ID: 1161933701

View in Genome Browser
Species Human (GRCh38)
Location 19:7357848-7357870
Sequence ATGAAAAAGCATGAGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161933701_1161933702 -4 Left 1161933701 19:7357848-7357870 CCATTCTGCTCATGCTTTTTCAT 0: 1
1: 0
2: 2
3: 36
4: 496
Right 1161933702 19:7357867-7357889 TCATTCATTCCTCAATCTGTTGG 0: 1
1: 0
2: 0
3: 26
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161933701 Original CRISPR ATGAAAAAGCATGAGCAGAA TGG (reversed) Intronic
901540444 1:9911717-9911739 ATGAAAAAGTGTGAGCAGGCCGG - Intergenic
902270170 1:15298504-15298526 ATGAAAAACTATGTGCAGAGAGG - Intronic
902752050 1:18523401-18523423 ATGTGAAAACATGAACAGAAAGG + Intergenic
902808058 1:18872993-18873015 ATGCAACAGCCTGGGCAGAAGGG + Intronic
904532388 1:31177775-31177797 AGGCAACAGCATGAGCAAAATGG - Intergenic
906549813 1:46655058-46655080 AGGAAGAAGAATGAGCAAAAGGG + Intronic
906893076 1:49739153-49739175 TTGAAAAACGATGAGAAGAATGG + Intronic
907654719 1:56330689-56330711 ATGAAAAAGTATTATAAGAAAGG - Intergenic
908616344 1:65927330-65927352 ATGAACAAGCAGGAGCAAATGGG + Intronic
909116319 1:71541644-71541666 ATGGAACAGCAGGAACAGAACGG + Intronic
909203230 1:72719819-72719841 ATGAAAAAGCAGCCACAGAATGG - Intergenic
909436630 1:75649615-75649637 CTGAAAAATCTTTAGCAGAATGG + Intergenic
909558456 1:76981932-76981954 AGGAAAACTAATGAGCAGAAAGG + Intronic
909686563 1:78355277-78355299 AGAAAAAAGAATGAGGAGAAGGG - Intronic
909841950 1:80338387-80338409 AGGAAAAAGCAGGAGCTGATGGG - Intergenic
910661417 1:89677916-89677938 AATAAAAAGCAGGAGCAAAAAGG - Intronic
910856145 1:91697928-91697950 AGGAAAAAATATGAGCAAAAAGG + Intronic
911708118 1:101039000-101039022 GTGAAACAGCATGTGCAAAATGG - Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
913672802 1:121113806-121113828 TTGAAAAAGGATGAGAAGAGAGG - Intergenic
914024578 1:143901180-143901202 TTGAAAAAGGATGAGAAGAGAGG - Intergenic
914663063 1:149809201-149809223 TTGAAAAAGGATGAGAAGAGAGG - Intronic
914913277 1:151803140-151803162 AAGAATAAGCGTGAGCAGAGAGG - Intronic
915294200 1:154908696-154908718 TAGAAAAGGCAGGAGCAGAAAGG + Intergenic
915983579 1:160440313-160440335 AAGAAAAAGCAAGAGAAGGAAGG - Intergenic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916302133 1:163287370-163287392 ATGAAGGAGCATGAGTAGTAGGG - Intronic
917000945 1:170358117-170358139 ATGAAAAAGTATGAAAAGTATGG + Intergenic
917622684 1:176812983-176813005 ATGAGAACACATGAACAGAATGG - Intronic
918510979 1:185314422-185314444 GTGAAATAGCTTAAGCAGAAAGG + Intronic
918595903 1:186292873-186292895 GTGAAAATGCCTGAACAGAATGG + Intergenic
919223274 1:194659800-194659822 AGGAAAAATAATGAACAGAAAGG + Intergenic
920096748 1:203491534-203491556 AGGAAACAGCATGAGTACAAAGG + Intergenic
920544649 1:206805940-206805962 AGAAAAAAGCAAGAGCAGCAGGG - Intronic
922501227 1:226098430-226098452 ATGACAAAGGATGCCCAGAAAGG + Intergenic
922956633 1:229607463-229607485 AAGAAATAACATGAGCAAAAAGG - Intronic
923046708 1:230361287-230361309 ATTAAAAAGCAAAGGCAGAATGG + Intronic
923544730 1:234915918-234915940 ATGAAAAAGCGTAAGGAGAATGG + Intergenic
924270667 1:242329295-242329317 ATGAAAAAGGCTGAGCACAGTGG - Intronic
924656844 1:245980197-245980219 ATGAAAAATCATGCACAGTAAGG - Intronic
1063242707 10:4187776-4187798 ATGAGAATGCATGAACATAAAGG - Intergenic
1064276289 10:13908289-13908311 AGGAAAAAGGATGAGAAGCATGG - Intronic
1064941281 10:20738807-20738829 ATGTGCAAGCATGAGCAGCAAGG - Intergenic
1065154031 10:22851476-22851498 ATGAAGAAGCATGACCTAAACGG + Intergenic
1065990118 10:31000918-31000940 GGGGAAAAGCATGAACAGAAAGG - Intronic
1067667048 10:48287791-48287813 TTGAAAAAGGCTGAGCAGAAAGG + Intergenic
1067894378 10:50163206-50163228 ATGAAAAAGTTTGAGGAGATAGG - Intergenic
1067954462 10:50777055-50777077 ATGAAAAAGTTTGAGGAGATAGG + Intronic
1068343261 10:55736995-55737017 CAGAGAAAGCAAGAGCAGAAGGG + Intergenic
1069035449 10:63641984-63642006 ATGGCCAAGCATTAGCAGAAAGG - Intergenic
1069308892 10:67008317-67008339 ATTAAAAACCATGAGCACTATGG - Intronic
1069367535 10:67710099-67710121 ATGAAAAAGGATAGGAAGAAAGG + Intergenic
1070457982 10:76636069-76636091 ATGACAAACAATGAGCAGAAAGG - Intergenic
1070775422 10:79106984-79107006 ATCAAAAAGCATGATCATGAGGG - Intronic
1072082732 10:92048005-92048027 TTGGAAAAGCAGCAGCAGAAAGG + Intronic
1074411354 10:113231151-113231173 ATGTGAAAGCTTGTGCAGAAAGG - Intergenic
1075106130 10:119541588-119541610 ATAAAATACCAGGAGCAGAAAGG + Intronic
1077510493 11:2958473-2958495 AAGAAAAAGCAGAAGCATAAGGG - Exonic
1077631999 11:3817239-3817261 AAGGAAAAGCCAGAGCAGAAAGG - Intronic
1078657909 11:13259624-13259646 ATGACAAAGCATGCGCTTAATGG + Intergenic
