ID: 1161920277

View in Genome Browser
Species Human (GRCh38)
Location 19:7260721-7260743
Sequence GGGTTGAATGAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161920277_1161920284 2 Left 1161920277 19:7260721-7260743 CCCTGCACCATCTCATTCAACCC 0: 1
1: 0
2: 2
3: 33
4: 242
Right 1161920284 19:7260746-7260768 ACACCACCACCCTAAGAAGCAGG 0: 1
1: 0
2: 3
3: 22
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161920277 Original CRISPR GGGTTGAATGAGATGGTGCA GGG (reversed) Intronic
900164881 1:1240636-1240658 GGGGTGAATGAGGTGGGGGATGG - Intergenic
901705831 1:11072391-11072413 GGATTGAATGAGATGATGGATGG - Intronic
902250520 1:15152139-15152161 GGATTAAATGAGATGGTTCAGGG + Intergenic
902300707 1:15500745-15500767 GGCGTGAATGTGATGGTGCTGGG + Intronic
902680577 1:18041255-18041277 GGGTGCAGTGAGATGGTGCGTGG + Intergenic
902946721 1:19846070-19846092 GGATTGTATGAGAGGGAGCAGGG + Intergenic
903484887 1:23682301-23682323 AGGTTGAGTGAGCTGGTGCCTGG + Intergenic
903671553 1:25038901-25038923 AGGTTGAATGAGATGAATCAAGG - Intergenic
906919240 1:50046881-50046903 GAATTGCATGAGATGGTCCATGG + Intergenic
908248424 1:62246107-62246129 GGTTTAAATGAGATGGTCCATGG + Intronic
909357896 1:74730251-74730273 GGCTTGAAAGTGATGGGGCATGG + Intronic
910159483 1:84258067-84258089 GGATTGAATGAGTGGGTGAAAGG + Intergenic
912716154 1:111985047-111985069 GGGTTAAATGAGATAATCCATGG - Intronic
912863295 1:113234325-113234347 GGATTGAATGAGATAGGGTAGGG - Intergenic
917182207 1:172311072-172311094 GGATTGAATGAGATAATGCAGGG + Intronic
918395581 1:184110675-184110697 GGGTGGAATGGGGGGGTGCATGG - Intergenic
919930564 1:202218725-202218747 GGGCAGAATGAGTTGGGGCATGG - Intronic
919976885 1:202618654-202618676 GGATTAAATGAGATGTTGCATGG + Intronic
921160859 1:212471346-212471368 GGGTTAAATGAGCTGAGGCAGGG - Intergenic
922996189 1:229963427-229963449 GGGTAGAATGAGATGATACCGGG + Intergenic
1064235178 10:13567322-13567344 GAGCTGAAAGAGATGGTGGAAGG - Intergenic
1064266765 10:13831636-13831658 GAGTTAAATAAGATGGTGTATGG + Intronic
1064753322 10:18553885-18553907 GAGTGGAATGAGATGGAGAATGG + Intronic
1066343121 10:34555868-34555890 GGCTAGAAGGAGGTGGTGCAGGG - Intronic
1068024847 10:51629874-51629896 GGTTTGAAAGAGATGGAGCCAGG - Intronic
1068478918 10:57563869-57563891 AGGTGGAATAAGATGGTGGAAGG - Intergenic
1072863531 10:99032461-99032483 GGTTTGAAAGGGATGGGGCAGGG - Intronic
1074303925 10:112258486-112258508 GGATTCAATGAGATAATGCATGG + Intergenic
1074318561 10:112380409-112380431 AGGATGAATGAGATGGTGTGTGG - Intronic
1075683949 10:124350985-124351007 GGGGTGACTGAGATGGCCCAGGG - Intergenic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1076549987 10:131272097-131272119 CGGCGGAATGAGCTGGTGCAGGG + Intronic
1076641215 10:131918283-131918305 GGGTGGAATGACACGGTGTAGGG + Intronic
