ID: 1161915604

View in Genome Browser
Species Human (GRCh38)
Location 19:7225755-7225777
Sequence GGACCCCTGGACCAGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161915604_1161915616 25 Left 1161915604 19:7225755-7225777 CCAGCACCCTGGTCCAGGGGTCC 0: 1
1: 0
2: 1
3: 44
4: 312
Right 1161915616 19:7225803-7225825 AGGAGACACCTGGCAGTGTCTGG 0: 1
1: 8
2: 36
3: 223
4: 826
1161915604_1161915611 5 Left 1161915604 19:7225755-7225777 CCAGCACCCTGGTCCAGGGGTCC 0: 1
1: 0
2: 1
3: 44
4: 312
Right 1161915611 19:7225783-7225805 TGGAGGCGATTCTGCCCACCAGG 0: 1
1: 0
2: 4
3: 20
4: 152
1161915604_1161915612 15 Left 1161915604 19:7225755-7225777 CCAGCACCCTGGTCCAGGGGTCC 0: 1
1: 0
2: 1
3: 44
4: 312
Right 1161915612 19:7225793-7225815 TCTGCCCACCAGGAGACACCTGG 0: 1
1: 0
2: 1
3: 37
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161915604 Original CRISPR GGACCCCTGGACCAGGGTGC TGG (reversed) Intronic
900171763 1:1272887-1272909 GTTCCCCTGGAGCAGGGCGCGGG + Intronic
900185505 1:1331387-1331409 GGGCCCCCGTCCCAGGGTGCAGG - Exonic
900998961 1:6137940-6137962 GGGGGCCTGGACCTGGGTGCTGG + Intronic
901058914 1:6462705-6462727 AGCCTCCTGGACCTGGGTGCTGG + Intronic
901235866 1:7667339-7667361 GGAGGCCAGGATCAGGGTGCGGG + Intronic
901534089 1:9871453-9871475 GGACCCCTGGACCAAGTTTAAGG - Intronic
901624736 1:10617531-10617553 GGACCCCAAGAGCAGGGTGCTGG - Intronic
902368124 1:15990450-15990472 GGCCTCCTGGGCCAGGGTGCTGG - Intergenic
902635590 1:17733174-17733196 GTAGCCCTGCTCCAGGGTGCTGG + Intergenic
903735640 1:25528497-25528519 GGACCCCTGCACCAGGCAGATGG + Intergenic
903767310 1:25743095-25743117 AGACCACTGGACCAGGGCACTGG - Intronic
903883789 1:26529851-26529873 GGACCCCAGGACCCGGGAGGCGG + Intronic
904563352 1:31413197-31413219 GGACCTCGGGATCCGGGTGCCGG - Intronic
905110272 1:35589706-35589728 GGGCTCCTGGAGCTGGGTGCTGG + Intronic
905128290 1:35731627-35731649 GGAATCTTGGACCAGGGGGCTGG + Intronic
905300760 1:36984987-36985009 GGAGCCCTTGACCACTGTGCTGG - Intronic
905915091 1:41679019-41679041 GGACCCATGGCCCAGGGAGAAGG + Intronic
906207885 1:43996790-43996812 GGTCCCCTTCCCCAGGGTGCTGG + Intronic
906306749 1:44724524-44724546 GAACCCCCGGCCCAGGGTCCTGG + Exonic
907842981 1:58174437-58174459 GGACCCCTGGACCGACCTGCTGG + Intronic
907962981 1:59299681-59299703 GCACACCTGGACAAGGGTGGGGG + Intronic
908300991 1:62761136-62761158 GGACCCCTGGACCGACCTGCTGG + Intergenic
908798382 1:67853802-67853824 AGACCCCTACACCAGGGGGCAGG + Intergenic
909440397 1:75689966-75689988 GGACCCTTAGACCAGGCAGCTGG + Intergenic
913221279 1:116662674-116662696 GGACCATTTGACAAGGGTGCAGG - Intronic
913470085 1:119178717-119178739 GGACCCCTGGACCGACGTGCTGG + Intergenic
915580679 1:156811268-156811290 GGAGGCCTGAACTAGGGTGCTGG - Intronic
916142460 1:161711416-161711438 GGATCCCAGGACCAGGGCTCTGG - Exonic
918303666 1:183226927-183226949 TGACACCTGGACCAGGTGGCTGG + Intronic
919613525 1:199776760-199776782 GGAGCCTTGGGCCAGGGTGCAGG - Intergenic
919921653 1:202169720-202169742 AGGCCCCTGGAGCAGGATGCTGG - Intergenic
922199954 1:223393382-223393404 GGACCTCGGGACCGGGGGGCAGG + Intergenic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
924707916 1:246513260-246513282 GGCCTCCTGGGCCAGGGTGCCGG + Intergenic