1080423339 11:32132949-32132971 ATGAATAACAATGAGTAGAATGG - Intergenic
1080781434 11:35433451-35433473 ATCAAAAGGCATGACCAGCAAGG - Intronic
1080871824 11:36243180-36243202 TTGATAGAACATGAGCAGAAGGG - Intergenic
1081282711 11:41229995-41230017 ATGAAATAGAAAGAGCAAAAAGG - Intronic
1082065943 11:47900320-47900342 ATGAATACCCTTGAGCAGAAAGG - Intergenic
1082125781 11:48429755-48429777 ATGAAAAGGAGTCAGCAGAATGG - Intergenic
1082250643 11:49976452-49976474 ATGAAAAGGAGTCAGCAGAATGG + Intergenic
1082665417 11:55970698-55970720 CTGCAAAAGCATGAGTTGAATGG + Intergenic
1083148091 11:60773450-60773472 ACCAAAATCCATGAGCAGAATGG - Exonic
1083379252 11:62251612-62251634 CTCAAGAAGCATGAACAGAAAGG + Intergenic
1085106008 11:73843700-73843722 ATGAAAAAAAATTAACAGAAAGG - Intronic
1085500808 11:77021538-77021560 ATGATGAAACATGAGCAGAGGGG - Exonic
1085986926 11:81799120-81799142 AAGCAAAAGCATGAGCAAGAGGG - Intergenic
1086740235 11:90358717-90358739 AAGAAAAAGTATGAGCAGGAGGG - Intergenic
1088184656 11:107152716-107152738 ATGAAAAAAAATTACCAGAAAGG + Intergenic
1089986181 11:122816163-122816185 AGAAAAAAACAGGAGCAGAAAGG - Intergenic
1090085576 11:123647538-123647560 ATGAAAAAGTAGCATCAGAAGGG - Intronic
1090604203 11:128404664-128404686 AGGACAAAGCATGTGCTGAAAGG + Intergenic
1091097806 11:132840440-132840462 ATGAATGAGAATGAGCAAAACGG - Intronic
1091609290 12:1989716-1989738 TTGAAAAAGCAAGAAAAGAAAGG + Intronic
1092711159 12:11339285-11339307 TTGAAAAAAGATGAGAAGAATGG - Intergenic
1093246343 12:16742011-16742033 ATGAAAAAGCCATGGCAGAAGGG - Intergenic
1093255280 12:16858890-16858912 ATGAGAAAGCAAGAGGAGCATGG + Intergenic
1093806784 12:23443560-23443582 ATTGAAAAGCATCAACAGAAAGG + Intergenic
1094170271 12:27483710-27483732 ATGAAAAAGGATGGGCATAACGG - Intronic
1094279569 12:28720645-28720667 ATGAAGAAACATGATCAGACTGG + Intergenic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1095523510 12:43096530-43096552 AGGGAAAAGCAAGAGGAGAAAGG - Intergenic
1096088956 12:48885526-48885548 ATAAAAAAGAAAGAGAAGAAAGG + Intergenic
1096200532 12:49678798-49678820 AGGCAAAGGCAAGAGCAGAAGGG + Intronic
1096401198 12:51307959-51307981 AAGAAAGAGCAAGAGCATAAAGG - Intronic
1097004871 12:55908927-55908949 AAGAAAAATCATGAGCAAAGGGG + Intronic
1097178099 12:57155004-57155026 ATGAAAAAGCAGGATCAAAGAGG + Intronic
1097812533 12:64034196-64034218 ATGAGACAGCACGAGCAGGATGG - Intronic
1098065714 12:66614092-66614114 CTGAAAAAGGAAGAGGAGAAAGG - Intronic
1098214560 12:68201606-68201628 ATGACAAAACATGTTCAGAATGG + Exonic
1098228068 12:68345310-68345332 ATGAAGGAGAAAGAGCAGAATGG - Intergenic
1101384479 12:104244524-104244546 CTGAAAAAGAATGTGCAAAATGG - Intronic
1101822388 12:108194047-108194069 ATGAAAAAGCATTGGCTAAATGG + Intronic
1102243218 12:111338453-111338475 ATGAAGAAGCTGGAGAAGAAAGG + Exonic
1102726215 12:115067500-115067522 ATGAAACTGCCAGAGCAGAAAGG + Intergenic
1103263158 12:119606676-119606698 ATGAAAAACCATGAGCTAAATGG + Intronic
1104732212 12:131113727-131113749 ATGATACAGCATGAGCAGTGAGG - Intronic
1105378819 13:19867566-19867588 TTGAAAAAGCATGAGATGACTGG + Intergenic
1105480640 13:20772716-20772738 ATGGAACAGCATGAGCAAAGGGG + Intronic
1105706995 13:22973827-22973849 GTGAAAGAGCATGAGAACAAAGG - Intergenic
1106074123 13:26442607-26442629 AAGAGATAGCATGTGCAGAAAGG - Intergenic
1106098546 13:26673102-26673124 ATAAAAAAGCATGAGGATTAAGG - Intronic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1106657951 13:31767519-31767541 ATAAAATAGCACTAGCAGAAAGG + Intronic
1106826266 13:33524323-33524345 AAGAAAAATCATCAGAAGAAAGG - Intergenic
1108158815 13:47616755-47616777 AGAAAAACGCAAGAGCAGAAGGG - Intergenic
1109161508 13:58981017-58981039 ATGAAATAGCATAGGCAGATTGG - Intergenic
1109363363 13:61324826-61324848 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1109543557 13:63811974-63811996 ATGAAAAAGGATAAGCAAAGGGG - Intergenic
1109775015 13:67029185-67029207 ATCACAAAGAAAGAGCAGAAAGG + Intronic
1109780107 13:67099276-67099298 ATGTAAAAGGATGTGGAGAATGG - Intronic
1109961595 13:69638933-69638955 ATGGAAAGGAAAGAGCAGAATGG - Intergenic
1110313131 13:74074121-74074143 ATGAGAAAACAGTAGCAGAAGGG - Intronic
1110829064 13:80009609-80009631 AAAAAAAAGCATAAGGAGAAGGG + Intergenic
1111111303 13:83713742-83713764 ATCAAATAGCAGCAGCAGAAAGG + Intergenic
1111199866 13:84920496-84920518 ATGAAAAAACATGAATAGATAGG + Intergenic
1112377494 13:98856914-98856936 ATAAACAACTATGAGCAGAAAGG + Intronic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1113163314 13:107408670-107408692 ATGAAAAGTCATGATCAGATTGG + Intronic
1113717150 13:112519389-112519411 ATGGAAGATCATTAGCAGAACGG - Intronic
1114136013 14:19851903-19851925 ATGGGAAACCATGAGGAGAAAGG - Intergenic
