ID: 1161908401

View in Genome Browser
Species Human (GRCh38)
Location 19:7174708-7174730
Sequence TTGCTGTGCACCCCATGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161908401_1161908410 21 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908410 19:7174752-7174774 GAGAGAAAGAGAAAGGGGAGGGG 0: 2
1: 9
2: 152
3: 1093
4: 5983
1161908401_1161908409 20 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG 0: 2
1: 21
2: 306
3: 2052
4: 10030
1161908401_1161908408 19 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908408 19:7174750-7174772 GAGAGAGAAAGAGAAAGGGGAGG 0: 2
1: 37
2: 429
3: 2662
4: 11733
1161908401_1161908411 22 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908411 19:7174753-7174775 AGAGAAAGAGAAAGGGGAGGGGG 0: 1
1: 10
2: 127
3: 1440
4: 8044
1161908401_1161908405 14 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908405 19:7174745-7174767 AGAGAGAGAGAGAAAGAGAAAGG 0: 48
1: 939
2: 4834
3: 10128
4: 22879
1161908401_1161908407 16 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908407 19:7174747-7174769 AGAGAGAGAGAAAGAGAAAGGGG 0: 19
1: 431
2: 3469
3: 8950
4: 21621
1161908401_1161908412 23 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908412 19:7174754-7174776 GAGAAAGAGAAAGGGGAGGGGGG 0: 1
1: 6
2: 97
3: 821
4: 5092
1161908401_1161908406 15 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908406 19:7174746-7174768 GAGAGAGAGAGAAAGAGAAAGGG 0: 23
1: 500
2: 3394
3: 7932
4: 19719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161908401 Original CRISPR TTGCTGTGCACCCCATGCCT GGG (reversed) Exonic
900237899 1:1601165-1601187 TTCCTGTGCTCTCCTTGCCTGGG + Intergenic
900521578 1:3107919-3107941 ATGCTGTGCAACCCCTGCCGGGG + Intronic
902332143 1:15735956-15735978 TGGCCGTGTACCCCATGCCAGGG + Intergenic
904437378 1:30507524-30507546 CTGCTGTGCACCCCAGGCTGGGG - Intergenic
904976181 1:34458485-34458507 TTGCTGTGCTCCCAGTGTCTTGG - Intergenic
905787696 1:40770955-40770977 GTGCACTACACCCCATGCCTGGG + Exonic
907475199 1:54700898-54700920 TTGCTGTCTACCCCCTTCCTTGG - Intronic
907588939 1:55647287-55647309 CTGCTGTACTCCCCATGCCATGG + Intergenic
910535190 1:88289407-88289429 TTGCTGTGTACTCAAAGCCTAGG - Intergenic
911054203 1:93696801-93696823 TTGCTGGGGACACGATGCCTGGG - Intronic
912010624 1:104957261-104957283 TTGCTGTGCACCAGAAGCCCTGG + Intergenic
912529370 1:110309225-110309247 TTGCTGAGCCCTCCAGGCCTGGG - Intergenic
913976134 1:143457591-143457613 TTACTGAGCACTCCATGTCTGGG + Intergenic
914070530 1:144283211-144283233 TTACTGAGCACTCCATGTCTGGG + Intergenic
914108625 1:144683143-144683165 TTACTGAGCACTCCATGTCTGGG - Intergenic
914340558 1:146756247-146756269 TGACTCTGCTCCCCATGCCTGGG + Intergenic
922173697 1:223178485-223178507 GTGCTGTCCTCCCCCTGCCTTGG + Intergenic
922799463 1:228358385-228358407 TTGCTGTGCACCCCAAGGGGTGG + Intronic
