ID: 1161918807

View in Genome Browser
Species Human (GRCh38)
Location 19:7250851-7250873
Sequence CTCTGAGTCTGGAGCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161918802_1161918807 -6 Left 1161918802 19:7250834-7250856 CCTGAGTGTGACCCTAGCTCTGA 0: 1
1: 0
2: 1
3: 19
4: 200
Right 1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG 0: 1
1: 0
2: 5
3: 32
4: 294
1161918801_1161918807 7 Left 1161918801 19:7250821-7250843 CCAAGAGGTAGAACCTGAGTGTG 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG 0: 1
1: 0
2: 5
3: 32
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161918807 Original CRISPR CTCTGAGTCTGGAGCTCAGA GGG Intronic
900354267 1:2252502-2252524 CCCTCAGTCAGCAGCTCAGACGG - Intronic
900827125 1:4935727-4935749 ATCTGGGCATGGAGCTCAGACGG + Intergenic
901138504 1:7012864-7012886 CGGTGAGTTGGGAGCTCAGACGG - Intronic
901167308 1:7229693-7229715 CTGTGAGCCAGGAGCACAGAGGG + Intronic
902490620 1:16778232-16778254 CTCTCAGCCTAGAGCCCAGAAGG - Intronic
902490753 1:16779036-16779058 CTCTGAGCCTGGAGTTGAGGGGG + Intronic
902564785 1:17304357-17304379 CTCTGGGACAGGAGCTCAGGTGG + Intergenic
903035720 1:20491406-20491428 CTCTGGGCTTGGAGCTCTGAGGG + Intergenic
905534056 1:38705208-38705230 GTGTGAGACTGGAGCTCAGCGGG + Intergenic
905547831 1:38813929-38813951 CTCTGCTTCTGGAGCTCACTGGG + Intergenic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907224377 1:52930755-52930777 ATCTGACTCTGAGGCTCAGAGGG + Intronic
907529634 1:55081685-55081707 CTCTGAGGCTGGAGATCTGCAGG + Intronic
908257533 1:62315295-62315317 CTCTGTCTTTGGAGATCAGACGG - Intronic
910110303 1:83675697-83675719 CTCTAAGTCTGGAGCTCTCTTGG - Intergenic
911201714 1:95051122-95051144 CTATGAGTCTGAGGTTCAGAAGG - Intronic
911669071 1:100587724-100587746 AGGTAAGTCTGGAGCTCAGAGGG - Intergenic
913253124 1:116928969-116928991 GTTTAAGTCTGGAGCTCAGTGGG - Intronic
915264917 1:154709845-154709867 CTCTGAGTCCAGAGCTCATCAGG - Intronic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
918391146 1:184064096-184064118 CTAACAGTCTGGAGCTGAGATGG + Intronic
919885960 1:201935059-201935081 CTCAAAGTCTGGGGCTCAGTGGG - Intronic
920165602 1:204033495-204033517 ATCTGAGGCTGGAACTCAGGAGG - Intergenic
920710396 1:208289096-208289118 CTTTGGGTCTGGAACTCAGTAGG + Intergenic
923289254 1:232528582-232528604 CTCTTAGTCTGGCTCTAAGAAGG - Intronic
923529691 1:234803499-234803521 CTCTGAGCCTGGAGTTGAGGGGG - Intergenic
923529823 1:234804303-234804325 CTCTCAGCCTAGAGCCCAGAAGG + Intergenic
1062768211 10:81068-81090 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1062786382 10:268808-268830 CTCTGAGGCATGAGCTCTGAGGG - Intergenic
1063822972 10:9858738-9858760 CTCTGACCCTAAAGCTCAGAGGG + Intergenic
1065200065 10:23304259-23304281 CTCTCAGACTGCAGCTGAGAGGG - Intronic
1065341448 10:24710603-24710625 CTCAGTGTCTGGCACTCAGAAGG + Intronic