1079356957 11:19737701-19737723 GGGTTAAGTGAAATAGTGCATGG + Intronic
1079672443 11:23186710-23186732 GGTTTTAATGAGATGGTACGGGG + Intergenic
1079942631 11:26700646-26700668 GGGTAGAAGGAGTTGATGCAGGG - Intronic
1081654890 11:44850619-44850641 GAGTTCAATGAGAAGATGCAAGG - Intronic
1085262119 11:75212243-75212265 AGATTGAATGAGATGATGCAAGG - Intergenic
1085281422 11:75333602-75333624 GGCTTAAATGAGATAATGCATGG - Intronic
1085337241 11:75705661-75705683 GGGTTGAAGGTGAAGGTGTAAGG + Intergenic
1085535236 11:77213578-77213600 GGCCTGAATGAGATGGTCCAGGG - Intronic
1085711039 11:78829434-78829456 GGGCTCAATGAGATAATGCATGG + Intronic
1086550336 11:88046122-88046144 GGTTTTAATGAGATGGTAAAGGG - Intergenic
1087682486 11:101232306-101232328 GGGTAGTATGAGATGCTGCCTGG - Intergenic
1089655355 11:119943296-119943318 GGGTGGGAGAAGATGGTGCAGGG - Intergenic
1090276696 11:125425127-125425149 TGATTTAATGAGATAGTGCAGGG - Intronic
1090683958 11:129094909-129094931 GTATTAAATGAGATGATGCATGG + Intronic
1092252729 12:6909847-6909869 GGATTGATTGAGAGGGAGCAGGG - Intronic
1092759129 12:11793480-11793502 GTTTTGAATGAGATGGTGTGTGG - Intronic
1092832860 12:12462220-12462242 GGATTAAATGAGATTCTGCAAGG - Intronic
1092966603 12:13649780-13649802 GGTTTGAATGATTTAGTGCAAGG - Intronic
1097576748 12:61403337-61403359 GAGAAGAATGAGATGGTACATGG + Intergenic
1097628629 12:62032292-62032314 GGGTTGAATGAAATTGAGAAAGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1100018002 12:90035344-90035366 GGATTAGATGAGATGGTTCAGGG + Intergenic
1100853633 12:98739169-98739191 GGCTTCAATGAGAAGGTACAGGG - Intronic
1101083059 12:101208826-101208848 GGATTAAATGAGATGATGCAAGG - Intronic
1101632304 12:106506892-106506914 GGGTTGAGTGGGAGGGAGCATGG + Intronic
1101834766 12:108287511-108287533 GGGGTGAATGAGTGGGTGAATGG + Intergenic
1106773372 13:32984498-32984520 GGGTGGAATGAGATGAGGCTAGG - Intergenic
1107567756 13:41623474-41623496 GGGATGAATGAGAGGCAGCAGGG + Intronic
1109285746 13:60406208-60406230 GTGGTGATTGAAATGGTGCATGG + Intronic
1110169912 13:72488150-72488172 GGGTGGAATGAGAGGGTGAAAGG - Intergenic
1111793130 13:92883976-92883998 GGGTGGGAGGAGATGGGGCAGGG + Intergenic
1112567939 13:100567249-100567271 ATGGTGAATGAGATGTTGCATGG - Intronic
1114839567 14:26247451-26247473 GGGTAGAATGAGGTAGGGCATGG - Intergenic
1119346402 14:73928345-73928367 GGGTTGAGTGTGATGGGACATGG + Intronic
1119553198 14:75532070-75532092 AGATTAAATGAGATGCTGCAGGG - Intronic
1120129013 14:80782976-80782998 GATTTGGATGAGATTGTGCAGGG - Intronic
1120780655 14:88482786-88482808 GGCTTGAATGTGATGGTGAGGGG + Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1122057865 14:99117133-99117155 GGATTAAATGAGATAGTGCATGG - Intergenic
1122137619 14:99644126-99644148 GGGGTGGATGAGATGCGGCAGGG - Intergenic
1124189751 15:27564595-27564617 GGATCTAATGAGATTGTGCATGG + Intergenic
