ID: 1161927292

View in Genome Browser
Species Human (GRCh38)
Location 19:7310738-7310760
Sequence AAAAATACACACATACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161927292_1161927294 13 Left 1161927292 19:7310738-7310760 CCCAGCTGTATGTGTGTATTTTT No data
Right 1161927294 19:7310774-7310796 ATTCCCATAAAATAAGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161927292 Original CRISPR AAAAATACACACATACAGCT GGG (reversed) Intergenic
No off target data available for this crispr