ID: 1161925711

View in Genome Browser
Species Human (GRCh38)
Location 19:7297552-7297574
Sequence CTGGGTTCAAGCGATCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161925701_1161925711 28 Left 1161925701 19:7297501-7297523 CCCAGGCTGGAGAGCAGTGGCCC 0: 24
1: 3021
2: 113927
3: 230094
4: 217662
Right 1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG No data
1161925705_1161925711 7 Left 1161925705 19:7297522-7297544 CCAATCATGGCTCACTGTAACCT 0: 4
1: 74
2: 914
3: 2229
4: 3163
Right 1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG No data
1161925704_1161925711 8 Left 1161925704 19:7297521-7297543 CCCAATCATGGCTCACTGTAACC No data
Right 1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG No data
1161925702_1161925711 27 Left 1161925702 19:7297502-7297524 CCAGGCTGGAGAGCAGTGGCCCA No data
Right 1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161925711 Original CRISPR CTGGGTTCAAGCGATCTTCC TGG Intergenic
No off target data available for this crispr