1114212701 14:20628760-20628782 ATGAAAAGGAGTGATCAGAATGG - Intergenic
1114349778 14:21836792-21836814 ATGACAAACCAAGAGCAGATTGG + Intergenic
1115562363 14:34594713-34594735 ATGAAAAAGCATCTGCTGACAGG + Intronic
1115734569 14:36310742-36310764 AAGAAAAAGCATGGACAGAAGGG + Intronic
1116187205 14:41611555-41611577 AAGAACAAGCATAAGCAGATAGG + Intronic
1116384660 14:44315813-44315835 ATGCAAGAGTAGGAGCAGAAAGG + Intergenic
1117069438 14:52043462-52043484 AAGAAAAGGCATGGGGAGAAGGG + Intronic
1117224697 14:53643421-53643443 ATGAAAAAGCATGAAAATGAAGG - Intergenic
1117470081 14:56035690-56035712 ATGAAAAAGAAAGCTCAGAAAGG - Intergenic
1118923209 14:70168505-70168527 AGGAAAAGGCATGAGGAAAAAGG + Intronic
1118956496 14:70487915-70487937 ATGTGAAAGCAGGAGCAGAGGGG + Intergenic
1119109356 14:71957239-71957261 ATGAGAAGGCATAAGCAGGAGGG + Intronic
1119550535 14:75509201-75509223 TTGAAAAACTATGAGTAGAAGGG + Intergenic
1120089476 14:80314264-80314286 ACGAAAAGGAATGAGCAGAGAGG + Intronic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1121525538 14:94616544-94616566 ATGGAAGAGGAAGAGCAGAAAGG - Intronic
1122431495 14:101650938-101650960 ATGAAAAAGAATGAAGAGTATGG + Intergenic
1122458232 14:101873411-101873433 CTGAAAAAGCAAGAACTGAAAGG - Intronic
1123156731 14:106234469-106234491 AGGAAAATGGATTAGCAGAAAGG + Intergenic
1123207504 14:106727570-106727592 AGGAAAATGGATTAGCAGAAAGG + Intergenic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1124219719 15:27839203-27839225 GTGAAAAAGCATAAGAACAAAGG + Intronic
1124797138 15:32792717-32792739 ATTAAATAGCATGAGCTGGAAGG - Intronic
1125278929 15:38024221-38024243 AGGAAAAGGGATGAGAAGAAAGG + Intergenic
1125442434 15:39717411-39717433 ATGCAAAAGCATTAGGGGAAGGG - Intronic
1125530343 15:40409097-40409119 ATGTAAAAGCATTAGGGGAAAGG + Intronic
1125553309 15:40564325-40564347 ATGAAAAAACAAGTTCAGAAGGG + Intronic
1126245682 15:46502221-46502243 ATGAAAACACATGGACAGAAAGG + Intergenic
1127306493 15:57710903-57710925 ATGCAGAAGGAAGAGCAGAAAGG - Intronic
1127656172 15:61058193-61058215 AGGAAAAAGCACTAGTAGAAAGG + Intronic
1128320049 15:66686971-66686993 AGCAGAAAGGATGAGCAGAAGGG - Intergenic
1129041746 15:72692986-72693008 ATGAAATAAGAGGAGCAGAAAGG - Intronic
1129110230 15:73332866-73332888 ATGAGAAAACATGATCAGAGAGG - Intronic
1130358465 15:83157436-83157458 ATGAAAAAGCAGGCTCAAAACGG - Exonic
1131211867 15:90504463-90504485 AGGCAAAAGAATGAGCAGCAGGG - Intergenic
1135165233 16:20133410-20133432 CGGGAAAAGCATGAGCAGAAGGG - Intergenic
1135690625 16:24534440-24534462 ATCAAAAAGCATGACTATAATGG - Intergenic
1136387322 16:29937195-29937217 ATAAAAAAGCAGAAGAAGAAAGG + Intergenic
1136599359 16:31274313-31274335 AAGAAAAAGAAAGAGGAGAAAGG + Intronic
1137004877 16:35266584-35266606 GTGGAAAAGAATGAGTAGAATGG - Intergenic
1137552933 16:49452987-49453009 ATAAAACAGCCTGAGCAAAAAGG - Intergenic
1139394232 16:66627277-66627299 ATGAAAAAGCATGATTTTAATGG + Intronic
1139456820 16:67086254-67086276 AACAAAGAGCATGAGCAAAAAGG - Intronic
1140168235 16:72576779-72576801 ATGATAAAGTATAAGCAGGAAGG + Intergenic
1140604636 16:76520240-76520262 ATGCAACAGCATGAGCTGACAGG - Intronic
1141239362 16:82250704-82250726 TGGAGAAAGCATGAGCAGAAAGG - Intergenic
1142570996 17:874156-874178 AAGGAGAAGGATGAGCAGAAGGG - Intronic
1142794952 17:2300430-2300452 CTGAACAACCAAGAGCAGAATGG - Exonic
1142960757 17:3551144-3551166 ATGAGAAAGCCTCAGGAGAAGGG + Intronic
1144111168 17:12034795-12034817 ATGAGAGAGAATGAGCATAAAGG + Intronic
1144261679 17:13527707-13527729 AGGAAAATCAATGAGCAGAATGG - Intronic
1144852027 17:18248683-18248705 ATTAACAAGAATGAGCGGAAAGG - Exonic
1144961584 17:19047193-19047215 ATGATAAAACATGGGCACAAGGG - Exonic
1144973576 17:19127331-19127353 ATGATAAAACATGGGCACAAGGG + Intergenic
1146293124 17:31626945-31626967 AAGAGAAAGAAAGAGCAGAAAGG + Intergenic
1146953155 17:36920561-36920583 ATGGAAAAGCAAGAGGAGAAAGG - Intergenic
1149007978 17:51825480-51825502 ATGAAAAAGCAGGCACAGAGAGG + Intronic
1150266321 17:63834477-63834499 ATGATCCAGCATGAGCAGGAGGG + Exonic
1150344635 17:64394675-64394697 ATGAAAAAGCATTAGTGCAATGG + Intronic
1151158549 17:72145077-72145099 ATGAAAAAGGAAAGGCAGAAGGG - Intergenic
1151379475 17:73715522-73715544 ATGCAAAAACAAGATCAGAAAGG + Intergenic
1153590096 18:6664807-6664829 ATGACAAAGCAAGAGCATATGGG - Intergenic
1155136382 18:22997698-22997720 ATGAAGAAGCAAGAGCAGAAGGG + Exonic
1155170727 18:23265220-23265242 ATGAGAGAGCAGGAGGAGAACGG + Intronic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1155777875 18:29791193-29791215 ATGAAAACTCATGAACACAAGGG - Intergenic
1156661998 18:39357273-39357295 ATTAAAGAGCATAAACAGAATGG - Intergenic
