ID: 1161908402

View in Genome Browser
Species Human (GRCh38)
Location 19:7174709-7174731
Sequence CTTGCTGTGCACCCCATGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161908402_1161908411 21 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908411 19:7174753-7174775 AGAGAAAGAGAAAGGGGAGGGGG 0: 1
1: 10
2: 127
3: 1440
4: 8044
1161908402_1161908408 18 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908408 19:7174750-7174772 GAGAGAGAAAGAGAAAGGGGAGG 0: 2
1: 37
2: 429
3: 2662
4: 11733
1161908402_1161908412 22 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908412 19:7174754-7174776 GAGAAAGAGAAAGGGGAGGGGGG 0: 1
1: 6
2: 97
3: 821
4: 5092
1161908402_1161908406 14 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908406 19:7174746-7174768 GAGAGAGAGAGAAAGAGAAAGGG 0: 23
1: 500
2: 3394
3: 7932
4: 19719
1161908402_1161908413 30 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908413 19:7174762-7174784 GAAAGGGGAGGGGGGTGTCACGG 0: 1
1: 0
2: 6
3: 72
4: 727
1161908402_1161908410 20 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908410 19:7174752-7174774 GAGAGAAAGAGAAAGGGGAGGGG 0: 2
1: 9
2: 152
3: 1093
4: 5983
1161908402_1161908409 19 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG 0: 2
1: 21
2: 306
3: 2052
4: 10030
1161908402_1161908405 13 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908405 19:7174745-7174767 AGAGAGAGAGAGAAAGAGAAAGG 0: 48
1: 939
2: 4834
3: 10128
4: 22879
1161908402_1161908407 15 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908407 19:7174747-7174769 AGAGAGAGAGAAAGAGAAAGGGG 0: 19
1: 431
2: 3469
3: 8950
4: 21621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161908402 Original CRISPR CTTGCTGTGCACCCCATGCC TGG (reversed) Exonic
900196785 1:1380719-1380741 CTTGGGGTGCACCCCATGCAGGG + Intergenic
900237898 1:1601164-1601186 CTTCCTGTGCTCTCCTTGCCTGG + Intergenic
900521577 1:3107918-3107940 AATGCTGTGCAACCCCTGCCGGG + Intronic
900809806 1:4793371-4793393 TTTGCTGTGCTCCCCATGGGAGG + Intergenic
900815165 1:4838044-4838066 CCTGCTGCGCACACCATGCTGGG - Intergenic
901492972 1:9605977-9605999 CTTCCTGTGCCCACCCTGCCCGG - Intronic
901603880 1:10444085-10444107 CTTGCTCTGCCGCCCATGCTGGG + Intronic
902332142 1:15735955-15735977 TTGGCCGTGTACCCCATGCCAGG + Intergenic
902834455 1:19037706-19037728 CTTGGCATGGACCCCATGCCAGG + Intergenic
903226293 1:21895812-21895834 CTTGCTTTGTACCCCAGGGCAGG + Intronic
904437379 1:30507525-30507547 GCTGCTGTGCACCCCAGGCTGGG - Intergenic
909297401 1:73968258-73968280 CTTGCTCCCCACCCCCTGCCAGG - Intergenic
910255933 1:85247795-85247817 CTTGCTCTGTCACCCATGCCAGG + Intergenic
911383511 1:97145817-97145839 CTAGCAGTGGACACCATGCCAGG - Intronic
914340557 1:146756246-146756268 CTGACTCTGCTCCCCATGCCTGG + Intergenic
917839169 1:178963637-178963659 CTTGCTGGCCTCTCCATGCCAGG + Intergenic
920506483 1:206518722-206518744 CTGGCTGTTCAACCCATACCAGG - Intronic
922431585 1:225560199-225560221 CTTCCTGTGCCCCCCAAGGCTGG + Intronic
922738789 1:228004489-228004511 CTTCCTCTGCACCCCAAGCAAGG + Intergenic
923639862 1:235744756-235744778 ACAGGTGTGCACCCCATGCCCGG - Intronic
1063415916 10:5872446-5872468 CTTGCTGTGTCACCCAGGCCGGG - Intronic
1067044133 10:42975003-42975025 CTTGCTGAGCTCTGCATGCCTGG + Intergenic
1070300263 10:75198534-75198556 CTAGCTATGCATCCCAAGCCAGG + Intergenic
1076661625 10:132059461-132059483 CTTGCTGTGGTCACCACGCCAGG - Intergenic
1076671565 10:132123719-132123741 CTTCCTTTGCACCCCAAGCCTGG + Intronic
1076798965 10:132811917-132811939 GTTGCTGTGCCCCCCATGAGGGG - Intronic
1077177829 11:1198629-1198651 CTTGTTGGGCACCCCATCCAAGG + Intronic
1077280880 11:1744944-1744966 CTGGCTGTGGACCCCACGCCTGG - Intronic
1077332850 11:1990904-1990926 CTTGCTCTGCACCCACTGCTGGG + Intergenic
1079249010 11:18773574-18773596 ACTGCTGTGACCCCCATGCCAGG - Intronic
1081574393 11:44310157-44310179 GTGGCTGTGCACTCCTTGCCCGG + Exonic
1081961426 11:47140570-47140592 ATAGGTGTGCACACCATGCCCGG + Intronic
1084311343 11:68317907-68317929 CTTGCTGTGGACCCCCTGGGAGG + Intronic
1084371693 11:68749724-68749746 CTTGCTGTGGATTCCAAGCCTGG + Intronic
1085711206 11:78830527-78830549 CCTGCTGAGCCCTCCATGCCTGG + Intronic
1086014216 11:82145846-82145868 TTTGCTGCGCACCCCCTGACAGG - Intergenic
1089591656 11:119546014-119546036 CCGGCTATGCACCCCAGGCCTGG - Intergenic
1090830164 11:130415748-130415770 ACAGGTGTGCACCCCATGCCTGG + Intronic
1091302390 11:134515757-134515779 CCGGGTGTGCTCCCCATGCCAGG - Intergenic
1091312693 11:134585902-134585924 CTAGCTGTGCAACCCCAGCCTGG - Intergenic
1202815833 11_KI270721v1_random:46080-46102 CTTGCTCTGCACCCACTGCTGGG + Intergenic
1092720753 12:11438186-11438208 CTTGCTCTGGATCACATGCCTGG - Intronic
1095802256 12:46281426-46281448 CTTGCTCTGCCCACCAAGCCTGG + Intergenic
1097324199 12:58257404-58257426 CTTGCTCTCCACCCCACGACAGG + Intergenic
1104564978 12:129872413-129872435 CCTGCCGTGCATCCCCTGCCTGG + Intronic
1105325779 13:19369783-19369805 TTCGCTGAGCACTCCATGCCAGG + Intergenic
1105778063 13:23680970-23680992 TTTGCTGTCCTCCCCAAGCCAGG - Intergenic
1109533312 13:63682898-63682920 CTTGCTCTTCACCCCCTGACAGG + Intergenic
1115534901 14:34363811-34363833 CAGGCTGTGCACACCACGCCTGG - Intronic
1116201193 14:41799346-41799368 GTTGCTGTGCACACAATGCCTGG - Intronic
1119827355 14:77668536-77668558 CTTTTTTTGCACCCCATGTCTGG - Intergenic
1121414906 14:93772692-93772714 CTTCCTGGGCAGCCCTTGCCAGG - Intronic
1122177929 14:99934822-99934844 CATGCTGTGCACGCTATGCAGGG - Intronic
1124636223 15:31366577-31366599 CTGTCTGTGTACCCCATGCCCGG + Intronic
1129699279 15:77758331-77758353 CTGACTGTGCACCCCAAGGCGGG + Intronic
1130565040 15:84986808-84986830 CTTGCTGTGCTGCCCAGGCTAGG + Intronic
1132150478 15:99454933-99454955 CTGGCTGAGCTGCCCATGCCCGG - Intergenic
1132392817 15:101451049-101451071 CTTTCTGTAAACCCCAAGCCAGG - Intronic
1132559231 16:585631-585653 CTTGCTGCACAGCCCCTGCCTGG + Intergenic
1132655117 16:1038643-1038665 GTTGCTCTGCAGCCCACGCCGGG + Intergenic
1133044145 16:3076797-3076819 CTTCCTGTGCCCCCCTTTCCTGG + Intronic
1133099656 16:3471471-3471493 CTTGCTCTGCCCCCCAAGGCTGG - Intronic
1135192617 16:20367313-20367335 CTTGCTGTGCAGCCTCTGTCTGG + Intronic
1136717189 16:32290081-32290103 CTCTCTGTGCACCTCATGCCTGG - Intergenic
1136835563 16:33496335-33496357 CTCTCTGTGCACCTCATGCCTGG - Intergenic
1137283590 16:46998548-46998570 CTTGCTCTGCCCCCCAAGGCTGG - Intergenic
1137481758 16:48857720-48857742 GTTTCTGTGTTCCCCATGCCTGG - Intergenic
1137647515 16:50088774-50088796 CTGGCTGTGGACTCCCTGCCTGG - Intronic
1138528087 16:57620329-57620351 CTTGCAGTGCACAGCATGGCCGG + Intronic
1139634673 16:68250839-68250861 CTTGCTCTGCAACCCAGGCTGGG - Intronic
1139774186 16:69303984-69304006 CTTCCTGTGCCCCCCAGACCCGG + Exonic
1139993728 16:70961160-70961182 CTGACTCTGCTCCCCATGCCTGG - Intronic
1140900035 16:79358807-79358829 CTTGCTCTGGAGCCCATTCCTGG + Intergenic
1142151700 16:88515380-88515402 CTTGCTGTGCATCCCCAGGCAGG + Intronic
1142316051 16:89345775-89345797 CATGCTGTGCACACCAGGCTGGG + Intronic
1203009241 16_KI270728v1_random:227697-227719 CTCTCTGTGCACCTCATGCCTGG + Intergenic
1203145740 16_KI270728v1_random:1796648-1796670 CTCTCTGTGCACCTCATGCCTGG - Intergenic
1144638353 17:16924775-16924797 CAGGCTGTTCACCCCATGCCAGG + Intergenic
1144709115 17:17388725-17388747 CTTGCAGCCCACCCCCTGCCCGG + Intergenic
1145208561 17:20997140-20997162 CAGGCCGTCCACCCCATGCCAGG - Intergenic
1145236497 17:21212130-21212152 CTTGCTGTAAACCCCTAGCCAGG - Intronic
1146036122 17:29408253-29408275 CTTGCTGTGTCCCCCAGGGCTGG + Intronic
1147260723 17:39208564-39208586 CCCGCTGTCCACCCAATGCCTGG - Intergenic
1147314650 17:39613828-39613850 CCTGCTGTGGACCCCCTGCTTGG + Intergenic
1147931811 17:43986424-43986446 CTTCCTGTGCACCCCAAGACTGG + Intronic
1148219056 17:45849539-45849561 GCTGCTGTCCACCCCAGGCCTGG - Intergenic
1148609760 17:48956927-48956949 CTTGCTGTGTTACCCATGCTGGG - Intergenic
1150645994 17:66977822-66977844 CTTTCTGTGCCCACAATGCCCGG - Intronic
1150673337 17:67221872-67221894 CTCGCTGCGCAGCCCATGCTGGG + Intronic
1152078320 17:78171718-78171740 CCTGCTGTGCTCCCCCTGCAGGG + Exonic
1152727698 17:81955816-81955838 CCTGCAGTGCCCCCCATCCCAGG + Intronic
1153368607 18:4287676-4287698 CTTGCCCTCCACCCCATGACAGG - Intronic
1156684609 18:39629442-39629464 CTTGCTCTGCTCCCTATACCAGG - Intergenic
1159085487 18:63784928-63784950 CTTGCCCTGCACCTCATGCCTGG + Intronic
1160518614 18:79491704-79491726 CTAAATCTGCACCCCATGCCAGG - Intronic
1161711615 19:5851672-5851694 CCAGCTGTGCACCCAAAGCCAGG - Intergenic
1161908402 19:7174709-7174731 CTTGCTGTGCACCCCATGCCTGG - Exonic
1162561265 19:11419262-11419284 CCTGCTGTGCGCTCCATGGCCGG + Exonic
1163651615 19:18521414-18521436 CTCGCTGACCACCCCCTGCCGGG + Intronic
1164776162 19:30855308-30855330 CCGGCTTTGCACCCCCTGCCTGG - Intergenic
1167143014 19:47665130-47665152 CCAGCTGTGCTCCCCAAGCCAGG + Intronic