1067044134 10:42975004-42975026 TTGCTGAGCTCTGCATGCCTGGG + Intergenic
1067925672 10:50505824-50505846 GTGCTTTGCTCCCCATTCCTCGG - Intronic
1069597628 10:69682622-69682644 TTGGTGTGCTCCCCAAGCCCTGG + Intergenic
1072823141 10:98578331-98578353 TCGCTGTGCACCTCATGACTTGG - Intronic
1073059506 10:100724831-100724853 TTGCCGTGAACCCCGAGCCTGGG + Intergenic
1073154442 10:101335271-101335293 TCTCTGTGCACACCATGACTTGG + Intergenic
1076313037 10:129521736-129521758 GTGCTGTCCACCCCAGGCCCAGG + Intronic
1077280879 11:1744943-1744965 TGGCTGTGGACCCCACGCCTGGG - Intronic
1079249009 11:18773573-18773595 CTGCTGTGACCCCCATGCCAGGG - Intronic
1080404016 11:31962562-31962584 TTGCTGTGCAACCCATCTCCAGG + Intronic
1081426855 11:42934740-42934762 TAGCGGTGGACTCCATGCCTTGG - Intergenic
1083772430 11:64875736-64875758 TTGCAGAGCACCCCTTGCCCTGG - Intronic
1084043444 11:66555672-66555694 TGCCTGTGGTCCCCATGCCTAGG + Intronic
1084674008 11:70623912-70623934 TTGCTGTCCACACCCTGCCCTGG - Intronic
1084757029 11:71246204-71246226 ATGCCCTGCACCCCATTCCTTGG + Intronic
1085384678 11:76150244-76150266 TTGCTGTCCTCACCATGCCCTGG - Intergenic
1086546210 11:87970527-87970549 GGAATGTGCACCCCATGCCTAGG - Intergenic
1086968633 11:93056566-93056588 TTGCTCTGAACCTGATGCCTCGG + Intergenic
1087887310 11:103495525-103495547 TTGCTTTGCAAGCCATGCCCTGG - Intergenic
1089854583 11:121531898-121531920 CTGAGGTGCACCCCATGACTGGG + Intronic
1094198213 12:27771216-27771238 CTGATGTCCACCCCATGCTTAGG + Exonic
1095394040 12:41742530-41742552 TTGCTGTCCACCCCCTAACTGGG - Intergenic
1096475867 12:51908293-51908315 GTGCTGTGAAACCCATGGCTGGG + Intronic
1096620060 12:52858829-52858851 TTGCAGTGAACCCATTGCCTGGG - Intergenic
1096777355 12:53972467-53972489 TTGCTGTGCTGCCCCTGGCTAGG - Intergenic
1097850382 12:64404936-64404958 TGGCGGTGCACCCCCTGGCTGGG + Intronic
1098308271 12:69123063-69123085 TTGCTGTGGACACCATGTCCTGG - Intergenic
1098734272 12:74079102-74079124 TTGCTGTGCATGACATCCCTTGG + Intergenic
1099331271 12:81291718-81291740 TTGCTGAGCCCCCAAAGCCTGGG - Intronic
1101733899 12:107448547-107448569 GTGCTTTGCACACCATGCCTTGG - Intronic
1104564979 12:129872414-129872436 CTGCCGTGCATCCCCTGCCTGGG + Intronic
1104971996 12:132534933-132534955 TGGCTGTGGCCCCCATACCTGGG - Intronic
1105223110 13:18352160-18352182 TTACTGAGCACTCCATGTCTGGG - Intergenic
1105325780 13:19369784-19369806 TCGCTGAGCACTCCATGCCAGGG + Intergenic
1105778062 13:23680969-23680991 TTGCTGTCCTCCCCAAGCCAGGG - Intergenic
1106227051 13:27793503-27793525 GTGCTGTGGACCCAATCCCTTGG - Intronic
1107809818 13:44189541-44189563 TCTCTGTGCCCCCAATGCCTAGG + Intergenic
1112465052 13:99636698-99636720 TTGTTGTGCACAGTATGCCTTGG + Intronic
1114618327 14:24080359-24080381 GGGCTGTGCATCCCCTGCCTAGG + Exonic
1116163954 14:41310182-41310204 TTACTTAGCATCCCATGCCTTGG - Intergenic