1063321154 10:5053809-5053831 GGACCCCTGGACCAACCTGCTGG - Intronic
1063415282 10:5868241-5868263 GGACCCCTGGACCAAACTGCTGG + Intronic
1063662092 10:8042018-8042040 TGACTCCAGGACCAGGGTTCTGG + Intergenic
1066293510 10:34035054-34035076 GGACCCCTGGACCAACCCGCTGG + Intergenic
1067262640 10:44707540-44707562 GGACACCTAGACCAAGGTTCGGG + Intergenic
1067469191 10:46523735-46523757 GGAGTCCTGGACGTGGGTGCAGG + Intergenic
1068334823 10:55621387-55621409 GGACCCCTGCTCTGGGGTGCGGG - Intronic
1069546182 10:69330513-69330535 GGAGCCCTGGACCACCGTTCTGG - Intronic
1070005389 10:72419491-72419513 GGACCTCTGAACCAGGCTGTGGG - Intronic
1070753344 10:78976701-78976723 GGGTCCCTGGAGAAGGGTGCTGG - Intergenic
1071150602 10:82630007-82630029 GGACCCATGGACCAGGAGCCAGG + Intronic
1073114125 10:101081401-101081423 GGACTCCTGGGGAAGGGTGCAGG + Intergenic
1073289059 10:102404467-102404489 TGTCCCCTGCACCAGGATGCTGG - Intronic
1074291416 10:112140384-112140406 CCCCGCCTGGACCAGGGTGCAGG - Intergenic
1074663477 10:115690558-115690580 AGACCCCTGGACCAGAGTACTGG + Intronic
1074742344 10:116497414-116497436 GGACCCCTGGACCAACCTGCTGG - Intergenic
1076768456 10:132650516-132650538 TGACCCCTGCACCAGGCAGCGGG - Intronic
1076894361 10:133302605-133302627 CCACCCCTGGGTCAGGGTGCAGG - Intronic
1076894389 10:133302697-133302719 CCACCCCTGGGTCAGGGTGCAGG - Intronic
1077224350 11:1433614-1433636 GGACCCCTGCCCCGGGATGCAGG + Intronic
1079330591 11:19529658-19529680 GGAACCCTGGACCTCTGTGCTGG - Intronic
1081753532 11:45528943-45528965 GAACCTCTGCACCAGGGTTCAGG - Intergenic
1081867298 11:46366838-46366860 GGCCCCCAGGGCCAGGGTGCTGG - Exonic
1083442750 11:62687912-62687934 GGCCGCGTGGACCAGAGTGCGGG + Exonic
1083639124 11:64135918-64135940 GGACCCCTGGAGCAGCTTCCCGG + Intronic
1083796553 11:65020211-65020233 GCAGCCCTGGGCCAGGGTTCTGG - Intronic
1084494629 11:69496874-69496896 TGAGCCCTGGACCAGGATGCAGG + Intergenic
1084963674 11:72732310-72732332 GGAACCTTGGAACAGGGTGGGGG - Intronic
1085398418 11:76219556-76219578 AGACCCCTGCACCAGGGTTATGG - Intergenic
1086372371 11:86168028-86168050 GGAGCCCTGGGCCAGAGTCCAGG + Intergenic
1087462446 11:98462610-98462632 GGAACCCTGCACCAGAATGCAGG - Intergenic
1088493180 11:110406314-110406336 GGACCCCTGGACCAACCCGCTGG + Intergenic
1093580257 12:20778122-20778144 GGACCCCTGGACCCACCTGCTGG - Intergenic
1093894770 12:24563162-24563184 TGACCACTGGACTAGGGGGCCGG - Intergenic
1094821746 12:34231531-34231553 GGATCCCTTGACCAGGGAGGTGG + Intergenic
1094834621 12:34316451-34316473 GGAGCCCTGGAGCAGGGCCCTGG - Intergenic
1095941943 12:47733120-47733142 TGCACCCTGGACCAGGGAGCTGG - Intergenic
1095952611 12:47790007-47790029 GGACCCCAGGGGCAGGGAGCTGG + Intronic
1096143774 12:49264530-49264552 CGACGCCGGGACCAGGCTGCGGG - Intronic
1096477582 12:51917792-51917814 GGCTCCTTGGACCAGGCTGCAGG + Intronic
1096626592 12:52899658-52899680 GGAATCCTAGACCAGGGTTCAGG - Intronic
1102035590 12:109768967-109768989 GGCCCCGTGGAACAGTGTGCTGG + Exonic
1102198530 12:111041730-111041752 GGACCCCTGGCACAGGGCCCTGG - Intronic
1102480877 12:113222089-113222111 GGAACACTGGACCAGGACGCAGG + Intronic
1104536318 12:129621268-129621290 GGCCCCCTGGAACAGAGAGCTGG - Intronic
1104573363 12:129944836-129944858 GGTGTCCTGGACCAGGGTGGTGG - Intergenic
1107749580 13:43550237-43550259 GGACCCCTGCTCTAGGGTGCAGG + Intronic
1108837722 13:54572578-54572600 GGACCCTTGGAGCCAGGTGCGGG - Intergenic
1110403082 13:75116528-75116550 GGACCAGTGTACCAGGGTCCTGG - Intergenic
1113863099 13:113502911-113502933 GCTCCCCAGGCCCAGGGTGCTGG - Intronic
1113882113 13:113632934-113632956 GGACCACTGGGCCTGGGGGCTGG + Intronic
1115707548 14:36014280-36014302 GGACCCCTGGACAATGGAACCGG - Intergenic
1117328141 14:54687640-54687662 GGTCCCCTGGACAAGGGGTCAGG + Intronic
1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG + Exonic
1121955383 14:98208275-98208297 GGACCCATGGACATGGGTCCAGG - Intergenic
1122774303 14:104110474-104110496 AGAGTCCTGGACCAGGGTTCTGG - Intronic
1122805348 14:104253612-104253634 AGACCCCAGGACCAGGGCGGAGG - Intergenic
1124355933 15:28994832-28994854 AGACCCCAGGACCAGATTGCAGG + Intronic
1124633911 15:31353081-31353103 GGGACCCTGGGCCAGGGGGCTGG + Intronic
1124640558 15:31393512-31393534 GGACCGAGGGACAAGGGTGCTGG - Intronic
1125249063 15:37678392-37678414 GAAACCCTGGACTAGAGTGCTGG + Intergenic
1125420519 15:39499958-39499980 GCACGCCTGGGCCATGGTGCTGG + Intergenic
1125608254 15:40954286-40954308 GGAACCCTGGCCCAGTGTGAAGG + Intronic
1128559949 15:68658238-68658260 GGAGCCCTGGACCAGGGAGAGGG + Intronic
1129389768 15:75214693-75214715 GGACCCCTTTTCCAGGGTGGCGG + Intergenic
1129573439 15:76715286-76715308 GGATCCCTGGGCCGGGGTGGGGG - Intronic
1130108571 15:80947007-80947029 AGGCCCATGGACCAGAGTGCTGG + Exonic
1130914266 15:88292221-88292243 GGGGCCGTGGACCAGGCTGCTGG + Intergenic
1131060308 15:89400202-89400224 GGACACCGGGACCAGGGCACAGG - Intergenic
1131277139 15:90991741-90991763 GGTGACCTGGACCAGGGTGGGGG - Intronic
1131334147 15:91531426-91531448 AGAACCGTGGGCCAGGGTGCTGG - Intergenic
1132179518 15:99741934-99741956 GGTCCCCAGGGCCAGGGTGTGGG + Intergenic
1132578910 16:676273-676295 CGACCCCTGGACCAAAGGGCTGG - Intronic
1132680837 16:1141126-1141148 GGACCCTTGGACCTGTGGGCAGG + Intergenic
1132897620 16:2236489-2236511 GGATCCCGGGTCCAGGCTGCGGG - Exonic
1133025475 16:2987331-2987353 GGCCTTCTGGACCAGGGTGCAGG + Intergenic
1133231567 16:4369452-4369474 AGACCCCTGGACCTGGGTCAGGG - Intronic
1133697252 16:8276495-8276517 GGACACCTGGAGCAGCATGCTGG + Intergenic
1134673493 16:16073175-16073197 GTACCCCTGGAGGAGGGTGATGG + Intronic
1135339065 16:21630654-21630676 GGACCCCTGGACCAACCCGCTGG - Intronic
1136776178 16:32873005-32873027 GGACCTCTGGGGCAGGGGGCTGG + Intergenic
1136894437 16:33988507-33988529 GGACCTCTGGGGCAGGGGGCTGG - Intergenic
1137026957 16:35486309-35486331 GGACCCCAGGGCCAGGGTAGGGG - Intergenic
1138317160 16:56080298-56080320 GGAGCCCCGGATCAAGGTGCTGG + Intergenic
1139440463 16:66964082-66964104 GGACCCCTCTCCCAGGGTGGAGG - Intronic
1139507649 16:67407212-67407234 GGACAGCTGGCCCAGGGTCCAGG + Intronic
1141486446 16:84343351-84343373 GGACCCCGGGCCCAGCGTGATGG - Intergenic
1142302515 16:89266788-89266810 TGTCCCCTGTACCTGGGTGCTGG - Intergenic
1203078594 16_KI270728v1_random:1135114-1135136 GGACCTCTGGGGCAGGGGGCTGG + Intergenic
1142572007 17:880905-880927 GGAGCCCTGGCCCAGGCTGTGGG - Intronic
1143212993 17:5203333-5203355 GGAGCCCTGCACCAGAATGCAGG - Intergenic
1143618410 17:8067311-8067333 GGACCCTGGGACCAGTCTGCAGG + Intergenic