1167345962 19:48945985-48946007 AGTGCTGTGACCCCCATGCCTGG - Intergenic
1167478488 19:49714269-49714291 CTTGCTGTGTCCCCCAGGCTGGG - Intergenic
925725189 2:6865309-6865331 CTTGCTGTGCGCCGCCGGCCTGG + Exonic
926341755 2:11909834-11909856 CTTGCAGAGAACCCCATGCATGG - Intergenic
927024284 2:19049661-19049683 CTTGCTCTGTCCCCCAGGCCAGG + Intergenic
927861542 2:26562912-26562934 CTGGCTGTGCCCCACTTGCCAGG - Intronic
928289938 2:30028202-30028224 CTTCCTGTGCACTCACTGCCAGG + Intergenic
928508439 2:31978627-31978649 CTTGCTGTGTTGCCCATACCCGG + Intronic
929179794 2:39025378-39025400 CTTGCTCTGTACCCCAGGCTAGG + Intronic
929808770 2:45170325-45170347 CTTGGTGTGCGCCCCAGTCCCGG + Intergenic
930817120 2:55609529-55609551 GTAGGTGTGCACACCATGCCTGG - Intronic
933108771 2:78370400-78370422 CTTGCTGTGGATCCCAGGCTGGG - Intergenic
933565319 2:83943396-83943418 CTTGCTGTGGGCCCCATCCTGGG - Intergenic
937669228 2:124521030-124521052 CTTGCCTTGAAACCCATGCCTGG + Intronic
938323638 2:130382516-130382538 CTTGCTGGGCAGCTCTTGCCTGG + Intergenic
943095418 2:183422413-183422435 CTTGCCTTGCACCCCCTGACAGG - Intergenic
944649768 2:201818133-201818155 CTTATTGAGCACCACATGCCAGG + Intronic
947593479 2:231397378-231397400 CTAACTGTGCACCCGCTGCCTGG + Intronic
948150993 2:235744503-235744525 CCTCCTGAGCACACCATGCCTGG - Intronic
948535184 2:238640639-238640661 CTTCCCCTGCACCCCATCCCAGG - Intergenic
1168738573 20:167784-167806 CTTGCTGTGTAGCCCAGGCTGGG + Intergenic
1168758234 20:330555-330577 TTTACCGTGCACCCCATTCCAGG - Intergenic
1171458364 20:25284413-25284435 TTTTCTGTGTGCCCCATGCCAGG + Intronic
1172086871 20:32392142-32392164 CTTGCTGTGCCACCCAGGCTGGG + Intronic
1172543964 20:35744729-35744751 CTTGCTCTGCAGCCCAGGCTGGG - Intergenic
1174076452 20:47940889-47940911 GTAGCTGTGCAGCCCTTGCCAGG - Intergenic
1175383095 20:58577183-58577205 CTTTATGTGTACCCCATCCCAGG + Intergenic
1175941643 20:62540052-62540074 CCTGATGTGAACCCCATTCCTGG - Intergenic
1176011311 20:62897849-62897871 GTTGAGGTGCACCGCATGCCGGG + Intronic
1180060302 21:45381599-45381621 TTGGCTGTGGCCCCCATGCCTGG - Intergenic
1182102388 22:27667328-27667350 GTGGCTGTGCGCCCCAGGCCCGG + Intergenic
1182676283 22:32042306-32042328 CTGGCCCTGCAGCCCATGCCAGG - Intergenic
1182913765 22:34009355-34009377 CTTGCTGTGTGCCCCATTGCAGG + Intergenic
1183096628 22:35555861-35555883 GTTGCTGTCAACCCCATTCCAGG - Intergenic
1183588451 22:38766607-38766629 CTCACTGGGAACCCCATGCCTGG - Intronic
1184504255 22:44891478-44891500 CTGGCTGGACACCCCCTGCCAGG + Intronic
949127126 3:459483-459505 CTTGCTGTGCATCTCTTGGCAGG + Intergenic
950015262 3:9750484-9750506 ATTCCTTTGTACCCCATGCCAGG - Intronic
950097869 3:10340449-10340471 CTTGCTGCCCACCCCGGGCCTGG + Intronic
950175637 3:10872177-10872199 CTTGCTATGACCCCCATGTCTGG + Intronic
950416837 3:12873670-12873692 TTTGCTGTTTACCCCATCCCAGG + Intergenic
953310687 3:41875359-41875381 CTTGCTGTGTACCAGGTGCCAGG - Intronic