1118842627 14:69524492-69524514 TTGCTTTGGGCCTCATGCCTCGG - Intronic
1119668099 14:76499065-76499087 TTCCTGGGCACCCCACCCCTCGG + Intronic
1122691354 14:103533428-103533450 TTGCTGTTCGCACCAGGCCTCGG - Intronic
1123454481 15:20407520-20407542 TTGCTGTGCAATCCTAGCCTAGG + Intergenic
1124577735 15:30924696-30924718 TTGATGTGGCCCCCATGCGTGGG + Intronic
1124636224 15:31366578-31366600 TGTCTGTGTACCCCATGCCCGGG + Intronic
1129984311 15:79903774-79903796 TCACTGTGTACCTCATGCCTAGG - Intronic
1130964466 15:88686542-88686564 GTGCCCTGCACCCCATGCCCTGG - Intergenic
1132655118 16:1038644-1038666 TTGCTCTGCAGCCCACGCCGGGG + Intergenic
1136717188 16:32290080-32290102 TCTCTGTGCACCTCATGCCTGGG - Intergenic
1136835562 16:33496334-33496356 TCTCTGTGCACCTCATGCCTGGG - Intergenic
1139388289 16:66588469-66588491 TTCCTCTGCCCCCCATGCCCTGG - Intergenic
1139993727 16:70961159-70961181 TGACTCTGCTCCCCATGCCTGGG - Intronic
1140900036 16:79358808-79358830 TTGCTCTGGAGCCCATTCCTGGG + Intergenic
1141420608 16:83912954-83912976 TTGATGTTCACTCCAGGCCTAGG + Intronic
1203009242 16_KI270728v1_random:227698-227720 TCTCTGTGCACCTCATGCCTGGG + Intergenic
1203145739 16_KI270728v1_random:1796647-1796669 TCTCTGTGCACCTCATGCCTGGG - Intergenic
1144638354 17:16924776-16924798 AGGCTGTTCACCCCATGCCAGGG + Intergenic
1147250871 17:39151787-39151809 CTACTCTGCACCCCTTGCCTTGG - Intronic
1147260721 17:39208563-39208585 CCGCTGTCCACCCAATGCCTGGG - Intergenic
1147426370 17:40347741-40347763 CTTCTTTGCACCCCCTGCCTTGG + Intronic
1147931812 17:43986425-43986447 TTCCTGTGCACCCCAAGACTGGG + Intronic
1150504589 17:65685181-65685203 TTGCTGTCCACCACATGCCTTGG - Intronic
1151700482 17:75740210-75740232 GTGCTATGAACCTCATGCCTCGG + Intronic
1154010820 18:10572388-10572410 CTGCTGTGCACCCCCAGACTGGG - Intergenic
1157153860 18:45245580-45245602 TTGCTGTGCACACTCTGACTTGG + Intronic
1159065957 18:63568066-63568088 TTGCTATGGACACCATGCCCAGG - Intergenic
1160777194 19:861724-861746 CTGCTGTGCGCCCCCTGCCCTGG + Exonic
1161908401 19:7174708-7174730 TTGCTGTGCACCCCATGCCTGGG - Exonic
1161951748 19:7471458-7471480 TTGTTCTGCACCCCAAGCATTGG + Exonic
1162110746 19:8398376-8398398 CTGCTGTGCACCCCCCTCCTGGG + Intronic
1165066741 19:33234101-33234123 CTGCTGTGGACCCCGTGCCCTGG - Intergenic
926134513 2:10326912-10326934 CTGCTGTGCCCCACATGCCCCGG + Intronic
926341754 2:11909833-11909855 TTGCAGAGAACCCCATGCATGGG - Intergenic
926433851 2:12818178-12818200 TTCATGTGGCCCCCATGCCTGGG - Intergenic
927178259 2:20425181-20425203 TTGCTCTCCTCCCCTTGCCTGGG + Intergenic
928135113 2:28682230-28682252 TTCCTGTGCAGCTCAGGCCTTGG + Intergenic
930720838 2:54636105-54636127 TTGCTTTCTAACCCATGCCTTGG + Intronic
932334512 2:70922494-70922516 GTGCTGTGCAGCCCACCCCTGGG + Intronic
934180834 2:89618582-89618604 TTACTGAGCACTCCATGTCTGGG + Intergenic