1065937796 10:30536105-30536127 CGCGAAGGCTGGAGCTCAGATGG + Intergenic
1066452420 10:35542701-35542723 CTCAGAGTCTTGTGCTCTGATGG + Intronic
1067229884 10:44398831-44398853 CTCTGAACTTGAAGCTCAGAGGG + Intergenic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1071329746 10:84547746-84547768 CTCTGAGCTCGGAGCTCTGAAGG + Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1074373309 10:112918271-112918293 TTCTTAGACTGAAGCTCAGATGG - Intergenic
1075247113 10:120832454-120832476 CTCTGAGGCAGGTGCTAAGATGG - Intergenic
1075771812 10:124944856-124944878 TACTAAGTCTGGAGGTCAGAAGG - Intronic
1075960891 10:126567036-126567058 CTGTGAACATGGAGCTCAGAGGG + Intronic
1076291886 10:129351805-129351827 CTCCCAGTCTGGAGGCCAGAAGG - Intergenic
1077138612 11:1013730-1013752 CTGTGAGCCGGGAGCTCAGCGGG - Intronic
1077303233 11:1856643-1856665 TTCAGAATCTGGAGCTCTGAGGG - Intronic
1077391747 11:2303539-2303561 CTCTCAGGCAGGAGCTCAGGGGG + Intronic
1077497151 11:2891884-2891906 CTCTGACCCTGGAGGTCAGTGGG - Intronic
1078471257 11:11588637-11588659 CTCTGAGCCTGGAGCTGACCTGG - Intronic
1078827437 11:14942605-14942627 TTATAAATCTGGAGCTCAGAGGG - Intronic
1080630054 11:34066199-34066221 CTCCTACTCTTGAGCTCAGATGG + Intronic
1081146020 11:39563207-39563229 ATCTGAGTCTGGATCCCAGTGGG - Intergenic
1083994710 11:66266262-66266284 CTCTGGGTCAGGAGCTCATCCGG - Intronic
1084468192 11:69339535-69339557 CTCTGCCTCTTGAGCTCAGTGGG + Intronic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1086240232 11:84681744-84681766 CACTGAGTCTGAATCTCAGCAGG - Intronic
1088133987 11:106531361-106531383 CTCAGAGTCTGGTACTCAAATGG + Intergenic
1088470960 11:110187267-110187289 CCCTGAGTGTGGAGCAAAGAGGG - Intronic
1088813235 11:113405406-113405428 CCTGGTGTCTGGAGCTCAGAGGG + Intergenic
1089563721 11:119359264-119359286 ATCTGGGTCTTGAACTCAGATGG + Exonic
1090480594 11:127064577-127064599 CACTGAGTGTGGAACTCAAAGGG - Intergenic
1090481919 11:127076566-127076588 ATAAGAGTCTGGAACTCAGAAGG + Intergenic
1090936163 11:131344452-131344474 ATCTGAGTCTGGGGCTCAGGGGG + Intergenic
1091338798 11:134794582-134794604 AACTGAGTCTGGAGAGCAGAGGG + Intergenic
1092846320 12:12588527-12588549 TTCTGACTCTGGAGTTTAGAGGG - Intergenic
1092912762 12:13162555-13162577 CAATGAGGCTGGAGCTGAGAGGG - Intergenic
1093387267 12:18573342-18573364 CCTTGAGTCTGGACCCCAGATGG - Intronic
1093422562 12:18991839-18991861 TTCTGAATCTGGAGCTCTGAGGG - Intergenic
1096077120 12:48812869-48812891 CCCAGAGTCTGGAGCGCAGTAGG + Intergenic
1096189831 12:49609276-49609298 CCCTGAGTGTTGAGCTGAGAGGG - Intronic
1097748808 12:63329848-63329870 CTCTGAGCCTAGAGCTTAGGAGG + Intergenic
1097837215 12:64285095-64285117 AGCTGAGTGTGGAGCTCAGGAGG + Intronic
1098065735 12:66614249-66614271 TCCTGAGTCTGGAGTTCAGTGGG - Intronic