1124492533 15:30167035-30167057 GGATTAAATGAGACGTTGCATGG + Intergenic
1124751001 15:32371290-32371312 GGATTAAATGAGACGTTGCATGG - Intergenic
1125527383 15:40385715-40385737 GAGCTTAATGAGATGGTACAAGG + Intronic
1127680789 15:61295849-61295871 GGCTTGTATGAGATGTTGAAGGG - Intergenic
1129269596 15:74412325-74412347 GGGTTAAACGAGGTGATGCATGG - Intronic
1130906646 15:88245294-88245316 GGGTTGAATGAGATTATGGTAGG - Intronic
1130963385 15:88679901-88679923 GGATTAAATGAGATGATGTATGG + Intergenic
1131081584 15:89541062-89541084 GGATTAAATGAGATTATGCATGG - Intergenic
1131291581 15:91111344-91111366 TGGTTCTTTGAGATGGTGCAGGG + Intronic
1133381705 16:5336451-5336473 GGATTGAATGAGATCATGCATGG + Intergenic
1133424547 16:5676541-5676563 GGATTGAATGAGATTGTGCCTGG + Intergenic
1133858578 16:9573080-9573102 GGATTAAATGAGATCGTGCATGG - Intergenic
1134079294 16:11314092-11314114 GGCTTCAATGAGACAGTGCAGGG + Intronic
1134208514 16:12257022-12257044 GGGCTGAATGAGGTGGTGGCAGG + Intronic
1134286026 16:12862669-12862691 GGATTAAATGAGTTGATGCAGGG - Intergenic
1135357882 16:21785098-21785120 TGGTTAAATGAGATTATGCAGGG - Intergenic
1135456386 16:22601216-22601238 TGGTTAAATGAGATTATGCAGGG - Intergenic
1137538923 16:49348827-49348849 GGATTGAATGAGATCATGCAGGG + Intergenic
1138183059 16:54956011-54956033 AGATTAAATGAGATGGTGCCTGG + Intergenic
1138506517 16:57480889-57480911 GGGATGAAGGAGAAGGTCCAGGG + Intronic
1139219351 16:65164128-65164150 AGGCTTCATGAGATGGTGCATGG + Intergenic
1139560367 16:67737950-67737972 GGGCTGACTGGGATGGGGCACGG - Intronic
1140939953 16:79712226-79712248 GGGTTGAATCCAAAGGTGCAGGG + Intergenic
1140960191 16:79904348-79904370 AGAGTGAATGAGATGATGCATGG + Intergenic
1141186767 16:81793176-81793198 GTGTTGGATAAGATGGTGCTGGG + Intronic
1141621875 16:85240616-85240638 GACTTAAACGAGATGGTGCATGG + Intergenic
1141917418 16:87109131-87109153 AGATTGAATGAGATGATACAGGG - Intronic
1142328090 16:89431425-89431447 GGGTTGAATGAGGCGATGCGTGG - Intronic
1142401384 16:89860593-89860615 GGGATGATAGAGATGGTGGAGGG - Intronic
1144132325 17:12258611-12258633 TGGTTGAATGAGACAGTGTATGG - Intergenic
1144384721 17:14738743-14738765 GGATGGAGTGGGATGGTGCAAGG - Intergenic
1144741464 17:17584904-17584926 GGATTAAATGAGAAAGTGCAAGG + Intronic
1150638510 17:66933482-66933504 GGATTCAATGAGACGGTGTATGG + Intergenic
1150733058 17:67712485-67712507 GGGTTGAGTGTGATGGTGAGAGG - Intergenic
1151086387 17:71385936-71385958 GGGTTGAAGGAGATAATGAATGG + Intergenic
1153700301 18:7686124-7686146 GTCTTGACTGGGATGGTGCAAGG - Intronic
1153959772 18:10130862-10130884 AGGTTGAATGGGATGGACCAGGG - Intergenic
1155358517 18:24977627-24977649 TGATTTAATGAGATTGTGCAGGG + Intergenic
1156190069 18:34708839-34708861 GGATTAAATGAGATAGTCCAAGG - Intronic
1158304120 18:56085783-56085805 GTGTTCAATGAGATGATGCATGG + Intergenic