934291133 2:91692818-91692840 TTACTGAGCACTCCATGTCTGGG + Intergenic
934686043 2:96322307-96322329 TGTCTGTGCATCACATGCCTCGG - Intergenic
937062665 2:118992040-118992062 CTGCTGTGTGCTCCATGCCTAGG - Intronic
937669229 2:124521031-124521053 TTGCCTTGAAACCCATGCCTGGG + Intronic
937907605 2:127059826-127059848 ATGCTGTGCACCCCAGGCACAGG + Intronic
939388022 2:141527059-141527081 TTGGTGTCCACCCCATGACTAGG - Intronic
942373039 2:175306614-175306636 TGGCTGTGCTCCCCATAGCTGGG - Intergenic
947269814 2:228321375-228321397 TTGCTCTGCACTCCTTGCCCCGG + Intergenic
948899033 2:240946842-240946864 TGGGTGTGCAGCCCAAGCCTGGG - Intronic
1170705064 20:18737510-18737532 TTGCTGGGCTTCCCCTGCCTTGG + Intronic
1172624390 20:36338904-36338926 TTGCTCTGCCCCACCTGCCTCGG - Intronic
1172957571 20:38771836-38771858 CTGCCCTGCACGCCATGCCTTGG + Exonic
1173858577 20:46267503-46267525 TTGCTGAGAACCACATGGCTAGG + Intronic
1175585138 20:60133101-60133123 TTGCTGGGCTCCCCAGGCTTTGG + Intergenic
1175941642 20:62540051-62540073 CTGATGTGAACCCCATTCCTGGG - Intergenic
1176011312 20:62897850-62897872 TTGAGGTGCACCGCATGCCGGGG + Intronic
1176731658 21:10504578-10504600 TTACTGAGCACTCCATGTCTGGG - Intergenic
1177107875 21:16982988-16983010 TTGCTATGCACCCCAAACCCAGG + Intergenic
1179412807 21:41175207-41175229 TTGCTGTCCAGCCCAGGCCCCGG + Intronic
1180181611 21:46120781-46120803 TTGGGGTGCAGCCCTTGCCTTGG - Intronic
1180378180 22:12114039-12114061 TAGCTGTGCACACGATGCCCAGG + Intergenic
1181619925 22:24084000-24084022 CTGCTGTGGACCCCAAACCTAGG + Intronic
1181726547 22:24815001-24815023 TTGCTGTGCACCCCTGGACAAGG + Intronic
1183096627 22:35555860-35555882 TTGCTGTCAACCCCATTCCAGGG - Intergenic
1184088136 22:42278123-42278145 CTGCTGTGCACACCCAGCCTGGG + Intronic
1185131468 22:49041544-49041566 TTGATTTTCTCCCCATGCCTAGG + Intergenic
950929289 3:16773124-16773146 TTGCTGTCATCCTCATGCCTGGG + Intergenic
951941906 3:28088620-28088642 TTGTTGAGCACCCCTTGCCCAGG + Intergenic
955392263 3:58530448-58530470 TCACTGGGCACCCCTTGCCTGGG + Exonic
961935844 3:130582841-130582863 TTGCTGTCCACCCCATCCTTGGG + Intronic
967878143 3:194280730-194280752 TTGCTGTCCACTCCATACCCTGG + Intergenic
969586893 4:8099096-8099118 TTGCTCTGCACTCCATGCTCTGG + Intronic
970453327 4:16194706-16194728 TTTCTGTGCACCCCCTGCTCTGG + Intronic
970602774 4:17653401-17653423 CTGCTGTGCACACCAGCCCTGGG - Intronic
977351465 4:95894148-95894170 TTGCTATGCTCCATATGCCTTGG - Intergenic
978287355 4:107094837-107094859 AAGCTGTGCACCACATCCCTTGG + Intronic
983999198 4:174219401-174219423 TTGCTTTCCAAACCATGCCTGGG - Intergenic
1202759797 4_GL000008v2_random:99504-99526 TAGCTGTGCACACGATGCCCAGG + Intergenic
985860928 5:2470210-2470232 TTGCTGAGCCCCACCTGCCTCGG + Intergenic
986336401 5:6758931-6758953 ATGCCGTGCCCCGCATGCCTCGG + Intergenic
987922533 5:24302246-24302268 TGGGTTTGCACCCCATGCATTGG + Intergenic