1157018774 18:43753604-43753626 ACCAAAAAGCTTGAGAAGAAAGG - Intergenic
1157364808 18:47054948-47054970 AGGGAAAAGCAAGAGAAGAATGG - Intronic
1157934532 18:51858569-51858591 AGGATAGAGCAGGAGCAGAAGGG - Intergenic
1158160033 18:54470895-54470917 ATGAAAACACATGAACAGGACGG - Intergenic
1158202524 18:54956494-54956516 ATGCAAAAGTATTTGCAGAAAGG + Intronic
1158812018 18:61048875-61048897 ATGGAAGAGCATAAGAAGAAAGG + Intergenic
1158855527 18:61540098-61540120 TTACAAAAGCAGGAGCAGAATGG - Intronic
1159465415 18:68776613-68776635 ATGAAAACACATGAACACAAGGG + Intronic
1159529726 18:69640053-69640075 ATGCAATAAAATGAGCAGAAAGG - Intronic
1161790979 19:6360075-6360097 AGGAAAAAGAATGGGCAAAATGG - Intergenic
1161933701 19:7357848-7357870 ATGAAAAAGCATGAGCAGAATGG - Intronic
1164769065 19:30794429-30794451 ACGTAAAAGCAAGACCAGAAAGG - Intergenic
1165768543 19:38365218-38365240 TTGAGAAAGAATGAGAAGAAAGG - Intronic
925740739 2:7004027-7004049 ATGAGAAAGCAAGAGGAGAGAGG - Intronic
925798984 2:7578011-7578033 TTTAAAAAGCAAGAGAAGAAAGG - Intergenic
926432095 2:12798262-12798284 ATAAAATATTATGAGCAGAAAGG - Intergenic
927001711 2:18802146-18802168 ATGTCAAAGTATGAGTAGAAAGG - Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
928378843 2:30801277-30801299 ATGAAAAAGCCTAAGAAGATAGG - Intronic
928909282 2:36402422-36402444 AAGAAACAGCGTGACCAGAATGG + Intronic
929038311 2:37718541-37718563 ATGAATACACATGAGAAGAAGGG - Intronic
929675862 2:43928551-43928573 AGGAAAAATCATGTGCACAAGGG + Intronic
930589550 2:53311333-53311355 ATGTTAATACATGAGCAGAATGG + Intergenic
930986774 2:57598697-57598719 ATGAGGAAGCATGGGCAGCACGG + Intergenic
931182209 2:59914393-59914415 ATGAAAAAACAGGAGCAAGAAGG - Intergenic
932799294 2:74725408-74725430 ATGAAAAAAAATGAGCTGATAGG + Intergenic
933714771 2:85351854-85351876 CTGAAAAAGCTACAGCAGAAGGG + Exonic
934056300 2:88254082-88254104 GAGAAAAAGTATGAGAAGAAGGG + Intergenic
935026428 2:99281625-99281647 AAGAAAGAGAATGAGGAGAAGGG + Intronic
937626944 2:124054566-124054588 GTCAAAAAGCATGAGGAGAGAGG + Intronic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939678267 2:145098858-145098880 AGGAAAAACCAAGAGCAGAGAGG - Intergenic
940022709 2:149172160-149172182 AAGAAGAAGAATGAGCAAAAGGG + Intronic
942338095 2:174912991-174913013 ATGTAAAGCCATGAGTAGAATGG + Intronic
942825613 2:180171364-180171386 ATGAAAAAACAGTAGCTGAATGG + Intergenic
942827769 2:180200624-180200646 ATGAATAAAAATGTGCAGAAAGG + Intergenic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
943279620 2:185915571-185915593 ATGAAAAGGCATCAGAAAAATGG - Intergenic
943302051 2:186215102-186215124 AAGGAGAAGAATGAGCAGAAGGG + Intergenic
943675196 2:190710249-190710271 TTGAAAATGCATGAGATGAAAGG - Intergenic
943791662 2:191939649-191939671 ATGAAGAGGCATGAACAGAAAGG + Intergenic
943920085 2:193695328-193695350 AAAAAAAAGCACAAGCAGAAAGG - Intergenic
945100569 2:206258938-206258960 ATGGCAAAGCCTGAGCAAAATGG + Intergenic
945611319 2:212007593-212007615 ATGTAAAAACATTAGCAGATAGG - Intronic
946312569 2:218890972-218890994 ATAAAAAAGCAGCAGAAGAAAGG + Intronic
947106010 2:226668511-226668533 ATGCAAAAGCCTCAGCAGAGTGG + Intergenic
948875054 2:240821579-240821601 ATTAAAAAGCATGAGGAAAACGG - Intergenic
1169632915 20:7653438-7653460 ATGAACCAGCATGTGTAGAAAGG - Intergenic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170820078 20:19750094-19750116 AAGAAAAAGCATTACCGGAAAGG - Intergenic
1171189378 20:23148172-23148194 ATGAAGAGGCCTGAGCAGGAAGG + Intergenic
1172828830 20:37814416-37814438 ATGGAAAACCATGAGAAGAGTGG - Intronic
1173104016 20:40114946-40114968 GTCAAAGAGCCTGAGCAGAAAGG - Intergenic
1173718072 20:45228545-45228567 ATGGAAAAACATGTGCATAATGG - Intergenic
1176054550 20:63137079-63137101 AGGAAAGAGCATGGGCAGAGAGG + Intergenic
1176669620 21:9720833-9720855 AGGAATGAGCAGGAGCAGAATGG + Intergenic
1177196307 21:17907102-17907124 ATGAAAAAGCAGGCTCAGAGTGG + Intronic
1177271736 21:18857579-18857601 ATAAAAAAGCAGTATCAGAAGGG + Intergenic
1177363896 21:20108924-20108946 ATGAAAGAGAATGATCAGAGTGG + Intergenic
1177754785 21:25333253-25333275 TTCAAAAAGCAAGAGAAGAAGGG + Intergenic
1177928808 21:27253495-27253517 ATGACAAAAAATGAGAAGAAAGG - Intergenic
1178733427 21:35127013-35127035 AAGCATAAGAATGAGCAGAATGG + Intronic
1178733768 21:35130584-35130606 ATGAAAAAGCAAGAGAATTAAGG - Intronic
1179303669 21:40135626-40135648 AAGAAAAACAATGAGCAGGAAGG - Intronic
1179390180 21:40981427-40981449 AGGAAAAAGCATAATCATAAAGG + Intergenic
1182733784 22:32516116-32516138 ATGAAAAGCAGTGAGCAGAATGG + Intronic
1182763128 22:32738990-32739012 AGAAAAAAGAATGAGCAGATGGG - Intronic
1183200599 22:36383449-36383471 ATCCAAAAGCATCAGCAGATGGG + Intronic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1184933511 22:47699811-47699833 ATCAAAAGAGATGAGCAGAATGG - Intergenic
949307098 3:2654472-2654494 ATATAAAAGCATGAGAAAAAAGG - Intronic
949392342 3:3577164-3577186 ATGCAAAGGTATGAGCAGAGTGG - Intergenic
949622529 3:5830592-5830614 ATGAAAACTCATGAACACAAAGG + Intergenic
949711665 3:6877487-6877509 ATGTAAAAGCAGGAGTAGCAGGG - Intronic
950562302 3:13740197-13740219 ATGAAAAAACATCATTAGAAGGG - Intergenic
950685459 3:14615192-14615214 ATTAAAATGCATGAGAACAATGG + Intergenic
951482382 3:23175009-23175031 ATGTAAAATACTGAGCAGAATGG - Intergenic
952521854 3:34168736-34168758 ATTAAAAGGCATGAGGAAAAGGG + Intergenic
952528777 3:34241878-34241900 ATGAAGAAACATGATCAGAGAGG - Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953798755 3:46005373-46005395 ATGAAACTGCATGAGGAAAACGG + Intergenic
955045854 3:55358988-55359010 AGGAAAAAGAAAGAGAAGAAGGG + Intergenic
955701651 3:61687615-61687637 ATGAAAAAGAATGAGAAGTTAGG + Intronic
956153000 3:66263542-66263564 ATTTAAAAGAATGAGTAGAATGG + Intronic
956923257 3:73953463-73953485 ATGGAAAAGTAAAAGCAGAAGGG + Intergenic
957106655 3:75897692-75897714 ATTATAGAGAATGAGCAGAATGG + Intergenic
957902735 3:86516694-86516716 ATGAAAAAAGCTGTGCAGAAAGG - Intergenic
958193036 3:90207643-90207665 ATGAAAAAGCCTTAGATGAAAGG - Intergenic
958513346 3:95078296-95078318 CTGAAAAAGCAAGACTAGAAAGG - Intergenic
958564099 3:95785556-95785578 ATGATAAACCATGAACATAATGG + Intergenic
958829831 3:99073711-99073733 ATGAAAACTAATGAACAGAAAGG - Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
960191896 3:114716586-114716608 ATGAAAAGGGAAGAGCAAAAAGG - Intronic
960890738 3:122444823-122444845 AGGAAAACGAATAAGCAGAAAGG + Intronic
962098027 3:132312176-132312198 GTGAAAAATCCTGAGCAAAAAGG + Intergenic
962494707 3:135927334-135927356 ATGAAACAGCATTAGGAGACTGG + Intergenic
962595847 3:136942749-136942771 ATGGAAAAGCCTGGACAGAAAGG - Intronic
962849662 3:139298871-139298893 ATGAAAAAGCAAGTGCTAAAAGG - Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
964386023 3:156148829-156148851 ATGAAAAAGCAAGTGATGAAAGG - Intronic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
964963605 3:162460714-162460736 AGGAAGAAGCATGAGAAAAAAGG + Intergenic
965549153 3:169946681-169946703 AGGAAAAAGTATGTGCAGAAGGG - Intergenic
965843045 3:172929594-172929616 ATGAGAAGGCAGGAGGAGAAAGG - Intronic
966209566 3:177438982-177439004 TTAAAAAAGCATGAACAGCATGG + Intergenic
966292414 3:178375384-178375406 ATGAAAAAGAATGACATGAAAGG + Intergenic
966540888 3:181088466-181088488 ATGATACAGCATGGACAGAATGG + Intergenic
966763737 3:183439846-183439868 ATGAAAATGCATGGACACAAAGG + Intergenic
968239447 3:197063682-197063704 ATGAAAATACATGGGCAAAAGGG - Intronic
970318932 4:14856501-14856523 AGGAAAAAGCATGTGCACAGTGG + Intergenic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971702562 4:29997519-29997541 ATGAAAGACCATGAAAAGAAAGG - Intergenic
971715458 4:30169800-30169822 ATGAAAAGGAATGAAGAGAAAGG - Intergenic
972263226 4:37432842-37432864 ATGAAAAAGGAAGAGGGGAAAGG + Intronic
972379492 4:38505862-38505884 AAGAAACAGCATGAGCAGATAGG - Intergenic
972400087 4:38693354-38693376 AAAAAAAAGCATGAGAAGTAAGG + Intronic
972465657 4:39354225-39354247 CTAAAAAAGTATGAGTAGAATGG - Intronic
973000002 4:44935641-44935663 AAGAAAATGCAGGAGAAGAATGG + Intergenic
973367234 4:49217652-49217674 ATGTAGAAGCATGTTCAGAAGGG - Intergenic
973656124 4:53049631-53049653 ATGTTAAAGAGTGAGCAGAAAGG + Intronic
974358336 4:60841888-60841910 ATGAAAAAGCATTTGCCAAATGG - Intergenic
974655003 4:64807046-64807068 ATGAAAAAGAATCAAAAGAAAGG + Intergenic
975282017 4:72571634-72571656 AGGATAAAGCATGAGAAAAAAGG - Intergenic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
977032481 4:91903627-91903649 ATTAAAAAGTATGAGAAAAAGGG - Intergenic
977066911 4:92329775-92329797 AAGAAAAAACAGGAGCAAAATGG + Intronic
977761012 4:100737001-100737023 ATGAAGATGAAAGAGCAGAATGG + Intronic
978435926 4:108684537-108684559 ATGAAAAAGCATGTACACCAAGG - Intergenic
978908925 4:114043124-114043146 AGGAAGAAGAATGAGCAAAAGGG + Intergenic
978973617 4:114841504-114841526 TTGAAAAAGCAAGCGCAGAGAGG + Intronic
979144701 4:117229508-117229530 AAGATAAGGGATGAGCAGAAGGG + Intergenic
979647137 4:123083165-123083187 TTGAAAAGGAATGGGCAGAAGGG + Intronic
980295207 4:130905375-130905397 ATGAAGGAGAATGAGCAAAAAGG + Intergenic
980302537 4:131012733-131012755 ATGAAAATGCATCAGCAGTTTGG - Intergenic
980384476 4:132069380-132069402 AGAAAAAAGCATGTGCAAAAGGG + Intergenic
980884550 4:138747935-138747957 AAGAAGAAATATGAGCAGAAAGG + Intergenic
981155914 4:141434813-141434835 CTGAAAAAACATGGACAGAAGGG - Intergenic