1099289309 12:80755672-80755694 TTATGAGTCTAGAGTTCAGAGGG - Intergenic
1100220972 12:92504355-92504377 CCCTGTGTATGGAGCTCAAAGGG - Intergenic
1102565626 12:113795565-113795587 CTCTGAGAATGGTGCTCAGTGGG - Intergenic
1102819691 12:115897299-115897321 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819700 12:115897335-115897357 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819709 12:115897371-115897393 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819717 12:115897407-115897429 CCCTGAGTCTGGAGACCAGGTGG + Intergenic
1102998529 12:117367612-117367634 CTCTAAGCCTGGAGTTCTGATGG + Intronic
1104167422 12:126247066-126247088 CTCTGTGCCTGGTACTCAGATGG - Intergenic
1104594170 12:130108989-130109011 CTCTCAGTTGGGAGCTCAGCTGG - Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104843885 12:131837197-131837219 CTCTGAGGAAGGAGCCCAGAGGG + Intronic
1105242204 13:18619013-18619035 CCCTGCATCAGGAGCTCAGATGG + Intergenic
1105324266 13:19355806-19355828 CTCTGAGTGGGTAGCTAAGATGG - Intergenic
1105868998 13:24487598-24487620 CTCTGAGTGGGTAGCTAAGATGG + Intronic
1108837585 13:54571194-54571216 ATTTGGGTCTTGAGCTCAGAGGG + Intergenic
1109114544 13:58364698-58364720 TTCTGAGGCTGGAGCACACATGG - Intergenic
1109352455 13:61202222-61202244 CCCTGAGTCTCTAGCTCAGCAGG + Intergenic
1111613630 13:90637541-90637563 CTCTGATTCTGGTTCCCAGAGGG - Intergenic
1112120130 13:96400883-96400905 CTCTGAGTCTGGAAACCAGGAGG - Intronic
1113373332 13:109741950-109741972 CTCTGAGGCTGGAGTGCTGAGGG - Intergenic
1114412095 14:22510566-22510588 CACTGAGTCTGGAGGTGAGCTGG + Intergenic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1120004500 14:79341622-79341644 CTCTGAATTTGGAGTTCACATGG - Intronic
1120112752 14:80577325-80577347 ATTTGAGTCTGGAGCTCAGAAGG - Intronic
1120118404 14:80648186-80648208 CTCTGAGTCAGGAGAGCAGTTGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120931223 14:89850457-89850479 CTCTGAGGATGGAGCCCAGGAGG + Intronic
1122033473 14:98930846-98930868 CTCTGTGTGTGGAGCTCACGGGG - Intergenic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1122952068 14:105050556-105050578 TTCTGAGGCAGGAGCCCAGAGGG + Exonic
1123489112 15:20765583-20765605 CCCTGCATCAGGAGCTCAGATGG - Intergenic
1123545611 15:21334670-21334692 CCCTGCATCAGGAGCTCAGATGG - Intergenic
1124106320 15:26740953-26740975 CTCTGAGTCAGAATTTCAGATGG + Intronic
1127263587 15:57343828-57343850 CTCTGAGTGGGGAGCCCAGGTGG - Intergenic
1127993602 15:64138410-64138432 CTCTGAGTCTTGCCCTCTGATGG + Exonic
1128551996 15:68603885-68603907 ATCTGAGTTTGGAGCTCAAGGGG + Intronic
1130542250 15:84828626-84828648 TTCTCAGTCTGCAGCTCAGAGGG - Intronic
1131265387 15:90912410-90912432 CTGTCAGGCTGGAGCTGAGATGG - Intronic
1202953952 15_KI270727v1_random:61940-61962 CCCTGCATCAGGAGCTCAGATGG - Intergenic
