ID: 1161908409

View in Genome Browser
Species Human (GRCh38)
Location 19:7174751-7174773
Sequence AGAGAGAAAGAGAAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12411
Summary {0: 2, 1: 21, 2: 306, 3: 2052, 4: 10030}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161908401_1161908409 20 Left 1161908401 19:7174708-7174730 CCCAGGCATGGGGTGCACAGCAA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG 0: 2
1: 21
2: 306
3: 2052
4: 10030
1161908402_1161908409 19 Left 1161908402 19:7174709-7174731 CCAGGCATGGGGTGCACAGCAAG 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG 0: 2
1: 21
2: 306
3: 2052
4: 10030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161908409 Original CRISPR AGAGAGAAAGAGAAAGGGGA GGG Intronic
Too many off-targets to display for this crispr