954499318 3:50995925-50995947 CTTGCTTTGTACCCCAGGCTGGG + Intronic
954506196 3:51076625-51076647 CTTGCTCTGAAGCCCATGCATGG + Intronic
954696215 3:52428381-52428403 CAGGCTGAGCACCCCAGGCCCGG - Intergenic
956318074 3:67961822-67961844 CTTGCTCTCCACCCCCTGACAGG - Intergenic
960484413 3:118233992-118234014 CTTGCTCTGCAGCCCAAGCTTGG + Intergenic
961362203 3:126375162-126375184 CTGGCTGAGCAGCCCATCCCAGG - Intergenic
961935843 3:130582840-130582862 GTTGCTGTCCACCCCATCCTTGG + Intronic
962606348 3:137035717-137035739 CTTGCTGTGCGCCCCTCTCCTGG - Intergenic
964736972 3:159927657-159927679 CTTGCAGTGGACCCGAGGCCTGG - Intergenic
967366961 3:188698199-188698221 TTTGCTGTGCCCCACATGCCTGG - Intronic
967667392 3:192189636-192189658 TTTTCTGTGCACACCATGCCTGG - Intronic
968659285 4:1792603-1792625 CGGGCTGTGCTCCCCAAGCCAGG + Intergenic
968981940 4:3854917-3854939 CTGTCTGTGCAACCCAAGCCAGG - Intergenic
969224691 4:5787824-5787846 CTGGCTCTGCACCCCACTCCGGG + Intronic
973748061 4:53984101-53984123 CCTGCTGTGAACCTCATGCCTGG - Intronic
974011655 4:56612959-56612981 TTTGCTGGGCACCCCAAGCATGG - Intergenic
976003865 4:80404354-80404376 CTCGCTGTGCACCCTATCTCTGG + Intronic
976638434 4:87311679-87311701 CTGGCTGTTCAGTCCATGCCTGG - Intronic
978779384 4:112533994-112534016 CTAGCTCTGCACTCCATGCCTGG + Intergenic
985421626 4:189790342-189790364 CTTGCTGTGCACAACCTTCCCGG + Intergenic
986019739 5:3790138-3790160 TTTGTTGGGCTCCCCATGCCTGG - Intergenic
986077644 5:4354523-4354545 CTTGCTGACAATCCCATGCCTGG + Intergenic
987076010 5:14382479-14382501 CTTGCTGCGCCCCCCATGCCTGG - Intronic
994102363 5:95907924-95907946 CATGCTGGGCTCCCCAGGCCTGG + Intronic
994255905 5:97595740-97595762 CTTGCTCTGCACCCCACAACAGG + Intergenic
994497873 5:100535855-100535877 CTTGCTGTGAGCCCCAACCCTGG + Exonic
996556044 5:124779858-124779880 ATAGCAGTGCACCCCATGTCTGG + Intergenic
998127447 5:139634200-139634222 GTGGCTGAGCCCCCCATGCCTGG + Intergenic
998137374 5:139681241-139681263 CTGGCTGAGTACCCCATGCAGGG + Exonic
998718320 5:144911539-144911561 CTTGCCGTCCACCACATGACAGG - Intergenic
1000624800 5:163526774-163526796 CTTACTGACCACCCCATCCCTGG - Intergenic
1002296718 5:178235451-178235473 CTGGCTGTGCATCCCTGGCCAGG + Intergenic
1002830735 6:818109-818131 TTTTCTGTGCACCTCATTCCTGG + Intergenic
1002830740 6:818145-818167 TTTTCTGTGCACCTCATTCCTGG + Intergenic
1002830745 6:818181-818203 TTTTCTGTGCACCTCATTCCTGG + Intergenic
1004331097 6:14721988-14722010 CTTGCTGTGCCACCCAGGCTGGG - Intergenic
1007105265 6:39279455-39279477 CCTCCTGAGCAGCCCATGCCAGG + Intergenic
1008039010 6:46776161-46776183 ATTGCTGAGCACCTGATGCCAGG - Intergenic
1009971820 6:70632764-70632786 GTAGGTGTGCACACCATGCCTGG - Intergenic
1012997024 6:105984422-105984444 CTTGCTGTCCCCCCTCTGCCTGG - Intergenic
1013305315 6:108842047-108842069 CTTGCTGAGTATCCCATGGCAGG + Intergenic
1015490135 6:133815505-133815527 GATGCTGTGCTCCTCATGCCAGG + Intergenic
1016865778 6:148764812-148764834 CCTGCTGTGCACACAATGTCAGG + Intronic
1018907259 6:168082844-168082866 CCTGCTGCGCACCCCAACCCAGG - Intergenic
1019008790 6:168825505-168825527 CTTGCTGTGCCCCCGCTGGCCGG + Intergenic
1019478536 7:1255552-1255574 CTGGCTGGGCACCCCAGCCCCGG - Intergenic
1019599461 7:1874040-1874062 CTCTCTGAGCACCCCATGCTAGG + Intronic
1019637230 7:2082369-2082391 CTTGCTGAGCTCCCCAGGCCTGG - Intronic
1019903454 7:4042587-4042609 CTTGCTGTGCCTCCAATGGCAGG - Intronic
1021020072 7:15587002-15587024 CTTGCTGTGCACGCATTGTCAGG + Intergenic
1023666340 7:42527038-42527060 CTTGCTGGGGATCCCAGGCCTGG - Intergenic
1030311422 7:108073033-108073055 CTTGCTCTGCTGCCCAGGCCTGG + Intronic
1030591031 7:111481993-111482015 CTTGCTATGCTGCCCATGCTGGG - Intronic
1031333773 7:120499938-120499960 TGTGCTGGGCACCCCATGCTAGG - Intronic
1034440194 7:151082289-151082311 GTTGCTGTGAACCCCGTGCTGGG + Exonic
1034619401 7:152445622-152445644 CTTGCTATGGCCCCCATGGCCGG + Intergenic
1035710401 8:1709093-1709115 CTTTCTATGCACTCCTTGCCTGG + Intergenic
1036196689 8:6723381-6723403 CTGGCTGTGCTGCCCATGCTGGG + Intronic
1036531326 8:9590556-9590578 CTTACTTTGCACCACATCCCTGG + Intronic
1037765228 8:21768573-21768595 CCCTCTGTGCACCCCAGGCCCGG - Intronic
1037952201 8:23026904-23026926 CTTGCTGTGTCCCCCGAGCCTGG - Intronic
1038327313 8:26581402-26581424 CTTGCTGTGTAACCCAGGCTGGG + Intronic
1041292009 8:56317085-56317107 CTACCTGTGAACCCCATGGCGGG + Intronic
1044084646 8:87928865-87928887 CTAAATGTGCACCCCATACCTGG - Intergenic
1044999020 8:97864275-97864297 CTTGCTGTGTTGCCCAAGCCAGG + Intergenic
1046580667 8:116088590-116088612 CTTTCTGTCTACCCCTTGCCAGG + Intergenic
1047667867 8:127112110-127112132 CCTGAGGTGCTCCCCATGCCAGG - Intergenic
1047765301 8:127985563-127985585 CCTGCCCTGCACCCCATGCTCGG + Intergenic
1048183867 8:132220964-132220986 CCTGCTCTCCACCCCATGACAGG + Intronic
1049424340 8:142531443-142531465 CTCCCTGTGCACCCCACGCCTGG - Intronic
1049720201 8:144112113-144112135 CTTGCTGTGCACCCTACGGTGGG - Exonic
1051768056 9:20545986-20546008 CTTGCTGTGCTGCCCAGGCTAGG - Intronic
1053352940 9:37425149-37425171 CCTGCTGTGAACCCCTTGGCGGG + Intronic
1059498447 9:114729932-114729954 CTTGCTCCCCACCCCATGACTGG - Intergenic
1060243665 9:121926201-121926223 CTGGCTGTGCACCCCAGCCCCGG - Intronic
1060632626 9:125173434-125173456 ACAGCTGTGCACCCCACGCCTGG - Intronic
1060973062 9:127749743-127749765 CTTGCTGTGCCCCCTAATCCTGG - Intronic
1061420405 9:130470396-130470418 CTTCCTGTGGACCCCAGGACAGG - Intronic
1061866339 9:133493509-133493531 CTTGCTATGCAGGCCATGGCTGG + Intergenic
1186880828 X:13864477-13864499 TTTGCTGTGCCCCACGTGCCTGG - Intronic
1188217912 X:27501764-27501786 CTTCCTCTCAACCCCATGCCAGG - Intergenic
1189534355 X:41922457-41922479 CTTTGTGTACACCCCATGCTCGG - Intronic
1192229296 X:69254050-69254072 CTGGCTGGAGACCCCATGCCAGG - Intergenic
1198182637 X:134224192-134224214 TTTGCTGTGGACCCCAGGACTGG - Intergenic
1199657192 X:150007751-150007773 CTGGCTTTGCACCCTTTGCCTGG - Intergenic