1158372735 18:56827898-56827920 GGATTAAATGAGATGATGCATGG + Intronic
1158410254 18:57199024-57199046 GGGCTGAATAAGATGGTGCATGG + Intergenic
1159704889 18:71674723-71674745 GGCTTGAATGTGATGCTTCAGGG + Intergenic
1160110055 18:76018268-76018290 GTCTTGACAGAGATGGTGCATGG - Intergenic
1160445194 18:78922142-78922164 GGTTAGATTGACATGGTGCATGG - Intergenic
1160775580 19:853594-853616 GGGTTAAATGAGATCCTGCAGGG + Intronic
1161401924 19:4069783-4069805 GGGAGAAATGAGACGGTGCATGG + Intergenic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1162013017 19:7829629-7829651 GGGTTGAATGAAATGGGGGTGGG - Intergenic
1162356997 19:10192345-10192367 GGGTTAAATGAGAATATGCATGG - Intronic
1163705366 19:18809293-18809315 TGCTTGCCTGAGATGGTGCAAGG + Intergenic
1165168989 19:33877739-33877761 GGGTTGAAGGACACTGTGCAGGG - Intergenic
1165486492 19:36099715-36099737 GGATTACATGAGATGGTGAAGGG + Intronic
1166857154 19:45788118-45788140 TGGTTGAATGGGATGGTGAGAGG - Intronic
1167590613 19:50402521-50402543 AGGCTGAAGGAGAAGGTGCAGGG + Exonic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1168333246 19:55581382-55581404 GGGTTGAATGAGTATATGCAGGG - Intergenic
1168411522 19:56143152-56143174 GGGTGGATTGACATGGTGGAAGG + Intronic
926599503 2:14826752-14826774 GGGTTGAATGGTAAGGAGCAGGG - Intergenic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
928218887 2:29386077-29386099 GCGCTGAAAGAGATGGTGGATGG - Intronic
928365359 2:30696220-30696242 GGATTGAATGAGCTGGGCCATGG + Intergenic
928647963 2:33375186-33375208 GGGTTAAATGTGATAATGCATGG + Intronic
931577599 2:63735475-63735497 GGGTTGAGTCAGACAGTGCAAGG + Intronic
931946224 2:67311194-67311216 GGGTTGAATCAAATGATGAAAGG + Intergenic
932642167 2:73460196-73460218 GGGTTGAAAGAGTTGGGGCTGGG - Intronic
934528608 2:95069802-95069824 GGATCAAATGAGATGATGCAGGG + Intergenic
935322217 2:101900272-101900294 GGGGTGAATGTGGTGGTGCCTGG + Intergenic
937315996 2:120932444-120932466 GGGCAGAATGAGAGAGTGCAGGG - Intronic
937970753 2:127546916-127546938 TGGTTGAATGAGTGGGTGAATGG - Intronic
939479934 2:142735070-142735092 GGATTAAATGAGATGATGTAGGG - Intergenic
939501321 2:142988527-142988549 GGGTTGAATGAGATCTTTCATGG + Intronic
943262329 2:185682099-185682121 GTGTGGAATGAGATAGTGCAGGG - Intergenic
944330232 2:198457131-198457153 GCTTTCAATGAGATGGTGAATGG + Intronic
945234396 2:207621415-207621437 GGGTTAAATCAGATAGTGTATGG + Intronic
1170375097 20:15691613-15691635 GGATTAAATGAGATAATGCATGG + Intronic
1174266528 20:49335975-49335997 GGGCTAAGTGAGATTGTGCAAGG + Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1179452475 21:41475433-41475455 GGGGTGAGTGAGGGGGTGCAGGG + Intronic
1181339582 22:22166954-22166976 GAGTTGAATGAAATGGTACAAGG + Intergenic
1181914679 22:26270170-26270192 GGATTGAATAAGATGATGCGTGG + Intronic
1182072051 22:27470548-27470570 TGGGTGGATGAGATGGTGGATGG + Intergenic
