ID: 1161925704

View in Genome Browser
Species Human (GRCh38)
Location 19:7297521-7297543
Sequence GGTTACAGTGAGCCATGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161925704_1161925707 -10 Left 1161925704 19:7297521-7297543 CCCAATCATGGCTCACTGTAACC No data
Right 1161925707 19:7297534-7297556 CACTGTAACCTCCAACTCCTGGG 0: 80
1: 2082
2: 29649
3: 104134
4: 191548
1161925704_1161925713 27 Left 1161925704 19:7297521-7297543 CCCAATCATGGCTCACTGTAACC No data
Right 1161925713 19:7297571-7297593 CTGGCAAGCACCAACACGCCCGG No data
1161925704_1161925711 8 Left 1161925704 19:7297521-7297543 CCCAATCATGGCTCACTGTAACC No data
Right 1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161925704 Original CRISPR GGTTACAGTGAGCCATGATT GGG (reversed) Intergenic
No off target data available for this crispr