1145760929 17:27425252-27425274 GGCCTCCTGGGCCAGGGTGCCGG - Intergenic
1145765791 17:27457244-27457266 GCACCCGTGGGCCAGGGTGACGG + Intronic
1145971485 17:28959058-28959080 GGACCCCGGGACCTCAGTGCTGG - Exonic
1146160969 17:30559409-30559431 GGCCTCCTGGGCCAGGGTGCCGG - Exonic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1147725353 17:42563333-42563355 GGGACCCTGGACTAGGGTGGAGG + Intronic
1148759351 17:49991465-49991487 GGACCCCAGGACCAGGCAGAAGG - Exonic
1149649758 17:58269403-58269425 GAACCCCTGTGCCAGGCTGCTGG + Intergenic
1151574293 17:74943933-74943955 GGACACCTGGAGTTGGGTGCAGG - Intronic
1151680640 17:75620973-75620995 GGACCCCTGGGACAGGGCACTGG + Intergenic
1152396469 17:80036234-80036256 GGACCCCTGGAGAAGGGCACCGG + Intergenic
1152656983 17:81524324-81524346 TGCTCCCTGGACCAGGGGGCTGG + Intergenic
1152797836 17:82316668-82316690 TGTCACCAGGACCAGGGTGCCGG + Exonic
1153761187 18:8334183-8334205 GGAACCCAGGACAAGGGTGTTGG - Intronic
1154064752 18:11096409-11096431 GGAGCCCGGGACCAGGCTCCTGG - Intronic
1156468330 18:37362019-37362041 GGACCCCAGGACCCAGGTGAAGG - Intronic
1157298210 18:46461123-46461145 GGAGCCCTGGACTGGGGAGCCGG + Exonic
1157842069 18:50968050-50968072 GGACAGCTGGGCCAGGGTGCGGG + Exonic
1158589721 18:58768997-58769019 GGGCCCCTGGGGCAGGGGGCAGG + Intergenic
1158790038 18:60768355-60768377 TGAGCCCTGTACCAGGGTTCTGG - Intergenic
1159897238 18:74008825-74008847 GGACTCCTGCACCCGGATGCTGG + Intergenic
1160232424 18:77058327-77058349 GGACCCCTGCTCCACGCTGCGGG + Intronic
1160371782 18:78378086-78378108 GGATCCCTGGAGCAGGGGTCTGG - Intergenic
1160488186 18:79312455-79312477 GGACCCCTGGTCTGGGGTGAGGG - Intronic
1160879082 19:1311367-1311389 GGACCCCTGGACCCGGCTTAAGG + Intergenic
1161006880 19:1941455-1941477 GGCGCCCAGGGCCAGGGTGCAGG - Intronic
1161597633 19:5159009-5159031 GGACCCCTGGACCAACCTGCTGG - Intronic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1163662457 19:18587009-18587031 GGACCCCTAAACCAGCCTGCCGG + Intronic
1165245926 19:34498320-34498342 GGGTCCCTGGAGCAGGGTGAAGG - Intronic
1165246480 19:34500919-34500941 GGAGCCCTGGAAGAGGGAGCAGG - Exonic
1165405624 19:35629196-35629218 GGACCCGTGGTCCCGGGTCCTGG + Exonic
1166338151 19:42121598-42121620 CTACCCCTGGACCAGGCTGGAGG + Intronic
1167866389 19:52332063-52332085 GGACCCCGGGACGAGTCTGCCGG + Intergenic
1168122044 19:54256964-54256986 GGGCCCCAGGACCTGCGTGCAGG - Exonic
1168134117 19:54338869-54338891 GGGCCCCAGGACCCGGGTGCAGG - Exonic
925046676 2:777839-777861 GGCCCCCTAAACCTGGGTGCTGG - Intergenic
925141261 2:1551091-1551113 GGACGCCGGGGCCAGGGTGAGGG + Intergenic
925585546 2:5460816-5460838 GGACCCCATGACCGGGTTGCTGG + Intergenic
926863136 2:17329974-17329996 GAGCCCAAGGACCAGGGTGCAGG + Intergenic
927872702 2:26633745-26633767 GGAGCCATGGCCCAGGCTGCTGG - Intronic
928293583 2:30061488-30061510 AGACCCATGGACTAGGGTGATGG - Intergenic
929111162 2:38406244-38406266 GGACCCCTGGAGTAGGGAGAGGG + Intergenic
929330763 2:40677659-40677681 GTACCCCTGGACCAATGGGCTGG + Intergenic
931540887 2:63327886-63327908 GGACCCCTGGACCAACCCGCTGG + Intronic
931665371 2:64606590-64606612 GGACAGCTGGCCCAGGGAGCAGG - Intergenic
931762533 2:65431040-65431062 GGACCCCTGGACCGCGAGGCAGG + Intronic