982230985 4:153207931-153207953 ATGGATAAGCATGATCAGCAAGG - Intronic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982353545 4:154442939-154442961 ATGACAGGGCATGAGCAGAGGGG - Intronic
982359079 4:154499536-154499558 ATGAAAATGCATGAGAAGAGAGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983794198 4:171839746-171839768 ATGAAAATTCACAAGCAGAAAGG + Intronic
983974486 4:173916428-173916450 CTGAGAAAGCATGAGCTGAATGG + Intergenic
984608474 4:181811625-181811647 AAGACAAAGCATGAGCAAAAGGG + Intergenic
985294827 4:188425512-188425534 AAGAGAAAGCAAGAGCAGGATGG - Intergenic
985349673 4:189045385-189045407 ATGAAAACGCATGCACAAAAAGG - Intergenic
985405155 4:189630632-189630654 AGGAATGAGCAGGAGCAGAATGG - Intergenic
985728911 5:1534060-1534082 ATGAAAAAGCAGCCACAGAATGG - Intergenic
986524553 5:8659533-8659555 AGGAAAAAGCATAAGCAAATAGG - Intergenic
987183765 5:15393255-15393277 GTGAAGAAGGAAGAGCAGAAAGG - Intergenic
987903347 5:24042959-24042981 ATGAAAAAGCTTGAAAATAATGG + Intronic
988095552 5:26604610-26604632 ATGAAAAAATATTAGCAAAAAGG - Intergenic
988908963 5:35820582-35820604 ATGATAAAGGATAAGCTGAAAGG - Intergenic
989328985 5:40233452-40233474 ATGAGAAGGCCTGACCAGAAAGG - Intergenic
989807088 5:45622595-45622617 ATGAGAAAGGATGAGCTGCAAGG + Intronic
992031830 5:72728845-72728867 TTGAAAAAAGATGAGAAGAATGG + Intergenic
992643565 5:78791599-78791621 ATTCAAAACCATGAGCAGACTGG - Intronic
993998794 5:94753751-94753773 ATGAACATGCATATGCAGAAGGG + Intronic
995086572 5:108117975-108117997 ATGAAAAAGCAGGAGATGGAGGG + Intronic
995567888 5:113450893-113450915 ATAAAAATGTATTAGCAGAAGGG + Intronic
995730251 5:115231655-115231677 ATGAAAAATCATGAGAGGAGGGG + Intronic
995944296 5:117624288-117624310 ATGATAATAAATGAGCAGAAAGG - Intergenic
998103924 5:139456526-139456548 ATGAAACAGCATGACCAAGATGG + Intronic
998256048 5:140589398-140589420 AGGGAAGAGAATGAGCAGAATGG + Intronic
998584110 5:143407740-143407762 ATGACAAAACATGAAGAGAATGG - Intronic
998754428 5:145360343-145360365 AGGCAAAAGCATAAGCAGTAAGG + Intergenic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
999854089 5:155574745-155574767 ATAAAATGGCATGAGCAAAAGGG + Intergenic
1000208846 5:159091611-159091633 ATGAAGAACCATGAACTGAAAGG + Intronic
1000209627 5:159097669-159097691 ACCAAAAAGCATGTGGAGAAGGG + Intronic
1000840850 5:166216332-166216354 GAGAAAAAGCATAAGAAGAAAGG + Intergenic
1002051259 5:176572909-176572931 ATGAAACAAAATAAGCAGAATGG + Intronic
1002438272 5:179247349-179247371 AGGAAAAAGAATGAGGAAAAAGG + Intronic
1003299882 6:4869908-4869930 ATGCAAAACCATGGGAAGAACGG - Intronic
1003333061 6:5145562-5145584 ATAAAAAAGCTTCATCAGAAGGG + Intronic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004129311 6:12903643-12903665 ATTAAGAAGCATGAGTAAAATGG + Intronic
1005335078 6:24787981-24788003 ATGAAAAGGCAAGAACAGACTGG + Intergenic
1006497155 6:34431983-34432005 AGGAAAGAGCTTGAGCTGAAAGG + Intergenic
1006663422 6:35669975-35669997 TTGAGAAATAATGAGCAGAATGG - Intronic
1008215854 6:48787563-48787585 ATTAAAAAGAATGAGCAATAGGG + Intergenic
1008413365 6:51209938-51209960 ATGGAAAGGCATGTTCAGAAGGG + Intergenic
1008761230 6:54853136-54853158 ATGAGAAAGCTGGAGGAGAAAGG + Intronic
1010007540 6:71011859-71011881 ATGAAGAAGCAAGAGCAAAGGGG - Intergenic
1010050588 6:71499252-71499274 TTTAAAAAGCATGAGATGAAAGG - Intergenic
1010324909 6:74553325-74553347 TTGAGAAAGCATGAGCAGGTGGG - Intergenic
1010364366 6:75032093-75032115 TTGAAAAAGGATTAGAAGAATGG + Intergenic
1011074636 6:83425501-83425523 AGGAAAAAGAATGAGCAAAAGGG + Intronic
1011381017 6:86742263-86742285 ATGCAAAATCATGATCAGGATGG - Intergenic
1011656771 6:89559279-89559301 AGGAAACAGCAAGAGCAAAAAGG - Intronic
1011832978 6:91395718-91395740 ATGAGAAAGCAGGAGCTAAATGG + Intergenic
1011869636 6:91876504-91876526 AGGTAAAAGCATAAGGAGAAGGG + Intergenic
1012129502 6:95472674-95472696 TTGAAAAAACATTAGAAGAATGG + Intergenic
1012394590 6:98781793-98781815 ATGAAAAAAGATGGGCAGATTGG + Intergenic
1012732729 6:102902349-102902371 ATGGAAACCCAGGAGCAGAAAGG + Intergenic
1012841331 6:104332391-104332413 ATGAAAAAGCATGACCCACAGGG + Intergenic
1012861741 6:104568372-104568394 ATGAAAAAGACTGAGGAAAAAGG + Intergenic
1013011344 6:106123378-106123400 ATGGAAAAGGAAGAGAAGAAGGG - Intergenic
1013380304 6:109562628-109562650 ATCAAAAAGCAAGAGCCAAAAGG - Intronic
1013622361 6:111902248-111902270 AGGAAAAAGCATGAGCAAAGAGG - Intergenic
1013801119 6:113944827-113944849 ATGAGAAAACATAAGCACAAAGG + Intronic
1014356053 6:120411634-120411656 ATGAAAAAGAAAGAACAGGAAGG + Intergenic
1014608079 6:123503718-123503740 GTGTCAAAGCATGAACAGAAAGG - Intronic
1014809337 6:125868282-125868304 ATTATAAACCATGAGCAAAAAGG - Intronic