1182088749 22:27579756-27579778 GGATTGAATGAGATGGGGCTGGG + Intergenic
1182793263 22:32971043-32971065 GGATTGAATGAGTTACTGCATGG + Intronic
1182860602 22:33556320-33556342 AGGCTAAATGAGATGGTTCAGGG + Intronic
1182880311 22:33727328-33727350 GAATTGAATCAGATGGTGAATGG - Intronic
1183300593 22:37057195-37057217 GGATTAAGTGAGATGGTGCCTGG + Intronic
1183483848 22:38078958-38078980 GGCTTGAATCAGAGGGTGGAGGG - Intronic
1185074062 22:48673728-48673750 GGGTGGAAGGTGAAGGTGCATGG + Intronic
949737717 3:7193184-7193206 GGGATAAATGGGTTGGTGCACGG + Intronic
950310574 3:11954310-11954332 GGATTAAATGAGATAGTGCATGG + Intergenic
950313987 3:11984245-11984267 GGATTAAATGAGATGATGCATGG + Intergenic
950519350 3:13487364-13487386 GGGTAGAATGGGATGAGGCAGGG - Intronic
951229502 3:20160555-20160577 GTGTAGTGTGAGATGGTGCAGGG + Intergenic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
953759050 3:45672633-45672655 GGGAAGGATGAGATGGTGGAAGG - Intronic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
955963926 3:64368722-64368744 GGGGTGAATGAGATGGGAGAAGG + Intronic
955964963 3:64379837-64379859 GCGTTTAATGAGGTGATGCAGGG - Intronic
958089800 3:88862059-88862081 ATGTTGAATGAGATGTTGTAGGG + Intergenic
959288753 3:104445801-104445823 GGGTTGATTTAAATTGTGCAGGG - Intergenic
960279342 3:115763841-115763863 AGATTAAATGAGCTGGTGCAGGG + Intergenic
960533292 3:118789248-118789270 GGGTGGAATGGGATGGGGCAGGG - Intergenic
962424560 3:135258306-135258328 GGTTTAAATGAGATAGTGTATGG + Intronic
964464849 3:156980458-156980480 GGGTTGAAGGAATTGGTGGACGG + Intronic
966066951 3:175830643-175830665 GGTTTGAATGAGATGGTAAGGGG - Intergenic
967197410 3:187040591-187040613 AGGTTCAATGAGATATTGCAAGG + Intronic
967486511 3:190038407-190038429 GGGGTGATTGAGATAATGCAGGG - Intronic
969231314 4:5833619-5833641 GGATTAAATGAGATGATGCATGG + Intronic
969315437 4:6378865-6378887 GGGTAGAATGCGATGGTGCGGGG - Intronic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
973249533 4:48046958-48046980 GGGAAGAATGATATGGTCCAAGG + Intergenic
974401708 4:61416766-61416788 GGGTGGGATGAGGTGGTGGATGG + Intronic
982270036 4:153577116-153577138 GGGTTGGAGGAGTGGGTGCAAGG + Intronic
982550162 4:156787712-156787734 GAGATGAATGAGATGGAGTAAGG + Intronic
982727948 4:158925517-158925539 GGGTTGAATGGGATGGTTTCAGG + Intronic
984924195 4:184792347-184792369 GGGTTGAATAAGAAGGGGAAGGG + Intronic
987777853 5:22392628-22392650 GACTTGAATGAGATGAAGCATGG - Intronic
988450406 5:31336880-31336902 GGAGTGGATGAGATTGTGCAGGG + Intergenic
989502257 5:42181280-42181302 GGGTTGGAGGAGATGGGGCAGGG + Intergenic
992118946 5:73571082-73571104 GGGTTAAATAAGATGGCACAGGG - Intronic
992118952 5:73571116-73571138 GGGTTAAATAAGATGGCACAGGG - Intronic
992118958 5:73571165-73571187 GGGTTAAATAAGATGGCACAGGG - Intronic