932142850 2:69294878-69294900 GGAGCCCTGCAGGAGGGTGCTGG - Intergenic
932446322 2:71783887-71783909 ACAGCCCTGGACTAGGGTGCTGG + Intergenic
932466564 2:71927911-71927933 GGAACCCTGGCCCAGGTTGTTGG + Intergenic
936105036 2:109615672-109615694 GGAGCCCTGGACGAGGGTGACGG + Exonic
937457097 2:122051886-122051908 GGACCCTTGGAGCCAGGTGCGGG + Intergenic
941537238 2:166739183-166739205 GGACCCCTGGACCGACCTGCTGG - Intergenic
942661535 2:178270113-178270135 GGACCCCTGCAGCAGGGTTGGGG + Intronic
943690965 2:190869201-190869223 GGAGCACTGGACCAGAATGCAGG + Intergenic
946206046 2:218109404-218109426 GGACCTCTGGACCAACCTGCTGG - Intergenic
946315220 2:218906861-218906883 AGAACCATGGACCAGGGGGCAGG + Intergenic
946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG + Intronic
947984919 2:234439812-234439834 AGAGGCCTGGCCCAGGGTGCTGG + Intergenic
948219922 2:236261467-236261489 GGACTTCAGGACAAGGGTGCAGG - Intronic
948293077 2:236841796-236841818 GGACCTCTAGACCAGGCTCCTGG - Intergenic
948364029 2:237443071-237443093 GGATCCCAGGACCAGGGTCCAGG + Intergenic
948455471 2:238102594-238102616 GGACCCCTAGAGCCGGGCGCTGG + Intronic
948478434 2:238236065-238236087 GAACGCCTGGGCCAGGGTGCAGG + Intergenic
1169423235 20:5475899-5475921 AGACTCCTGGACCACAGTGCAGG + Intergenic
1169778007 20:9277056-9277078 GAAGCCCTGGACCAGGTTCCTGG + Intronic
1170697693 20:18674713-18674735 GGAGCCCTAGACCATGGTGATGG + Intronic
1171723197 20:28587233-28587255 TGAGCCCTGGAACATGGTGCTGG + Intergenic
1172340973 20:34157367-34157389 GGACCCCTGGACCAATCTGCGGG + Intergenic
1172816163 20:37688475-37688497 GGACCCATGGACCTGGATGTTGG + Intergenic
1174040210 20:47694215-47694237 GGAGGCCTGGGCCAGGGTGGCGG + Intronic
1174173831 20:48632729-48632751 GCCCCCCTGGACCTGGGGGCAGG - Intronic
1174174285 20:48635288-48635310 GGACCCTTGAACCTGGGTGGTGG - Intronic
1174364524 20:50048494-50048516 GGGCACCTGGGCCAGGCTGCTGG + Intergenic
1174619424 20:51862858-51862880 GGACCCTTGGACCATGGGGATGG - Intergenic
1175305091 20:57970421-57970443 GGACCCCTGGGAGATGGTGCAGG - Intergenic
1175561544 20:59934113-59934135 GGACCGGGGGACCAGGGCGCCGG + Intronic
1175838119 20:62009317-62009339 GGAACCCTGGGCCATGGGGCAGG + Intronic
1175846297 20:62060727-62060749 GGAGGCCTGGACCTGGGTGGAGG - Intronic
1175874357 20:62222350-62222372 GGGCCCCTGGATCTTGGTGCAGG - Intergenic
1176004404 20:62852383-62852405 GGACCCCAGTTCCAGGGTTCTGG - Intronic
1176180424 20:63747147-63747169 GGGCCCCTGGACCATGGCGGCGG - Exonic
1176232860 20:64040885-64040907 GGAGCCATGGGCCAGGATGCAGG - Intronic
1179457085 21:41507494-41507516 GGACCGCTGGGCCAGGCTGCTGG - Intronic
1179618219 21:42595394-42595416 GGATCCTTGGAGCGGGGTGCTGG + Intergenic
1179627647 21:42657698-42657720 GGACCCCTGGGCCAGGCTGTGGG + Intronic
1180694398 22:17742625-17742647 GAAGGCCTGGACCAGGGTCCGGG + Intronic
1180844249 22:18972820-18972842 TGACCACTGGCCCATGGTGCAGG - Intergenic
1181032226 22:20154212-20154234 GGACACCTGGCCCTGGCTGCTGG + Intergenic
1181040086 22:20187984-20188006 GGACCCCAGGCCCTGGCTGCAGG + Intergenic
1181057222 22:20265891-20265913 TGACCACTGGCCCATGGTGCAGG + Intronic
1182622677 22:31626554-31626576 GGAGGCCTGGAGCAGGGAGCTGG - Intronic
1183028987 22:35087822-35087844 GGAGCCCTGGGCCAGGCAGCAGG + Intergenic