1015065649 6:129023396-129023418 ATGGAAAAAGAGGAGCAGAATGG - Intronic
1015868445 6:137751804-137751826 AAGAATAAGCAGCAGCAGAAGGG + Intergenic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016306210 6:142686559-142686581 ATCAAAAAGCAGAAGCAAAACGG + Intergenic
1016359473 6:143252090-143252112 ATGAAAAAGCAAGAGAAAAATGG - Intronic
1016576860 6:145578849-145578871 AGGCAAAAGCAGGAGAAGAAGGG + Intronic
1016941981 6:149490061-149490083 ATGAAAAGACATGAGCACTATGG + Intergenic
1017206846 6:151811714-151811736 ATAAAAAAGTAAGATCAGAAAGG - Intronic
1017448918 6:154535433-154535455 AAAAAAATGCATGAGAAGAATGG - Intergenic
1018007060 6:159632021-159632043 ATGAGAAAGCAGGAGTAGAGAGG - Intergenic
1018078818 6:160240951-160240973 AAGAAAATGCATCAGCATAATGG - Intronic
1018460418 6:163993528-163993550 AAGAAAAAGCATGAGAGGAGGGG - Intergenic
1019166938 6:170103304-170103326 CTGACAAAACATGAGCAGCAGGG + Intergenic
1020623252 7:10544293-10544315 AGGAAAAAGTATGGGCAGAGGGG - Intergenic
1021009318 7:15442573-15442595 AAGAGCAAGCATGGGCAGAAGGG - Intronic
1021782708 7:24121359-24121381 ATGAAAAAGAATGTGCTGATTGG - Intergenic
1022521998 7:31014405-31014427 ATGAAGAAGGATGGGCAGAAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023183206 7:37507210-37507232 CTGAAAAGGCTTTAGCAGAAAGG - Intergenic
1023289813 7:38657256-38657278 ATGAGGAAACAAGAGCAGAAAGG - Intergenic
1024715468 7:52074955-52074977 ATGAAACAGCCTGAGAAGGAGGG + Intergenic
1025582810 7:62741672-62741694 TTGAAAAAACATTAGAAGAATGG - Intergenic
1026497730 7:70918350-70918372 ATGAAACACCATTATCAGAAAGG - Intergenic
1026701049 7:72645469-72645491 ATCAAAAAACATGTACAGAAAGG + Intronic
1027470601 7:78568933-78568955 AGGGAAGAGCATGTGCAGAACGG - Intronic
1027486300 7:78765837-78765859 AAGAAAAAGCATGAGAAGCCTGG + Intronic
1027587106 7:80071951-80071973 ATGAATAAGCAAGAGCTGCAAGG + Intergenic
1028390262 7:90308147-90308169 ATGAATAAGCAGGTTCAGAATGG - Intronic
1028394027 7:90347839-90347861 GAGGAAAAGCATGAGCAGAATGG + Intronic
1028556239 7:92128345-92128367 CTGAAGAATCATGAGAAGAAAGG - Intronic
1028771867 7:94634420-94634442 CTTAAAAAGCATTAGCAGACTGG - Intronic
1028828166 7:95298331-95298353 TTGAAAAAGCAAGAGTACAAGGG + Exonic
1028885889 7:95932461-95932483 AGGGAAAGGCCTGAGCAGAATGG + Intronic
1029805354 7:102990355-102990377 CTGAAAAAGCAAGACAAGAAGGG + Intronic
1029837082 7:103323597-103323619 AAGAAAAAGAAAAAGCAGAATGG - Exonic
1030181769 7:106716922-106716944 CTGAAAAAGAATGTCCAGAAAGG + Intergenic
1030354588 7:108527908-108527930 ATGAAAGAGCATAAGCGGAGAGG - Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030846731 7:114424789-114424811 AACAGAAAACATGAGCAGAAAGG - Intronic
1031019263 7:116609414-116609436 ATGTAAGATTATGAGCAGAAAGG + Intergenic
1031269123 7:119622600-119622622 ATGAAAAAGAATAAGAAAAATGG + Intergenic
1031473971 7:122200622-122200644 AACCAAAAGCATGACCAGAATGG + Intergenic
1031589878 7:123577755-123577777 ATGAAGAAACATGAGCTGGATGG - Intronic
1032157574 7:129481614-129481636 ATTAAAAAGAATGAGCAGCCGGG + Intronic
1032327859 7:130949035-130949057 AGGAAAAAACATAAGCATAAGGG + Intergenic
1032660139 7:133973941-133973963 ATGAAAAGGCAAGAGAAAAAGGG + Intronic
1032666032 7:134037383-134037405 ATCAAAAAGCATGAGATGATGGG + Intronic
1032734611 7:134680279-134680301 ATGAAAAACCATGAAAAAAATGG - Intergenic
1032953147 7:136939137-136939159 ATGAGGAAGCAGTAGCAGAAGGG + Intronic
1032967976 7:137123564-137123586 ATTAAAAAGCAGGAACATAAGGG + Intergenic
1033301784 7:140192621-140192643 ATGAAGAAGGAAGAGAAGAAAGG + Intergenic
1034567816 7:151929537-151929559 ATGAAAGATCAGAAGCAGAAGGG - Intergenic
1035634061 8:1130420-1130442 AAGATAAACCAGGAGCAGAAGGG + Intergenic
1035907960 8:3534675-3534697 ATGAAAAAGGATGTACACAATGG - Intronic
1035938023 8:3864407-3864429 GAGAAAAAGCATGAGAAGAAAGG + Intronic
1037292520 8:17366433-17366455 ATGAATCAGCATCAGCAGAATGG + Intronic
1037936729 8:22919933-22919955 AGGAAAAGGCCTGGGCAGAATGG + Intronic
1039080534 8:33729819-33729841 ATGATAAAGCAGTAGCATAAGGG - Intergenic
1041546754 8:59054247-59054269 ATGAATAGGCATGAGCACAGAGG + Intronic
1041587758 8:59541828-59541850 ATAAAATAGCAGAAGCAGAAAGG - Intergenic
1042401932 8:68359781-68359803 ATGAAATACCATAAGCACAAAGG + Intronic
1042694805 8:71545160-71545182 ATGAAAAAGCAGGTTCAGACTGG - Intronic
1044493005 8:92842970-92842992 ATGAAGGAGCAAGAGAAGAAAGG - Intergenic
1044509602 8:93059258-93059280 TTGCAAAAGAATGAGCAAAATGG + Intergenic
1044951604 8:97440791-97440813 ATGAAAACCCATAACCAGAAAGG + Intergenic
1045566759 8:103324954-103324976 ATACAAAAGCATGAACAAAACGG - Exonic
1045757315 8:105559471-105559493 AAGAAAGAGTATGAGAAGAAGGG + Intronic
1045775695 8:105799943-105799965 AGGAAAGAGGATGAGCAGAAAGG - Intronic