1132457111 16:30044-30066 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1132884167 16:2175233-2175255 CCTGGAGTCTGGAGCCCAGACGG - Intronic
1133050545 16:3115106-3115128 GTGTGAGGCTGGAGCTGAGAAGG + Intronic
1133340266 16:5031366-5031388 CTCTGATTCTGCAGGTCTGAGGG + Intronic
1134027839 16:10968001-10968023 CTCAGAGTCTTGTCCTCAGATGG - Intronic
1135636018 16:24076353-24076375 TTCAGAGTATGGAGATCAGAGGG + Intronic
1136537342 16:30907787-30907809 CAATGAGCCTGGAGTTCAGAGGG - Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1138191172 16:55015641-55015663 CTCCGAGCCTGCACCTCAGAAGG + Intergenic
1138442514 16:57043500-57043522 CACTGAGGCTGGAGATCACAGGG - Exonic
1138656840 16:58496275-58496297 CTCCGGGGCTGCAGCTCAGAGGG - Intronic
1139344821 16:66296234-66296256 CTCTCAGGCAGGAGGTCAGATGG - Intergenic
1139374280 16:66487089-66487111 CCCTCAGTGTGGAGCTCAGCTGG - Intronic
1140127133 16:72127050-72127072 TTCTGAGTCTGGAAGCCAGAGGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141985379 16:87576495-87576517 CTCTCACTCTGGAGGCCAGAAGG + Intergenic
1142177615 16:88652181-88652203 CTCTGAGAAAGGAGCTCAGTGGG - Exonic
1144379508 17:14680290-14680312 CTCTCATTCTGAAGCTCAGTGGG - Intergenic
1144526753 17:15996937-15996959 CTCGAAGTCTGGAGCTCAAGAGG - Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1145293081 17:21565272-21565294 CTCTGGAGCTGGTGCTCAGATGG - Intronic
1145386888 17:22420654-22420676 CTCTGGAGCTGGTGCTCAGATGG + Intergenic
1145799064 17:27671903-27671925 CTCTGGGTCTGGTGCTGGGAAGG - Intergenic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1146993197 17:37294810-37294832 CTCTGAGACTGGACCCCAAAGGG - Intronic
1147744568 17:42687387-42687409 CTCCGACTCTGGAGCTCTGTTGG + Intronic
1148756059 17:49973521-49973543 CTCAGAGGCAGGAACTCAGAAGG + Intronic
1148861369 17:50606020-50606042 CTCTGAGCCTGGGGCTCACCTGG - Exonic
1149313231 17:55416513-55416535 CTCTAAATCTGGGGCTCAGTAGG + Intronic
1150290068 17:63975995-63976017 CCCTGAGCCAGGAGCTGAGAAGG - Intergenic
1151758313 17:76087218-76087240 CCCTGGGACTGGAGCTCAGGGGG - Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152261248 17:79268512-79268534 AACTGTGGCTGGAGCTCAGAGGG - Intronic
1152290983 17:79440231-79440253 CGCTGTCTCTGCAGCTCAGACGG - Intronic
1152961100 18:80565-80587 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1154023762 18:10687677-10687699 CTCTGAGCCTAGACCTCACAGGG + Intronic
1154163332 18:11996054-11996076 CTCCCAGGCAGGAGCTCAGAGGG - Intronic
1156544248 18:37947691-37947713 CTCACAGTCTGGAGGCCAGAAGG - Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1160131745 18:76231492-76231514 CCCTGAGGCTGGAGGTAAGAAGG - Intergenic
1160509911 18:79447581-79447603 CTCTGAGGCTGGCGCTCATCGGG + Intronic
1161131002 19:2588662-2588684 CCCTGAGTCTGGAGTTCCCACGG - Intronic
1161261279 19:3339069-3339091 ACCTGAGGCTGGAGGTCAGAGGG + Intergenic
