ID: 1161925702

View in Genome Browser
Species Human (GRCh38)
Location 19:7297502-7297524
Sequence TGGGCCACTGCTCTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161925702_1161925707 9 Left 1161925702 19:7297502-7297524 CCAGGCTGGAGAGCAGTGGCCCA No data
Right 1161925707 19:7297534-7297556 CACTGTAACCTCCAACTCCTGGG 0: 80
1: 2082
2: 29649
3: 104134
4: 191548
1161925702_1161925711 27 Left 1161925702 19:7297502-7297524 CCAGGCTGGAGAGCAGTGGCCCA No data
Right 1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG No data
1161925702_1161925706 8 Left 1161925702 19:7297502-7297524 CCAGGCTGGAGAGCAGTGGCCCA No data
Right 1161925706 19:7297533-7297555 TCACTGTAACCTCCAACTCCTGG 0: 91
1: 2920
2: 45256
3: 107343
4: 181867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161925702 Original CRISPR TGGGCCACTGCTCTCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr