ID: 1161925705

View in Genome Browser
Species Human (GRCh38)
Location 19:7297522-7297544
Sequence AGGTTACAGTGAGCCATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6384
Summary {0: 4, 1: 74, 2: 914, 3: 2229, 4: 3163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161925705_1161925711 7 Left 1161925705 19:7297522-7297544 CCAATCATGGCTCACTGTAACCT 0: 4
1: 74
2: 914
3: 2229
4: 3163
Right 1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG No data
1161925705_1161925713 26 Left 1161925705 19:7297522-7297544 CCAATCATGGCTCACTGTAACCT 0: 4
1: 74
2: 914
3: 2229
4: 3163
Right 1161925713 19:7297571-7297593 CTGGCAAGCACCAACACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161925705 Original CRISPR AGGTTACAGTGAGCCATGAT TGG (reversed) Intergenic
Too many off-targets to display for this crispr