1161383117 19:3976984-3977006 CTCTGGGCCTGGAGCTCTGAAGG - Intronic
1161500289 19:4610727-4610749 CTCTGAGTCTGTATCTCTGTGGG - Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162663453 19:12190016-12190038 CTCAAACTCTGGAGCTCAGGTGG + Intergenic
1163127742 19:15253412-15253434 CACTGAGGCTGCTGCTCAGAAGG + Intronic
1163334553 19:16661988-16662010 CGTGGAGTCTGGAGCTGAGATGG - Intronic
1165568154 19:36750685-36750707 CTCTGACACTGGAGCCCACAAGG + Exonic
1167152761 19:47719325-47719347 CTCTGCGTCTGGGCCACAGATGG + Intronic
1167157960 19:47750702-47750724 CGTTGAGTCTGGGGCTCAGAGGG + Intronic
1168441276 19:56369270-56369292 CTCTCAGTCTGGAGCTGTAAAGG - Intergenic
926658595 2:15438677-15438699 CTCTGTCTCTGCAGCCCAGAAGG - Intronic
926901850 2:17760286-17760308 ATGTGAGTCTGGAGCTCAAAGGG - Intronic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
931387333 2:61809429-61809451 TTATGAGTCTGGAATTCAGAAGG - Intergenic
931894830 2:66717117-66717139 CACTGCTTCTGGAGCACAGAAGG - Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932748938 2:74358590-74358612 TGCTGGGTCTGGAGCTCAGCAGG - Intronic
933158814 2:79002140-79002162 CTCTGAGCCTGGACCACGGATGG - Intergenic
933533356 2:83538667-83538689 CTCTCAGTCTAGAGCACAGATGG - Intergenic
933991922 2:87640016-87640038 TTCTGAGCTTGGAGCACAGATGG + Intergenic
934647990 2:96070446-96070468 CACTGCATCTGGAACTCAGATGG - Intergenic
934841365 2:97626267-97626289 CACTGCATCTGGAACTCAGATGG - Intergenic
936301922 2:111310802-111310824 TTCTGAGCTTGGAGCACAGATGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936824457 2:116564107-116564129 CTCTGAGCTTGTAGCTGAGATGG + Intergenic
937039049 2:118807092-118807114 CTCAAGGTCTGGAGCCCAGAGGG + Intergenic
937208861 2:120254202-120254224 TGCTGACTCTGGAGCTCAGAGGG - Intronic
938483205 2:131679362-131679384 CCCTGCATCAGGAGCTCAGATGG + Intergenic
940911756 2:159215623-159215645 CTCTGAGACCCGAGCTCAGAAGG + Intronic
946143628 2:217712642-217712664 CTCTCAGTGTGGAGCTCTGTGGG + Intronic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
947434446 2:230060836-230060858 CTCTGAGTCTGGAGGAAGGAGGG + Intronic
948526932 2:238576550-238576572 ATCTGAGTTTGGAGTTCAGGAGG - Intergenic
948548179 2:238747117-238747139 CACTGAGTCAGGAGCTGAGAGGG + Intergenic
1168857778 20:1020918-1020940 CTCTGAGTCTGGTGCCTAGTAGG - Intergenic
1169305800 20:4489384-4489406 CTGAGAGTCTGTATCTCAGAGGG - Intergenic
1170417772 20:16162754-16162776 CTCTTAGTCTCTAGCTAAGATGG - Intergenic
1170816000 20:19714948-19714970 GTTTGACCCTGGAGCTCAGAGGG + Intronic
1171233571 20:23507189-23507211 ATATGATTCTGGAGTTCAGAAGG - Intergenic
1173152686 20:40581384-40581406 CTCTGAGCCTGGAGCTGGGAGGG - Intergenic
1173352766 20:42260360-42260382 CTTTGAGCCTGGAGCTCAGGAGG + Intronic
1173594198 20:44248066-44248088 CTCCGTGTCTTGAGCTGAGAAGG + Intronic
