + Intergenic
1161278451 19:3432421-3432443 CTTCTCCCCTTCAGACTGGGAGG - Intronic
1161900238 19:7113092-7113114 TTTCTCTCCTTCACAGTGGGTGG - Intronic
1164657975 19:29938592-29938614 TGTCTCCCATTCCCAGTGGGGGG + Intronic
1165392176 19:35545184-35545206 TTTCTTTCCTTCCCAGGGGCCGG + Exonic
1165446625 19:35860326-35860348 TCTCCCTCCTGCACAGTGTGTGG - Exonic
1165559313 19:36665677-36665699 TTTCTCTCTTTCACCGTGGCTGG - Intronic
1166228702 19:41413072-41413094 TTTCTCTGCTTCACTGTTGTTGG + Intronic
1166536118 19:43575844-43575866 TTTCTCGGCTTCAGTGTGGGCGG - Exonic
1167626238 19:50591617-50591639 TCTCTCTCCTGCAGAGAGGGAGG + Intergenic
1167696732 19:51019483-51019505 TTTCTCAACCTCACAGCGGGGGG + Intronic
1168220638 19:54957834-54957856 TTTCTCTCCTCCACACTGGAGGG + Intronic
925324310 2:3005622-3005644 TTGCTCTACTTCAGGGTGGGAGG + Intergenic
926556911 2:14368577-14368599 TCTCCCTCCTTGAAAGTGGGTGG + Intergenic
926772071 2:16387171-16387193 TTTCTCTCCTTCACCTTGCCTGG - Intergenic
927948883 2:27154302-27154324 TTTCAGCCCTTCAGAGTGGGAGG + Exonic
928114772 2:28538870-28538892 TCTCTGTCCCTCACGGTGGGCGG - Intronic
930967405 2:57346581-57346603 TTTTTCTGCTTCATAGTTGGAGG - Intergenic
931319512 2:61162289-61162311 TTTCTCTCCATAACTGTGGTGGG - Intronic
931438951 2:62273694-62273716 CTTCTCTCCTTCCCAGAGGATGG - Intergenic
931632289 2:64312065-64312087 TCTCACTACTTCACAGCGGGTGG - Intergenic
934147266 2:89107672-89107694 TTCCTCTCTTTCACAGTGCTTGG + Intergenic
934222006 2:90092922-90092944 TTCCTCTCTTTCACAGTGCTTGG - Intergenic
937440322 2:121909721-121909743 TTTATCTCCTCCAGAGTGTGTGG - Intergenic
938611758 2:132955212-132955234 TTTGTCTCCTTGCCAGTGAGAGG - Intronic
939430327 2:142096544-142096566 TTTGTCTCCATCATAGTAGGAGG - Intronic
939541383 2:143498337-143498359 TTTCTATTCTTCTCTGTGGGAGG + Intronic
939901170 2:147851378-147851400 TTTCTCATCTACACAATGGGGGG + Intronic
940089504 2:149899740-149899762 GTTTTCTTCTTCATAGTGGGAGG + Intergenic
940415688 2:153417340-153417362 TTTCTCTCTCTCAGAGTGAGAGG + Intergenic
940489165 2:154335434-154335456 TTTCTCCCCTTTTCAGGGGGTGG + Intronic
940715720 2:157221408-157221430 TTTCTCTTCTTTACAGTTTGGGG - Intergenic
941039981 2:160610341-160610363 TTTCGCCCCTTCCCAATGGGTGG + Intergenic
943078013 2:183221569-183221591 TTTCTATTCATCACATTGGGAGG + Intergenic
943188420 2:184645450-184645472 TTTCTGTTTTTCATAGTGGGAGG + Intronic
944732282 2:202528777-202528799 TTTCTCAACTTTACAGTGGTGGG - Intronic
945611239 2:212005997-212006019 TTTTTCTCCTTTTCAGTGGCAGG - Intronic
946013191 2:216583054-216583076 GTTCTCTCCATAACATTGGGTGG - Intergenic
946399295 2:219460255-219460277 TTGCCCTCCTTCACAGAGGTGGG - Intronic
946507577 2:220317924-220317946 TTTCTCTCCTCCCCAGTGTGTGG + Intergenic
948200953 2:236129378-236129400 TCTCTCTCCTGCATAATGGGAGG - Exonic
948359285 2:237407510-237407532 GTGCTCTCATTCACAGAGGGAGG - Intronic
948360880 2:237419315-237419337 TTTCTCTTCTGCAGAGTGAGTGG + Intergenic
1170122749 20:12927969-12927991 TTTCTCTCCTTGAAAGTAGCAGG - Intergenic
1172788966 20:37489275-37489297 TCTCTGGCCTTCACAGTGGGAGG - Intergenic
1172821370 20:37737753-37737775 GTTTTCTCCTTCCCAGTGGGTGG + Intronic
1174030183 20:47617565-47617587 GTTATCTCCTTCTCACTGGGAGG - Intronic
1175744429 20:61445384-61445406 GGTCTCTCCTTCAAAGTGAGTGG + Intronic
1178203163 21:30431507-30431529 TGACTCTCCTTACCAGTGGGAGG - Intergenic
1179071116 21:38071954-38071976 TTCCTCTCCTACAGAGTGTGCGG + Intronic
1179405439 21:41121955-41121977 TTTCTCTCCTTCAAAGTGCGAGG + Intergenic
1180963180 22:19771764-19771786 GTTCTCTTATTCAAAGTGGGGGG + Intronic
1181284830 22:21744369-21744391 TTTTTCTCCCTCACTGTGGGAGG - Intergenic
1181846397 22:25712677-25712699 TTTCTCACCTGTAAAGTGGGTGG + Intronic
1182286931 22:29254187-29254209 TCTCTTTCCTCCACAGGGGGAGG + Exonic
1182917164 22:34044961-34044983 TTTCTCTCTTTCACTTTGGGTGG + Intergenic
1183106145 22:35616626-35616648 TTCCTCTCCTGTACAGTGAGGGG - Intronic
1183367440 22:37414636-37414658 TTTCTCACCTGCAAAATGGGAGG - Intronic
1183663966 22:39236784-39236806 TTTCTTTGCTTCTCAGTGGCTGG - Intronic
1184159450 22:42689204-42689226 TTTCTCTCCTTGGAAGTTGGTGG - Intergenic
1184353875 22:43965006-43965028 TTTCTCATCTCCACTGTGGGTGG + Intronic
1184964183 22:47955532-47955554 TATCTCTCCTTCACAGATGAAGG - Intergenic
949362053 3:3242633-3242655 TTTCTCTCCTGCAGAGAGAGGGG + Intergenic
949505901 3:4727237-4727259 TGTCTCTCAATCACAGTGTGTGG - Intronic
949821345 3:8119183-8119205 TTCCTCTGCTACACAGTGTGTGG + Intergenic
950522835 3:13506732-13506754 TGGCTCTGCTGCACAGTGGGAGG + Intergenic
950930650 3:16785459-16785481 TTTCTATCCTGTTCAGTGGGAGG - Intergenic
951085041 3:18502453-18502475 TTGCTCTTTTTCACAGTGTGAGG - Intergenic
952009585 3:28885130-28885152 TTTCCCTCCTCCACTGTGGAAGG - Intergenic
953565631 3:44029359-44029381 TTTCACCCCTTCACAGATGGGGG - Intergenic
953688246 3:45094918-45094940 TTGCTCACCTGCACTGTGGGTGG + Intronic
953840179 3:46383669-46383691 TTCCTCTCCTTCTCAGAGGACGG - Intergenic
955498550 3:59561834-59561856 CTTCTCTCATTCCCAGTTGGTGG - Intergenic
955657108 3:61256154-61256176 TGTCTCTCCTTCACTATAGGTGG - Intergenic
956210363 3:66795821-66795843 TTTGTTGCCTCCACAGTGGGAGG + Intergenic
959200540 3:103240952-103240974 GTTCTCTCCTTTCCAGTTGGAGG + Intergenic
963987904 3:151618163-151618185 TCTCTCTCTCTCACTGTGGGAGG + Intergenic
965363969 3:167775985-167776007 TTTCTCACCTACAAAATGGGGGG + Intronic
969675648 4:8612967-8612989 TTTCTCTCCTGCTCAATGGTTGG + Intronic
971167192 4:24196277-24196299 TTTCTCTCCTTCTCTGGGAGTGG - Intergenic
971319124 4:25591134-25591156 TTTTTCCCCTTCACAGAGTGTGG - Intergenic
974082578 4:57228049-57228071 TTTCTCTCCTTGAAGATGGGTGG + Intergenic
974517639 4:62937695-62937717 TTTTTCTTCTTCAGAGTGGCAGG + Intergenic
974894104 4:67917790-67917812 ATTCTCTGCTTCATAGTGGTGGG - Intronic
976444417 4:85114051-85114073 TTTCTCTCCATGACTGTGTGTGG - Intergenic
976542497 4:86294516-86294538 TTTTTCTTTTTCACAGTAGGAGG - Intronic
978116697 4:105027085-105027107 TTTTTCTCCTTCATATTTGGAGG - Intergenic
978891416 4:113832461-113832483 CTTCTCTGTTTCACAGTGGCTGG + Intergenic
979545978 4:121940376-121940398 TTTCTCTCCTACTCAGTAAGTGG + Intronic
981417221 4:144507287-144507309 TTTGTGTACTTCACAGTGGAGGG + Intergenic
982642326 4:157978829-157978851 TTTCTCTTTTTAACAGTGAGTGG + Intergenic
982855873 4:160382243-160382265 TTTCTCTCCTTCACAGCAAGTGG + Intergenic
983497625 4:168461102-168461124 TTACTCTCCTTCCCAGAGGTTGG + Intronic
983830459 4:172320564-172320586 TTTCTCTCCTGCAAAATGGCTGG - Intronic
985247570 4:187993215-187993237 TTTCTCCCCTACACAGGCGGAGG - Intergenic
985259870 4:188105423-188105445 TTTTTCTCATTCACAGTGCAGGG - Exonic
985678787 5:1245511-1245533 TTTCTCCCCTATACACTGGGTGG - Intronic
985868869 5:2538255-2538277 TTTTGCTCCTTCAGAGGGGGCGG - Intergenic
986059324 5:4173157-4173179 TTTCTCTCCTGCACAATAAGAGG + Intergenic
986328359 5:6698897-6698919 TTTTTCCCCTTCACAGTGGTTGG + Intergenic
987741154 5:21910440-21910462 TTTCTTTCTTTTACAGTGGCTGG - Intronic
988098028 5:26642867-26642889 TCTCTCTCTGTCACAGAGGGTGG + Intergenic
988726744 5:33933954-33933976 TGTCTCTCATTCACAGTGGCAGG - Intergenic
990097523 5:52135519-52135541 TTTCTCTCCATTCCAGAGGGTGG + Intergenic
990621184 5:57560654-57560676 TTTTTCTCATTCACAGTGCTGGG - Intergenic
992570858 5:78055714-78055736 TTTCTCTCCTTCAAGGAGAGAGG + Intronic
992953261 5:81881626-81881648 TTCCCTTCCTTCTCAGTGGGAGG - Intergenic
993353415 5:86877372-86877394 TTTCTCTCCTGCAGAGAGAGAGG - Intergenic
993946795 5:94124706-94124728 TTTCTAACCTTCAAAGTAGGAGG + Intergenic
995288514 5:110420750-110420772 TTTCTCTCTGTAACAGTGGCAGG - Exonic
996555451 5:124774045-124774067 TTTTTCTTCTTCAGAGTAGGAGG - Intergenic
996874406 5:128225348-128225370 CTTCATTCCTTCACAGAGGGTGG + Intergenic
996981195 5:129497297-129497319 TTTCTCTTCTTCCCAGTGTTAGG + Intronic
997382572 5:133448340-133448362 TTTCTCTCCTTCAGACGGTGTGG - Intronic
998589323 5:143460812-143460834 TTTCTCACTATTACAGTGGGAGG - Intergenic
999448619 5:151661412-151661434 GTTCTCTTCTACACAGTGGGAGG - Exonic
1003534324 6:6962976-6962998 TTTCTCTGCTGCACACAGGGTGG - Intergenic
1003721425 6:8707448-8707470 ACTCTCTCCTTCATAGAGGGAGG - Intergenic
1005831686 6:29676225-29676247 TTTCTATACTTCACAGTTGCTGG - Intronic
1007095395 6:39209690-39209712 TTTCTCTCCTCCACAAGGGCTGG + Intronic
1009527304 6:64763803-64763825 TTTCTCCCTTTCAGATTGGGAGG - Intronic
1009873288 6:69474549-69474571 CTTCTCTCCTTCCCAGAGGATGG + Intergenic
1010356406 6:74938995-74939017 TTTCTCTTATCCACAGTGGACGG - Intergenic
1012257890 6:97055333-97055355 TATCCCTCTTTTACAGTGGGAGG + Intronic
1013183908 6:107740911-107740933 TTGATCCCCTTCACAGTGGATGG - Intronic
1015982514 6:138853440-138853462 TTTCACTCCCTCCCACTGGGAGG - Intronic
1018914320 6:168123532-168123554 TTTCACGCCTTCAAATTGGGAGG + Intergenic
1019143728 6:169963503-169963525 TTCCTCTCCTGCACAGTGGTGGG - Intergenic
1022109961 7:27223129-27223151 TCTCTCTCCTACCCAATGGGAGG - Intergenic
1022123271 7:27331003-27331025 TTTCTTTCCTTCAGAATAGGAGG - Intergenic
1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG + Intergenic
1024175722 7:46838711-46838733 TTCCTCAACTCCACAGTGGGTGG + Intergenic
1024218781 7:47270766-47270788 TTTGCCTCCTCCACAGTGTGAGG - Intergenic
1024503601 7:50141081-50141103 TTTCTCTTCTTCAGAATGAGCGG - Intronic
1027262103 7:76471978-76472000 TTTGTCTCTTGCACAGTGGGTGG - Intronic
1027313484 7:76970073-76970095 TTTGTCTCTTGCACAGTGGGTGG - Intergenic
1029055361 7:97734504-97734526 TCTCTCTCTCTCTCAGTGGGTGG + Intronic
1029227829 7:99040945-99040967 TTTCTTTCCTGTGCAGTGGGAGG - Intronic
1030249628 7:107427932-107427954 TATCTCTCCTTCAGTGTGGCTGG + Intronic
1030414696 7:109227983-109228005 CTTGTTTCCTTCCCAGTGGGAGG + Intergenic
1030582439 7:111375014-111375036 TTTAGCTCCTTCATAGCGGGGGG + Intronic
1031433105 7:121697278-121697300 TTTCTCTTAATCACAGTGGGTGG + Intergenic
1031569332 7:123339758-123339780 TATCTCTCCTTCATAGTTGAAGG + Intergenic
1032335429 7:131020510-131020532 ATTCTCTTCTTCACTGTGGAAGG - Intergenic
1032802482 7:135328059-135328081 TTTCTATCCTTCCCAGTGCCTGG - Intergenic
1033331472 7:140420491-140420513 GTTCTCTCCTTCCCAGGGGCAGG - Intronic
1034187855 7:149192837-149192859 CATTTCTCCTTCACAGCGGGTGG - Intergenic
1034490679 7:151391638-151391660 TTTCTTCCCTTCACAGGGTGGGG - Intronic
1034725144 7:153329062-153329084 TTTCTCTCTTCCTCAGTGGTGGG + Intergenic
1034878843 7:154748691-154748713 TCTTTCCCCTTCACAGTGGAGGG + Intronic
1035369405 7:158369533-158369555 TTTCTCTACTGGACAGTGGGAGG - Intronic
1036428926 8:8671541-8671563 TATCTCCCCTTCATAGTGGAAGG - Intergenic
1037614964 8:20510728-20510750 CTTCTCCCCTTGAGAGTGGGTGG + Intergenic
1038460073 8:27708899-27708921 TTTCCCTCCCTTACAGTGTGTGG + Intergenic
1039150152 8:34495700-34495722 TTTCTCTGCTTCAGAATTGGAGG - Intergenic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1040933396 8:52758684-52758706 GTGCTCTCACTCACAGTGGGGGG + Intergenic
1041817328 8:61988980-61989002 GCTCTCTGCTTCACAGTTGGAGG - Intergenic
1042341393 8:67683818-67683840 TTTCTATTCTTCATATTGGGGGG + Intronic
1045072179 8:98519427-98519449 TATCACTCCTTCACAGTTGCTGG + Intronic
1046444868 8:114305033-114305055 TTTCTCACTTTTACAGTGGAAGG - Intergenic
1046620912 8:116528646-116528668 TTTCACTCCTGGTCAGTGGGAGG - Intergenic
1047712270 8:127564432-127564454 TTTCTCTGCTCCACAGTGTCTGG + Intergenic
1048885638 8:138907157-138907179 TATTTCTCCATCACAGTGTGGGG + Intronic
1050819485 9:9859558-9859580 ATTCTCTCCTTGAAGGTGGGGGG - Intronic
1052789872 9:32865351-32865373 TTACCCTGCATCACAGTGGGTGG - Intergenic
1052964283 9:34327886-34327908 TGTCTCTAATTCACTGTGGGTGG - Intronic
1053475758 9:38381109-38381131 GTTCTCTCCTTCACAGAGCATGG - Intergenic
1054740591 9:68802409-68802431 TTTCTATCCATCACAGTGCCTGG - Intronic
1054930584 9:70630713-70630735 TTTCATGCCTTAACAGTGGGAGG + Intronic
1054998072 9:71415212-71415234 ATTCTCTCCTGGACAGTGTGTGG + Intronic
1055619214 9:78106539-78106561 TTTCTCTATTTCACAGTGGAAGG + Intergenic
1056377330 9:86027438-86027460 TGTCTCTCCTTCACAGCAGATGG + Exonic
1057303665 9:93900355-93900377 TTTCTTTCCCTCACAGTTTGTGG + Intergenic
1058040194 9:100294306-100294328 GTTCTCTCCTTAACATTGGCAGG + Intronic
1060520706 9:124292435-124292457 TTTCTCTCCTTCCCACAGGCAGG - Intronic
1060531440 9:124349214-124349236 TATTTCTCCTCCCCAGTGGGAGG + Intronic
1061614768 9:131772605-131772627 AGTCTCTGCTTCACAGTTGGGGG - Intergenic
1185938335 X:4284411-4284433 TTTCTCTCCATATCAATGGGAGG + Intergenic
1186090741 X:6045564-6045586 TTTGTCTCATTCACAGTTGAAGG + Intronic
1188248383 X:27860981-27861003 CTTCTCTACAACACAGTGGGAGG - Intergenic
1188256945 X:27974189-27974211 TTTCTCTCCTGCACAGTGGTTGG - Intergenic
1193907923 X:87264974-87264996 TTTCTCTGCTTAACACTTGGAGG - Intergenic
1194655689 X:96570538-96570560 TTTCTCTCCTGGACAGTGCTGGG - Intergenic
1195762095 X:108257618-108257640 CTTCTCTCCTCCACAGAGGTTGG + Intronic
1196163777 X:112515438-112515460 TTTCTTTCCTTCATGTTGGGAGG - Intergenic
1199582530 X:149374510-149374532 TTTGTCTCTTCCACAGTGTGAGG + Intergenic
1200098805 X:153678144-153678166 TTTCTCACTTTTAGAGTGGGAGG - Intronic