995712187 5:115047237-115047259 GGCTTGAATAAGATTGTTCAGGG - Intergenic
996203137 5:120700362-120700384 GGTTTTAATGAGATGGTGAGGGG + Intergenic
997369456 5:133348816-133348838 GGATTAAGTGAGATGGTGTACGG + Intronic
998377998 5:141703724-141703746 GGATTAAATGAGAGAGTGCATGG + Intergenic
998416568 5:141950471-141950493 GGTTTGAATAAGACGGTGCATGG - Intronic
999174517 5:149622506-149622528 GGATTGAATGAGATCATGCATGG - Intronic
999864766 5:155688733-155688755 GGGTTAAATGAGATGTTACATGG - Intergenic
1000195410 5:158952356-158952378 AGGGTGACTGAGATGGTGAATGG + Intronic
1000724515 5:164752751-164752773 GGGTTCAAGGAGATGGGGCTTGG + Intergenic
1001001986 5:168016129-168016151 GGGTTAAATGTGTTGATGCAGGG - Intronic
1001383236 5:171317646-171317668 GGGATCAATGGGATGGTGGAAGG - Intergenic
1001412895 5:171523459-171523481 GAGTTTAATGAGATGATGGATGG + Intergenic
1002335070 5:178471857-178471879 GGGTGGAAGGAGCTGGGGCATGG - Intronic
1003364714 6:5461471-5461493 GGGTTGATTGTGATGGTGGCTGG - Intronic
1003619161 6:7682580-7682602 AGGTTGGGTGACATGGTGCATGG + Intergenic
1004373490 6:15072742-15072764 GGGTTAACTGAGATAATGCATGG + Intergenic
1004927833 6:20432589-20432611 GGGTTGAATTAGATGATTTATGG + Intronic
1005896162 6:30181305-30181327 GGGTTGAATGAGCCTGTGCTAGG + Intergenic
1006847839 6:37075246-37075268 GGATTAAATGAGATGATGTATGG - Intergenic
1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG + Intergenic
1007423028 6:41730894-41730916 TTGTTGAATAAGACGGTGCAGGG - Intronic
1008556605 6:52678725-52678747 GGATTAAATAAGATGATGCATGG + Intronic
1012114020 6:95270822-95270844 GGGTAGGGTAAGATGGTGCAGGG - Intergenic
1013287238 6:108692073-108692095 GGATTAAGTGAGATGATGCATGG + Intergenic
1013455433 6:110325524-110325546 GGGTTGACTGAAATAATGCAAGG + Intronic
1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG + Intronic
1014870719 6:126593438-126593460 GAGTTAAATGAGATAGTGTATGG - Intergenic
1016019513 6:139220965-139220987 GGGTAGAATCAGTTGTTGCAGGG + Intergenic
1016374450 6:143406237-143406259 GGGCAGGATGAGATGGTGCATGG + Intergenic
1016838584 6:148504252-148504274 GGGGTGTTTGAGATGCTGCAAGG + Intronic
1017701808 6:157081213-157081235 GGGTAGAATGAGATGCAGTAAGG + Intronic
1017853939 6:158332282-158332304 GGGCCGAAGGAGATGATGCAAGG + Intronic
1017910669 6:158789968-158789990 GGCTCATATGAGATGGTGCATGG - Intronic
1018672703 6:166192842-166192864 GGGTTGCAGAAGGTGGTGCAGGG + Intergenic
1019103442 6:169650217-169650239 GGGATGGATGAGTAGGTGCATGG - Intronic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1020475698 7:8591813-8591835 GGGTTGAAAGGGAGGGTGAAAGG + Intronic
1023098366 7:36686939-36686961 TGTTTAAATGAGATAGTGCAAGG + Intronic
1028391243 7:90320420-90320442 AGGTAGGATGAGATAGTGCAGGG + Intergenic
1029623007 7:101701670-101701692 GGATTGAATGAGAGGGTCCTGGG + Intergenic
1032537977 7:132680400-132680422 GGGTTAAATGAGGTGGTGTGTGG - Intronic
1032574910 7:133043146-133043168 GGGTTGGGTGTGATGGTTCACGG - Intronic
1033279531 7:139995895-139995917 GGGATGAATGAGAGGGAGCGAGG - Intronic
1033943699 7:146687383-146687405 GGTTTAAATGAGATAGTACATGG + Intronic
1036390647 8:8321599-8321621 AGATTGAATGAGATGCTGCATGG - Intronic
1037111762 8:15171256-15171278 AAGTTGAAAGAGATTGTGCAGGG + Intronic
1037815055 8:22107732-22107754 GGGCAGAATGAGAGGGTGCCTGG + Exonic
1037927458 8:22855236-22855258 GGGGTGAATGTGTCGGTGCACGG + Intronic
1039917917 8:41873417-41873439 GGATTAAATGAGATTGTGAATGG - Intronic
1041090549 8:54297394-54297416 GGGTTGGATGAGATCTTGGAGGG + Intergenic
1041938933 8:63365852-63365874 GGGTGGCATCAGCTGGTGCATGG - Intergenic
1043624806 8:82243568-82243590 TTGTTGAAGGAGGTGGTGCATGG + Intergenic
1044148397 8:88744986-88745008 GGTTTTAATGAGATGGTAAAGGG + Intergenic
1044206007 8:89492597-89492619 TGGTTGAATGTGTTGGGGCAGGG + Intergenic
1044847144 8:96392971-96392993 GGGTTATATGAGATGATTCATGG + Intergenic
1047455108 8:125001082-125001104 GAGTTCAGTGACATGGTGCATGG + Intronic
1047523009 8:125609860-125609882 GGGTTGAATGATAGGGGGCAGGG + Intergenic
1047774582 8:128059227-128059249 GGTTTGAATGAGATATGGCAGGG + Intergenic
1048327576 8:133451132-133451154 GAGTTGAATGAGATGGTCCAAGG - Intergenic
1049571708 8:143372881-143372903 GGGTTCCAGGGGATGGTGCAGGG + Intronic
1049571814 8:143373149-143373171 GGGTTCCAGGGGATGGTGCAGGG + Intronic
1050654580 9:7812772-7812794 GGTTGGAATGAGATCCTGCAAGG - Intronic
1051049011 9:12909402-12909424 GGGTGGCATCAGCTGGTGCACGG + Intergenic
1051431071 9:16981044-16981066 GGGTAGAGTCAGATGGTGTAGGG - Intergenic
1052341253 9:27366435-27366457 GGATTGAATGAGATGTTTGAGGG - Intronic
1058296936 9:103320636-103320658 GGAGTTAATGAGATGCTGCATGG - Intergenic
1058742753 9:107960251-107960273 GGGTAGTATTTGATGGTGCAAGG - Intergenic
1059483933 9:114612575-114612597 TGGTTGAATGAGGGGCTGCAAGG + Intronic
1060416770 9:123436161-123436183 GGGTTGAACAAGAGGGTGCCTGG - Intronic
1062175099 9:135157360-135157382 GGATTACATGAGATAGTGCATGG - Intergenic
1062367571 9:136218522-136218544 GGGTGGAATGAGTTGGGGCGTGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188493042 X:30756092-30756114 GGGTTGGCTGGGCTGGTGCATGG - Intergenic
1189859358 X:45257358-45257380 GGATGAAATGAGATGATGCAGGG + Intergenic
1195616884 X:106919802-106919824 GGCTTAAATGACATAGTGCATGG + Intronic
1195888349 X:109665920-109665942 GGATTAAATGAGATGATACATGG + Intronic
1195939589 X:110157102-110157124 GGAATGAATGAGCTGGTCCAGGG + Intronic
1197167790 X:123397260-123397282 GGTTTGATTGATATTGTGCAAGG - Intronic
1197351934 X:125391619-125391641 GGTTTTAATGAGATGGTAAAGGG + Intergenic
1197882114 X:131177911-131177933 GGATTAAATGAGATAATGCATGG + Intergenic
1198794980 X:140385088-140385110 GGCTTGAATGACTTGGTGAATGG - Intergenic