ID: 1161912714

View in Genome Browser
Species Human (GRCh38)
Location 19:7206542-7206564
Sequence ACAATAGGGTTCACGCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161912714_1161912717 -6 Left 1161912714 19:7206542-7206564 CCTAGGAGCGTGAACCCTATTGT No data
Right 1161912717 19:7206559-7206581 TATTGTGAACTGTGCATGCGAGG No data
1161912714_1161912720 2 Left 1161912714 19:7206542-7206564 CCTAGGAGCGTGAACCCTATTGT No data
Right 1161912720 19:7206567-7206589 ACTGTGCATGCGAGGGATCTGGG No data
1161912714_1161912718 -5 Left 1161912714 19:7206542-7206564 CCTAGGAGCGTGAACCCTATTGT No data
Right 1161912718 19:7206560-7206582 ATTGTGAACTGTGCATGCGAGGG No data
1161912714_1161912719 1 Left 1161912714 19:7206542-7206564 CCTAGGAGCGTGAACCCTATTGT No data
Right 1161912719 19:7206566-7206588 AACTGTGCATGCGAGGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161912714 Original CRISPR ACAATAGGGTTCACGCTCCT AGG (reversed) Intronic