1183248835 22:36713905-36713927 GGACCCAGGGAAGAGGGTGCAGG - Intergenic
1183717222 22:39540503-39540525 GGTGCCCTGGACCAGGAGGCAGG + Intergenic
1184287273 22:43478724-43478746 GGACCCAGGGACCTGGGTTCTGG - Intronic
1184341271 22:43887377-43887399 GTCCCCCTGTACCAGGCTGCGGG + Intronic
1184785654 22:46670468-46670490 GGACCCCTAGGCCTGGGTCCAGG + Intronic
1185057147 22:48587005-48587027 CGACCCCCTGTCCAGGGTGCAGG + Intronic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185187031 22:49407341-49407363 AGAGCCTTGGACCAGGCTGCGGG + Intergenic
1185187046 22:49407412-49407434 GGAGCCTTGGACCAGGCTGCCGG + Intergenic
1185187154 22:49407891-49407913 GGAGCCTTAGACCAGGCTGCGGG + Intergenic
1185238021 22:49725783-49725805 TGACCCCAGGACCCGGGTTCCGG - Intergenic
1185268835 22:49918989-49919011 GGACCCCGGATCCAGGGTGAGGG - Intronic
1185268858 22:49919057-49919079 GGACTCCAGGACCACGGTGGAGG - Intronic
951628137 3:24689424-24689446 GGACCCCTGGCCTAGGAAGCAGG - Intergenic
952554760 3:34519564-34519586 GGACCCCTGGACCAACCTGCTGG - Intergenic
952885368 3:38008488-38008510 GGGCCCCTGAGCCAGGGCGCGGG + Exonic
954331864 3:49895500-49895522 GCATCCCTGGACCAGACTGCTGG - Exonic
954599370 3:51856077-51856099 GGACCCCTGGACCAACCTGCTGG + Intergenic
954952339 3:54486691-54486713 TGACCCTTGACCCAGGGTGCAGG + Intronic
957646619 3:82939172-82939194 GCACCCCGAGACCAGGGTGGGGG - Intergenic
959555231 3:107709677-107709699 TTACCTCTGGACCATGGTGCAGG + Intronic
960875317 3:122289722-122289744 TGACCCCTGGACAAGAGTGGAGG + Intergenic
961351822 3:126308939-126308961 GGATCGCTGGCCCAGGGTGAGGG + Intergenic
961478129 3:127161297-127161319 GGTGGCCTGGACCAGAGTGCTGG - Intergenic
962274574 3:134002294-134002316 GAACCCCTGGGCCAGGAGGCAGG - Intronic
964255123 3:154766843-154766865 GGCCTCCTGATCCAGGGTGCAGG - Intergenic
968491286 4:891936-891958 GGAGCCCTGGTGCTGGGTGCTGG - Intronic
968503701 4:962491-962513 GGACCGCTGGACCATCCTGCTGG - Exonic
968518488 4:1024708-1024730 GGACGCCGGGCCCAGGGGGCGGG - Intronic
968917304 4:3502181-3502203 GCAGCCCTGGATCAGGGTGCAGG - Intergenic
969423153 4:7108844-7108866 GCACACCTGCACCAGGGAGCAGG - Intergenic
971280647 4:25239942-25239964 GGACCCCTGGACCAACCTGCTGG - Intronic
971834650 4:31748072-31748094 GCAGCCCAGGACCAGGCTGCAGG + Intergenic
972211440 4:36842736-36842758 GGAGGCCTGGACCAGGATGTTGG - Intergenic
973551244 4:52038134-52038156 GGAGCCCTGGCCGGGGGTGCGGG - Intronic
974527408 4:63061578-63061600 GGACCCCTGGACCCACCTGCTGG + Intergenic
975595303 4:76043996-76044018 GGACCCCTGGACCAACCCGCTGG - Intronic
977749233 4:100588847-100588869 TGACACTTGGACCAGGGTGGTGG - Intronic
977834391 4:101631689-101631711 GGACCCCTGGACCAACCTGTTGG - Intronic
980444654 4:132888635-132888657 GGACGCCTGGACCATCCTGCTGG + Intergenic
982701680 4:158664656-158664678 GGACCCCTGGACCGACCTGCTGG + Intergenic
984917992 4:184740867-184740889 GGACCCCTGGACCAGTCCACTGG + Intergenic
984939045 4:184915632-184915654 GGACCCCTGGACCAACCCGCTGG - Intergenic
985640826 5:1062819-1062841 GGACTCCTGGAGGTGGGTGCTGG - Intronic
985644291 5:1077804-1077826 GGTCCCCCCGACGAGGGTGCGGG + Intronic
986743621 5:10725363-10725385 AAACCCCTGGCCCAGCGTGCAGG - Intronic
992747652 5:79835258-79835280 GGCCACCTGGACCAGGCTGGTGG - Intergenic