1176449228 21:6848975-6848997 CCCTGCATCAGGAGCTCAGATGG + Intergenic
1176827396 21:13713999-13714021 CCCTGCATCAGGAGCTCAGATGG + Intergenic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180741234 22:18054464-18054486 ATATGAGTCTGAAGCTCAGCTGG - Intergenic
1183321369 22:37167068-37167090 CTCTGAGTCTGGGGGTTAGGTGG - Intronic
1184208889 22:43023632-43023654 CTCTGAGTCTGGGCCACAGATGG + Intergenic
1185173288 22:49305560-49305582 CTCTGAGTCTCAGGCACAGATGG + Intergenic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
953023901 3:39133928-39133950 CCCAGAGTCTGGGGCACAGAGGG + Intronic
953324535 3:42001798-42001820 ACATGAGTCTGGAGTTCAGAGGG + Intergenic
953532758 3:43752953-43752975 CTCAGTGTCAGGAGCTTAGAAGG - Intergenic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
955402818 3:58605452-58605474 CTCTGCCTCCTGAGCTCAGAGGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
961624608 3:128253247-128253269 CCCTGAGCCTGAGGCTCAGAGGG - Intronic
961640176 3:128360242-128360264 CTCAGAGACTGGAGCCCACAGGG + Intronic
962622041 3:137189896-137189918 CTGAGAGTCTTCAGCTCAGAGGG - Intergenic
963481666 3:145882663-145882685 CTCTCAGCCTGGAGCTCAGTGGG + Intergenic
963844217 3:150139179-150139201 ATATGGATCTGGAGCTCAGAAGG + Intergenic
967931161 3:194691316-194691338 CTTTGCTCCTGGAGCTCAGAGGG + Intergenic
968037460 3:195560070-195560092 CTCTGACTCTGGTGCACACAGGG + Intergenic
968697888 4:2041715-2041737 ATCTGTGGCTGGAGCTCAGCAGG - Intronic
968765300 4:2465243-2465265 TTCTGAGTCTGGGCCTCAGGTGG + Intronic
969849573 4:9945651-9945673 CCCTGAGTCTGGTGGTCTGATGG - Intronic
972089793 4:35267059-35267081 CTCAGAGTGTGCACCTCAGAGGG + Intergenic
972549801 4:40120772-40120794 ATCTGATTCTTTAGCTCAGAGGG + Exonic
973146681 4:46834259-46834281 CATTGATTCTGGAGTTCAGATGG + Intronic
973547148 4:51993320-51993342 ATGTGAGTCTGGAGCTTAGATGG + Intergenic
973808492 4:54548009-54548031 CTCTGAGTCAGCAGGTAAGAAGG - Intergenic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
975251633 4:72186318-72186340 CGCTGAGTCTGGAGCACACTGGG - Intergenic
976377250 4:84359657-84359679 CACTGAATCTGGATGTCAGATGG + Intergenic
982348319 4:154385932-154385954 TGCAGAGTCTGGAGCCCAGATGG - Intronic
984984566 4:185315256-185315278 ATCTGAGTCTGGAGTTCTGTGGG - Intronic
986078884 5:4368485-4368507 CTCTGAATATAAAGCTCAGAAGG + Intergenic
988235786 5:28542235-28542257 TTCTGAGTCTAGTGCTCAGTAGG - Intergenic
990118504 5:52419551-52419573 CTATGTGCCTGGAGCTCAGGAGG - Intergenic
990788594 5:59451424-59451446 GTATGTGTCTGGAGCTCAGGAGG - Intronic
991461183 5:66860967-66860989 ACCTGAGTCTGGTGCTCGGAAGG + Intronic
993090800 5:83424000-83424022 CTCTGAGTCTGGAACTCCTTGGG - Intergenic
996315734 5:122158730-122158752 CTATGAGTCTGGAACTCAGAAGG + Intronic
996837914 5:127814396-127814418 CCCAGAGTGTGGAGCTCAGGAGG + Intergenic
997673177 5:135693376-135693398 CCCTCAGTGTGGAGCTCACAGGG - Intergenic
997975298 5:138438501-138438523 CTGTGACTCAGGAGCTCAGGTGG + Intergenic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999134429 5:149308776-149308798 GTCTCAGTCTAGAGCTCAAAAGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999862818 5:155666845-155666867 GTCTGAGGCTGGAGCTCATTCGG + Intergenic
1000038826 5:157469649-157469671 CTCTGTGTTTGTAGCTCAGGGGG - Intronic
1000522797 5:162318763-162318785 CTCTGAGTCTGGGCCTGTGATGG - Intergenic
1001083487 5:168683890-168683912 CTCTGGGCCTGCAACTCAGAAGG - Intronic
1002569275 5:180130809-180130831 ATATGACTCTGGAGATCAGAGGG - Intronic
1002616837 5:180461384-180461406 CTATGAGTCTGGGGAACAGATGG - Intergenic
1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG + Intergenic
1002968658 6:1992200-1992222 GTGTGAGTCTGGAGCTCAGCGGG - Intronic
1003272249 6:4617580-4617602 CTCTGATTCTGGAGGTCAAATGG - Intergenic
1003436318 6:6091731-6091753 GTGTGAGTGAGGAGCTCAGATGG + Intergenic
1006285814 6:33092970-33092992 CTTTGACTTTGGTGCTCAGAGGG - Intergenic
1007257052 6:40536768-40536790 CTCAGAATCTGCAGATCAGAGGG + Intronic
1012669874 6:102030854-102030876 CATTAAGTCTGGAGTTCAGAGGG - Intronic
1012844559 6:104373365-104373387 AGGTGAATCTGGAGCTCAGAAGG + Intergenic
1013606365 6:111752697-111752719 GACTGAATTTGGAGCTCAGAGGG + Intronic
1014401895 6:121000143-121000165 CTTTGTGTCTGGAGCTCTCAGGG - Intergenic
1014843437 6:126246473-126246495 CTCAGAAACTGGAGCCCAGAGGG + Intergenic
1015431873 6:133141365-133141387 CACTGAGTTGGGAGCTAAGAAGG - Intergenic
1015563374 6:134540322-134540344 CAGTGAGTCTGGAGCCTAGAAGG + Intergenic
1017698504 6:157043357-157043379 CTCTGAGGATGGTGCTCAGAAGG - Intronic
1018398088 6:163396339-163396361 ATGTGAGTCTGGATCCCAGAAGG - Intergenic
1018705363 6:166460264-166460286 CTCTGAGACCGGAGCACAGAGGG - Intronic
1018737225 6:166696400-166696422 ATATTAGTCTGAAGCTCAGAAGG - Intronic
1018762614 6:166904895-166904917 ACCTGATTCTGCAGCTCAGAGGG + Intronic
1019435059 7:1018362-1018384 CTTTGAGTCTGGGTCTGAGATGG - Intronic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022416157 7:30178883-30178905 CTCAGATTTTGGAGTTCAGAGGG - Intergenic
1022452962 7:30532963-30532985 AGCTAAGTCTGGAGCTCAGGGGG - Intronic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1028547391 7:92018826-92018848 ATATGACTCTGCAGCTCAGAAGG - Intronic
1029356064 7:100052640-100052662 GTATGAGTCTGGAGGTCAGCAGG + Intronic
1029407474 7:100384325-100384347 CTCTGAGTCTAGAGTGCAGGGGG + Intronic
1030171409 7:106606638-106606660 ATAGGAGTCTGGAGTTCAGAGGG - Intergenic
1031467266 7:122127875-122127897 ATATGAGTCTGAAGCTCAGGAGG - Intronic