1045997296 8:108378118-108378140 ATGAAAACTCAGTAGCAGAATGG - Intronic
1046003288 8:108447176-108447198 ATGAAACAAAATGAACAGAATGG - Intronic
1046021692 8:108672865-108672887 ATCATAAAGAATGAGCAGGATGG + Intronic
1046640026 8:116719417-116719439 ATGAAAAAGAAAGAGTGGAAAGG + Intronic
1047011974 8:120682767-120682789 CTGAAAAAGCATGACCAAAATGG + Intronic
1047464473 8:125099225-125099247 AAGATAAAGCAGAAGCAGAAGGG + Intronic
1047759850 8:127946169-127946191 GAGAGTAAGCATGAGCAGAAAGG - Intergenic
1048016032 8:130498690-130498712 CTGAAAAAGCATAGCCAGAAAGG + Intergenic
1048037066 8:130687075-130687097 AAGACAAAACATGAGCAGATAGG - Intergenic
1048605614 8:135965252-135965274 ATGAAAAAGGATGAAAAAAAAGG + Intergenic
1050018252 9:1258668-1258690 GGGCAGAAGCATGAGCAGAAGGG - Intergenic
1050584552 9:7097009-7097031 GTGAAAAAACATGAGCAAAATGG - Intergenic
1050610012 9:7342345-7342367 ATGAAAACAGATGAGCAGAGAGG + Intergenic
1051499285 9:17759335-17759357 GTGAAACAGCATCAGCAGGAAGG - Intronic
1051563461 9:18469611-18469633 ATGAAACAGCAAGAGCTGCAAGG + Intergenic
1051826269 9:21223722-21223744 ATAAAAAAGAATGACCAGAAGGG + Intronic
1052277462 9:26693447-26693469 ATGAAAATGGCTTAGCAGAATGG - Intergenic
1052506751 9:29364703-29364725 ATGAACAAGAATGACCACAAAGG - Intergenic
1052657745 9:31385114-31385136 ATGAAAAGGCCAGAGAAGAAGGG - Intergenic
1055311509 9:74986762-74986784 ATTAAGAAGAATGAGCAGTAGGG - Intronic
1055312865 9:75002193-75002215 GTGAAAAAGCTGGAGCAGAAAGG - Intronic
1056293139 9:85164207-85164229 AGGAAACAGCATAAGCCGAAAGG + Intergenic
1057470791 9:95354308-95354330 ATCAAAAAGCCTGGGCAGCATGG + Intergenic
1057496368 9:95564431-95564453 ATAACAAACCATGGGCAGAAAGG + Intergenic
1058151439 9:101468055-101468077 ATAAAATGGCATGAGCAGAAAGG + Intergenic
1058198047 9:102002868-102002890 AAGAGTAAGTATGAGCAGAATGG + Intergenic
1058239074 9:102533564-102533586 CTGATAAAGCATGTGCAGAAGGG - Intergenic
1058472731 9:105297833-105297855 AGGAAAGGGCATGAGCAGGAGGG - Intronic
1058791291 9:108448483-108448505 ATGCAAAAGCCTGAGATGAAGGG + Intergenic
1059520147 9:114933333-114933355 AGGAGAGAGAATGAGCAGAAGGG - Intergenic
1060345564 9:122812906-122812928 TTTAAAAAGCCTCAGCAGAAGGG + Intronic
1060698149 9:125727796-125727818 GTGAAAAAACAAGAGCAGAGAGG + Intergenic
1060987387 9:127827598-127827620 ATGAAACAGCAGCAGCAGAAGGG + Intronic
1203656245 Un_KI270753v1:34-56 AGGAATGAGCAGGAGCAGAATGG - Intergenic
1186081927 X:5942719-5942741 AAGGAAAAGCATGAGAATAATGG + Intronic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1186355248 X:8783656-8783678 ACGAAACATCATCAGCAGAAGGG - Intergenic
1188286160 X:28327697-28327719 AGAAAAAAGCAGAAGCAGAAAGG - Intergenic
1188684303 X:33050695-33050717 ATGACAAAGCTTGATTAGAATGG + Intronic
1190188420 X:48255880-48255902 AAAAAAAAGCATGGGCAGGATGG - Intronic
1190827859 X:54034057-54034079 ATGAAAATTCAACAGCAGAATGG + Intronic
1191598189 X:62971250-62971272 AGGAAAAAAAATGAGGAGAAGGG + Intergenic
1191999938 X:67138766-67138788 ATTAAAAAGGAAGAGCAAAATGG - Intergenic
1192202580 X:69076181-69076203 ATGAAATATCATGAGCAAATGGG + Intergenic
1192261751 X:69509783-69509805 ATGAAAAAGCATGACCTGCGTGG + Intronic
1192262055 X:69511349-69511371 AAGAAAAAGGATGGGGAGAAGGG - Intronic
1193366251 X:80637437-80637459 ATGAACAAGGATGAGTAAAAAGG - Intergenic
1193520083 X:82518970-82518992 ATGCAAAAGCTTGAGCAGCTGGG + Intergenic
1193599760 X:83496016-83496038 ATGAATAAGTATGTGCAGACTGG + Intergenic
1194703079 X:97138747-97138769 ATGCAAAAGGATGAACAAAATGG - Intronic
1194933585 X:99919039-99919061 TTGAGAAAGCTTGAGCAGAAAGG + Intergenic
1195521110 X:105830496-105830518 ATAAAAAAGAATAAGCAGTATGG - Intronic
1195964095 X:110414409-110414431 AGGAAAAAGGATGAGGGGAAAGG + Intronic
1196006832 X:110845487-110845509 ATGAAACAGACTAAGCAGAAAGG - Intergenic
1196868531 X:120090946-120090968 AGGAGAAAGCATGAAGAGAATGG + Intergenic
1197305644 X:124837994-124838016 AGGATAAAACATGAGCAGAGAGG + Intronic
1197478115 X:126948035-126948057 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1198250363 X:134874193-134874215 AAGAAGAAGAATGAGCAAAAGGG + Intergenic
1198491096 X:137142342-137142364 AGGAAAAAGTAAGAGAAGAAGGG - Intergenic
1198635411 X:138693755-138693777 ATCAAAAAGCATAGGCACAAAGG - Intronic
1198692596 X:139300567-139300589 AAGAAAAGGCATGAGCAGAAAGG - Intergenic
1198971079 X:142280945-142280967 ATGAAGAATGATGATCAGAAAGG - Intergenic
1199277063 X:145957688-145957710 CTGAAAAAATATGAGCAAAAGGG + Intergenic
1201312717 Y:12611535-12611557 TTGTAAAAGCTTGAGCAAAAGGG + Intergenic
1201488370 Y:14514349-14514371 GTGAAAAAGCATGACCAGTTAGG + Intergenic
1202139028 Y:21701674-21701696 AGGAAAAAGCAGAAGCTGAAGGG - Intergenic