993051632 5:82932782-82932804 GGACCCTCGGAGCCGGGTGCCGG - Intergenic
994366894 5:98928090-98928112 GGACTCCTGGACCGGGATGGAGG - Intronic
994384473 5:99113403-99113425 GGACTCTTGGTCAAGGGTGCTGG + Intergenic
996535143 5:124570046-124570068 GGACGCCTGGACCACGGTGGAGG + Intergenic
996611205 5:125382533-125382555 GGAGCCCTGTACCAGACTGCAGG - Intergenic
999145545 5:149390927-149390949 GGACCCCTGGACCAGGATTTTGG + Intronic
999239415 5:150118875-150118897 GGGCCTCTGGCCCAGGGTTCAGG + Intronic
1002110522 5:176907087-176907109 GGACCCCAGGACCAGTTTTCTGG - Intronic
1002285531 5:178160361-178160383 GCACCCCAGGACCAGGAAGCGGG - Intergenic
1002790693 6:435610-435632 GGCGCCCTGGAGCAGGGAGCGGG + Intergenic
1003241666 6:4350607-4350629 GCACACCTGGACAAGGGTGGTGG + Intergenic
1003871336 6:10405097-10405119 GGACCACGGGTTCAGGGTGCAGG + Intronic
1006186021 6:32182200-32182222 AGACCCTGGGACTAGGGTGCAGG - Intronic
1006642587 6:35496750-35496772 GGAGCCCCGGATCGGGGTGCCGG - Intronic
1009471305 6:64030824-64030846 GGACCCCTGGACCAACGCGCTGG + Intronic
1010270266 6:73909642-73909664 AGACCCCTGGACCAACCTGCTGG + Intergenic
1010458539 6:76086602-76086624 GGACACCTTGGCCAGGGTCCAGG - Intergenic
1011128667 6:84033329-84033351 TGACACCTGGACCAGTGGGCAGG + Intergenic
1013906981 6:115232465-115232487 GGACCCGTGGACCAACCTGCTGG - Intergenic
1015812934 6:137179184-137179206 AGTCCCCTGGATCAGGCTGCTGG - Intergenic
1017118065 6:150997259-150997281 TGAGCCCTGGACAAGGGTGTAGG + Intronic
1017488040 6:154920978-154921000 GGGTCCCTGGTTCAGGGTGCTGG + Intronic
1019046719 6:169155416-169155438 AGACCAGTGGTCCAGGGTGCAGG + Intergenic
1019409703 7:901165-901187 GGCCCTCTGTTCCAGGGTGCTGG - Intronic
1019441667 7:1050568-1050590 GTCCGCCTGCACCAGGGTGCAGG - Intronic
1019450402 7:1094832-1094854 GGAGCCCAGCACCACGGTGCTGG - Intronic
1019537719 7:1537792-1537814 GGCTCCCTGGCCCAGGGTGTGGG + Intronic
1019696962 7:2451505-2451527 GGAGCCCTGTGCCAGGCTGCAGG - Intergenic
1022738641 7:33100110-33100132 GGATGCCTGTACCAGGGAGCGGG + Intronic
1022895561 7:34747400-34747422 TGATCCCTGCACCAGGCTGCAGG - Intronic
1029439934 7:100581991-100582013 GGACCCCTGAGCCAGGCAGCGGG - Intronic
1031834717 7:126668615-126668637 GAACCCCTTGACCAGGGAGGTGG - Intronic
1033589263 7:142796727-142796749 GGACTCCTGGTTCTGGGTGCTGG + Intergenic
1033604645 7:142917737-142917759 GGACCCCGGGGACAGAGTGCTGG - Intronic
1034579331 7:152028824-152028846 GGACCCCTGGACCAACCTGCTGG - Intronic
1034672678 7:152870217-152870239 GGACCCCTGAACCATGCAGCAGG - Intergenic
1034983230 7:155491432-155491454 GGCTCCCGGGACCAGGGTGCAGG + Intronic
1034993633 7:155564532-155564554 GGACCCCTGGACGCGGCTGCTGG + Intergenic
1035061198 7:156070851-156070873 GGACCTCAAGACCAGGATGCGGG - Intergenic
1035646268 8:1223199-1223221 GGAACCCTGGACAGGGTTGCTGG - Intergenic
1035725859 8:1824366-1824388 GGACCCCTGGCCCCAGGGGCAGG + Intronic
1037630269 8:20649441-20649463 GGTCCTCTGGACCAGGGCGGTGG + Intergenic
1038301853 8:26358279-26358301 AGACAACTGGACCAGGGGGCGGG + Intronic
1038485850 8:27934730-27934752 GAACCCCTGGAGCAGGGGGCAGG + Intronic
1039804429 8:40986421-40986443 GAACACCTGGACCTGGCTGCAGG + Intergenic
1039834367 8:41245051-41245073 GGATTTCTGAACCAGGGTGCAGG - Intergenic
1041212255 8:55563995-55564017 GGACCCCTGCTCCAGGGGCCTGG + Intergenic