1034222766 7:149459434-149459456 GGCAGAGGCTGGAGCTCAGAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034338473 7:150338184-150338206 CTCTGGCTCTGGAGCACAGGAGG + Intergenic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035882517 8:3257740-3257762 TTCTGGGGCTGGAGCTGAGAAGG + Intronic
1036757329 8:11479911-11479933 AACTGCGTCTGCAGCTCAGAAGG + Intergenic
1041132857 8:54721333-54721355 ATCTGCCTCTGGAGCTCTGAAGG + Intergenic
1042847342 8:73181629-73181651 TTCTGAGTTTGTAGCTCGGATGG + Intergenic
1043431237 8:80196964-80196986 TTCTGGGTCTTGAGCCCAGATGG + Intronic
1043691550 8:83159656-83159678 ATCTGTTTCTGCAGCTCAGAGGG + Intergenic
1044698323 8:94944792-94944814 CAGTGAGACTGAAGCTCAGAAGG - Intronic
1045330843 8:101154522-101154544 CTCTGAGGCAGGAGCCCTGAAGG + Intergenic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047285932 8:123487245-123487267 CTCTGTTTCTGGAGCTTACATGG + Intergenic
1048166922 8:132070073-132070095 CTCTGAGTCTGAAGCCCAGGTGG - Exonic
1048475844 8:134741697-134741719 GTATGAGTCTGGAGCTAAGAAGG - Intergenic
1050077058 9:1876203-1876225 ATCATAGTCTGGCGCTCAGAAGG - Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1051904571 9:22080388-22080410 CTCAGAATCTTTAGCTCAGAAGG - Intergenic
1052116317 9:24652081-24652103 CTATCAGTCTGTAGCTGAGAGGG + Intergenic
1053020307 9:34689876-34689898 ATCTTAGACAGGAGCTCAGAGGG + Intronic
1054729295 9:68684640-68684662 GAGTGAGTCTGGAGTTCAGAGGG + Intergenic
1055328882 9:75161414-75161436 CACAGAGTCTGGACCACAGAGGG + Intergenic
1056732732 9:89179806-89179828 CTCTGACTCTTGACCTCAGTGGG + Intergenic
1056753003 9:89365163-89365185 CTCTGGGGCTGGAGCTTAGTGGG - Intronic
1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG + Intronic
1057824255 9:98360072-98360094 CTCAGAGTCCGGAGCACACAGGG + Intronic
1058119477 9:101123304-101123326 CTCTGAGCTTGGAAATCAGATGG + Intronic
1058951838 9:109911114-109911136 GTCAGAGGCTGGAGGTCAGAAGG + Intronic
1061015722 9:127980147-127980169 CCCTGAGTCTGAAGCCCCGAAGG + Exonic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1061940088 9:133879135-133879157 CTGCGAGTCTGCAGCTGAGACGG - Intronic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062737061 9:138143421-138143443 CTCTGGGTGTGGACCTCAGGAGG + Intergenic
1203519960 Un_GL000213v1:35541-35563 CCCTGCATCAGGAGCTCAGATGG - Intergenic
1186695387 X:12025300-12025322 TCATGAGTCTGGAGCTTAGAGGG - Intergenic
1187274501 X:17806002-17806024 CTCTGAGTCAGCAGCTGAGGTGG + Intronic
1188543123 X:31271287-31271309 ATCTGAGTCTTGAGCTCAGAGGG + Intronic
1191223612 X:58016817-58016839 CTCTGATTTTGGTGATCAGATGG - Intergenic
1192183384 X:68930069-68930091 CTCTGAGACTGGACGTGAGAAGG - Intergenic
1194453306 X:94071740-94071762 CTCTAAGTCTTCAGATCAGATGG - Intergenic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200399248 X:156009682-156009704 CTCTGGGTGTGGACCTCAGGAGG + Intronic
1202063438 Y:20912326-20912348 CTCTGAATCTTGATCTCAAAAGG - Intergenic