997224191 5:132196518-132196540 GTGCTGTGAACCCCAGGCTTGGG - Intronic
997738800 5:136235607-136235629 TGGCTTTCCACCCCATGCCCTGG - Intronic
997839932 5:137229941-137229963 CTGCTGTGCAGCCCATGGGTAGG + Intronic
998127448 5:139634201-139634223 TGGCTGAGCCCCCCATGCCTGGG + Intergenic
998129298 5:139643302-139643324 TGTCTGAGCACCCCATTCCTTGG + Intergenic
998398814 5:141836794-141836816 ATGCTGTGCCACCCATGCCCAGG - Intergenic
998404756 5:141867989-141868011 TCTATGGGCACCCCATGCCTAGG + Intronic
999710403 5:154313455-154313477 TAGTTGTGCACCCCCTGACTAGG - Intronic
1002830736 6:818110-818132 TTTCTGTGCACCTCATTCCTGGG + Intergenic
1002830741 6:818146-818168 TTTCTGTGCACCTCATTCCTGGG + Intergenic
1005998109 6:30944151-30944173 TTGCTAAGCAACTCATGCCTTGG - Intronic
1012860531 6:104554093-104554115 CTGCTGTTGAGCCCATGCCTTGG - Intergenic
1016890346 6:149000134-149000156 TGGCTTCTCACCCCATGCCTTGG - Intronic
1018444162 6:163840011-163840033 TTGCTGGGCATCCAATGACTTGG + Intergenic
1024242339 7:47445244-47445266 CTGCTGAGCACCACATGCCTTGG - Intronic
1028983173 7:96989572-96989594 TTGCTGCGTAACCCCTGCCTTGG + Intergenic
1029058614 7:97773384-97773406 TGGCTGTGGACCACATGGCTAGG - Intergenic
1030350066 7:108474920-108474942 CTGCTGTGCAGCCCATGGGTTGG - Intronic
1032325191 7:130921540-130921562 GAGCTGTGCATTCCATGCCTGGG - Intergenic
1037593016 8:20329200-20329222 TTGATGAGAACCCCATGCCCCGG - Intergenic
1037611499 8:20480067-20480089 CTCCTGTGCCCCGCATGCCTGGG + Intergenic
1039804902 8:40989448-40989470 TTGCTGTGCAGCCGATTTCTAGG - Intergenic
1040573210 8:48627481-48627503 TGCCTGTGCACCCCAGGCCCTGG - Intergenic
1040889929 8:52306512-52306534 TTACTATGTACCCCTTGCCTTGG - Intronic
1046789669 8:118307532-118307554 TTGATGTCTACCACATGCCTGGG + Intronic
1049424339 8:142531442-142531464 TCCCTGTGCACCCCACGCCTGGG - Intronic
1060034433 9:120242839-120242861 TGGGTGTGCACCCCAGGCCAAGG + Intergenic
1060243664 9:121926200-121926222 TGGCTGTGCACCCCAGCCCCGGG - Intronic
1060399612 9:123340595-123340617 TGGCTGTGTACCCCTAGCCTTGG + Intergenic
1060973061 9:127749742-127749764 TTGCTGTGCCCCCTAATCCTGGG - Intronic
1061634646 9:131899599-131899621 TTGCTGTCCACCGCACCCCTAGG - Intronic
1061866340 9:133493510-133493532 TTGCTATGCAGGCCATGGCTGGG + Intergenic
1062366347 9:136211231-136211253 GTGCTGAGCCCCCCATGCCCAGG + Intronic
1062522244 9:136962947-136962969 TCTCTGTGCACCGCCTGCCTAGG + Intergenic
1062598382 9:137309286-137309308 TCTGTGTGCACCGCATGCCTGGG + Intronic
1203540573 Un_KI270743v1:84399-84421 TAGCTGTGCACACGATGCCCAGG + Intergenic
1186880827 X:13864476-13864498 TTGCTGTGCCCCACGTGCCTGGG - Intronic
1187039796 X:15581373-15581395 TCTCTGTGCATCCCAGGCCTGGG + Exonic
1189022068 X:37350829-37350851 ATCCTGTTCACCTCATGCCTGGG - Intronic
1193298521 X:79861159-79861181 TTGCTTTCCACCCCAGCCCTAGG + Intergenic