1043413255 8:80021849-80021871 GGAGCCCTGGGTAAGGGTGCAGG - Intronic
1044847053 8:96392365-96392387 GGAACACTGGACCAGGAGGCTGG - Intergenic
1045096106 8:98800247-98800269 GGACCCCTGGACCGACCTGCTGG + Intronic
1045494164 8:102694315-102694337 GGACCCTTGGTCCAGGGGCCAGG + Intergenic
1045838204 8:106548319-106548341 GGAGCACTGGACCAGGGGTCAGG - Intronic
1045858855 8:106793452-106793474 GGACCCCTGGACCAACCAGCTGG + Intergenic
1047510742 8:125513449-125513471 GGTCGCCTGGACCTGGGAGCGGG + Intergenic
1048676914 8:136793835-136793857 GGCGCCCTGGAGCAGGGGGCGGG + Intergenic
1048757620 8:137755827-137755849 AGACCCCTGGACCAACCTGCTGG - Intergenic
1049102965 8:140592265-140592287 GCAGCCCTGGACCAGCGTGCGGG - Intronic
1049546242 8:143232726-143232748 GGACCCCTGGAGCCCAGTGCGGG + Intergenic
1049689661 8:143953054-143953076 GGACGCCTGGACCCTGGCGCAGG - Intronic
1049759458 8:144325544-144325566 GGGCCCCTGGGCCAGGGTAAAGG + Intronic
1052261628 9:26523094-26523116 GAATACCTGGAGCAGGGTGCGGG + Intergenic
1061875191 9:133540019-133540041 AGACCCCTGGGCCAGGGCTCAGG - Intronic
1062137050 9:134934722-134934744 GAACCCCTGGGCCTGGGTGCTGG - Intergenic
1062316959 9:135972041-135972063 GTGCCTCTGGACCTGGGTGCAGG - Intergenic
1062385533 9:136309530-136309552 GGAGCCCCTGGCCAGGGTGCAGG - Intergenic
1062416579 9:136454231-136454253 GGGCCCCTGGAGCCGGGTCCTGG - Exonic
1062436788 9:136549957-136549979 GCACCCCTGGGCCTGGGTGACGG - Intergenic
1062478475 9:136741036-136741058 GGACACCTGCACCTGGGTGGGGG - Intronic
1203780338 EBV:97006-97028 GGACCCCGGGGTCAGGGTGATGG + Intergenic
1203494370 Un_GL000224v1:136980-137002 GGACCCTTGTAGCAGGGTTCTGG - Intergenic
1203498201 Un_GL000224v1:173164-173186 GGACTCCGGGACCATGCTGCTGG - Intergenic
1203506989 Un_KI270741v1:78855-78877 GGACCCTTGTAGCAGGGTTCTGG - Intergenic
1203510755 Un_KI270741v1:115414-115436 GGACTCCGGGACCATGCTGCTGG - Intergenic
1185478833 X:431054-431076 GGAACCCTGGACCAGGCAGGGGG + Intergenic
1186455495 X:9707232-9707254 GGACCCCTGGGCCAGGGGTGGGG - Intronic
1190051979 X:47157253-47157275 GGGCCTCTGGACCACGGTGTAGG + Intronic
1190722693 X:53163276-53163298 GGACCCCAGGACGAGTCTGCCGG - Intergenic
1192191942 X:68996312-68996334 GGGCCCATGGACTAGGGAGCAGG + Intergenic
1192244388 X:69360657-69360679 GGAGCTTTGGACCAGGGTGGTGG + Intergenic
1192482204 X:71495225-71495247 GGACCCCTGGACCAACCTGCTGG - Intronic
1195440844 X:104896327-104896349 GGACCCCTGGACCAACCTGCTGG + Intronic
1197869500 X:131051577-131051599 CGAGCCCTGGACTAGGATGCTGG + Intergenic
1198954757 X:142116362-142116384 GGAACCATTGCCCAGGGTGCAGG + Intergenic
1199656954 X:150005806-150005828 GGATCCCTGGATCAGAGTGGTGG + Intergenic
1200169343 X:154060988-154061010 GGACACCTGGACCAGGGTGGGGG + Intronic
1201495815 Y:14590495-14590517 GGACCCCTGGACCGACTTGCTGG - Intronic
1202243660 Y:22794705-22794727 GGACCCCTGGACCAACACGCTGG + Intergenic
1202258387 Y:22943679-22943701 GGACCCCTGGACCAACCTCCTGG + Intergenic
1202396647 Y:24428455-24428477 GGACCCCTGGACCAACACGCTGG + Intergenic
1202411377 Y:24577437-24577459 GGACCCCTGGACCAACCTCCTGG + Intergenic
1202459405 Y:25092635-25092657 GGACCCCTGGACCAACCTCCTGG - Intergenic
1202474136 Y:25241637-25241659 GGACCCCTGGACCAACACGCTGG - Intergenic