ID: 1161939764

View in Genome Browser
Species Human (GRCh38)
Location 19:7395113-7395135
Sequence CTCGCGCGGCTTCCCGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161939759_1161939764 13 Left 1161939759 19:7395077-7395099 CCGCCTCCGAGGCGGGATCGCGC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1161939754_1161939764 21 Left 1161939754 19:7395069-7395091 CCTCTGCCCCGCCTCCGAGGCGG 0: 1
1: 0
2: 2
3: 18
4: 333
Right 1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1161939761_1161939764 7 Left 1161939761 19:7395083-7395105 CCGAGGCGGGATCGCGCATGCGC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1161939760_1161939764 10 Left 1161939760 19:7395080-7395102 CCTCCGAGGCGGGATCGCGCATG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1161939757_1161939764 15 Left 1161939757 19:7395075-7395097 CCCCGCCTCCGAGGCGGGATCGC 0: 1
1: 0
2: 1
3: 7
4: 513
Right 1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1161939758_1161939764 14 Left 1161939758 19:7395076-7395098 CCCGCCTCCGAGGCGGGATCGCG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 46
1161939753_1161939764 22 Left 1161939753 19:7395068-7395090 CCCTCTGCCCCGCCTCCGAGGCG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161939764 Original CRISPR CTCGCGCGGCTTCCCGCTTC CGG Intronic
901624984 1:10618721-10618743 CTCGCACGGCTTCCCCGTGCGGG - Intronic
902723799 1:18322352-18322374 CACGCCCGTCTTCCCTCTTCTGG + Intronic
905752340 1:40477186-40477208 CTCGGGCGGCTTCCAGCTTCCGG + Intergenic
910759378 1:90719436-90719458 GTCGCCCAGCTACCCGCTTCCGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
1070549600 10:77480711-77480733 CTAGCGCAGCTTCCCCCTCCCGG + Intronic
1072332010 10:94363118-94363140 CCCGCCCGGCTTCCCGCCTTTGG - Intergenic
1075768880 10:124917026-124917048 CGCGCGCGGCTCCCGGCTGCCGG - Intergenic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1078497320 11:11831499-11831521 GACTCGCGGCTTGCCGCTTCTGG + Intergenic
1113565725 13:111318560-111318582 CTCCCGCAGCTTCCCGGTGCTGG + Intronic
1130295940 15:82647276-82647298 CTCGTGCGGCTTCCCAATCCTGG - Intronic
1132582995 16:693936-693958 CTCGCTCGCCCTCCCGCTTGGGG - Exonic
1133239490 16:4405790-4405812 CTTCCGAGGCTTCCCGCTCCTGG + Intronic
1136548578 16:30969357-30969379 CTCGCTCTTCGTCCCGCTTCGGG - Exonic
1140617874 16:76689523-76689545 TTCACGCAGCTTCCAGCTTCTGG + Intergenic
1140748332 16:78000612-78000634 CTCGAGCGGGTTGCCGCTGCTGG - Intergenic
1148582369 17:48752769-48752791 CTCCCACGGTTTCCCGCATCTGG + Intergenic
1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG + Intronic
925725125 2:6865036-6865058 CCCGGGCGGCTTCCCGGTCCGGG + Exonic
936010838 2:108924348-108924370 CTCGGGCGCCTTCCCTCTGCAGG + Intronic
937329714 2:121018954-121018976 CTCCCGCGCCTCCCCGCCTCAGG - Intergenic
945102444 2:206274753-206274775 CCCGCGCCGCTTCTCGCCTCCGG + Exonic
1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG + Intronic
1176194919 20:63832346-63832368 CTCGCGCGGCTGCCGGCCACAGG - Intergenic
1176552856 21:8236497-8236519 CCCCCGCTGCTTCCCGCCTCAGG + Intergenic
1176571754 21:8418900-8418922 CCCCCGCTGCTTCCCGCCTCAGG + Intergenic
1176579665 21:8463462-8463484 CCCCCGCTGCTTCCCGCCTCAGG + Intergenic
1203257833 22_KI270733v1_random:152897-152919 CCCCCGCTGCTTCCCGCCTCAGG + Intergenic
949648623 3:6128673-6128695 CTCGAGCGGGTTGCCGCTGCTGG + Intergenic
967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG + Intergenic
968734237 4:2287063-2287085 CTCCTGCCGCTTCCAGCTTCTGG - Intronic
992098339 5:73382195-73382217 CCAGCGCGGCTTCCGGCGTCCGG - Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1004720439 6:18264189-18264211 CGGGCGCGGTTTCCCGCCTCGGG - Intronic
1006752552 6:36387729-36387751 CTCGCGCGCCTGCCCGCCTGCGG - Exonic
1027774088 7:82443592-82443614 CCCGCGCGGCTCCGCGCCTCGGG - Exonic
1036178267 8:6560504-6560526 CTCGCTCGGTTTACGGCTTCTGG - Intronic
1036793621 8:11740113-11740135 CTCCTGGGGCTTCCGGCTTCAGG - Intronic
1040575916 8:48651430-48651452 CTCCCCCGGCTGCCAGCTTCCGG + Intergenic
1054697181 9:68372276-68372298 CTCCCGCCTCTTCCAGCTTCTGG + Intronic
1054842574 9:69759666-69759688 CTGGCCCGGCTTTCCGCTACCGG - Intronic
1061509356 9:131051000-131051022 CTCCCGGGGCTCCCCGCTTCAGG + Intronic
1062413693 9:136437511-136437533 CTCCCGCTGCCTCCCGCTCCTGG - Intronic
1062673662 9:137726531-137726553 CTCGGGTGGCTTCCCCCTTTTGG + Intronic
1062675147 9:137738622-137738644 CTCGGGTGGCTTCCCCCTTTTGG - Intronic
1203474026 Un_GL000220v1:134920-134942 CCCCCGCTGCTTCCCGCCTCAGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic