ID: 1161939833

View in Genome Browser
Species Human (GRCh38)
Location 19:7395335-7395357
Sequence GAGGCCCGAGGCAGCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 2, 2: 10, 3: 44, 4: 337}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161939833_1161939854 24 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939854 19:7395382-7395404 CAGGCAGGCGAACGGGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 178
1161939833_1161939840 -8 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939840 19:7395350-7395372 CGGGCCTCCCGCCGGCTCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 245
1161939833_1161939850 16 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939850 19:7395374-7395396 GACTTCTCCAGGCAGGCGAACGG 0: 1
1: 1
2: 2
3: 9
4: 132
1161939833_1161939849 9 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939849 19:7395367-7395389 CCTGGGGGACTTCTCCAGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 248
1161939833_1161939842 -6 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939842 19:7395352-7395374 GGCCTCCCGCCGGCTCCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 287
1161939833_1161939851 17 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939851 19:7395375-7395397 ACTTCTCCAGGCAGGCGAACGGG 0: 1
1: 0
2: 2
3: 7
4: 111
1161939833_1161939839 -9 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939839 19:7395349-7395371 TCGGGCCTCCCGCCGGCTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 195
1161939833_1161939847 5 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939847 19:7395363-7395385 GGCTCCTGGGGGACTTCTCCAGG No data
1161939833_1161939855 25 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939855 19:7395383-7395405 AGGCAGGCGAACGGGTGCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1161939833_1161939853 23 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939853 19:7395381-7395403 CCAGGCAGGCGAACGGGTGCTGG 0: 1
1: 0
2: 1
3: 13
4: 235
1161939833_1161939841 -7 Left 1161939833 19:7395335-7395357 CCCCCGGGGCTGCCTCGGGCCTC 0: 1
1: 2
2: 10
3: 44
4: 337
Right 1161939841 19:7395351-7395373 GGGCCTCCCGCCGGCTCCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161939833 Original CRISPR GAGGCCCGAGGCAGCCCCGG GGG (reversed) Intronic
900127608 1:1075465-1075487 GATGCCCGCGGCAGCCCTGGGGG - Intergenic
900176788 1:1294659-1294681 CAGCCCCTGGGCAGCCCCGGGGG - Intronic
900202713 1:1418317-1418339 GACGACCGAGGCAGCCCCTTAGG - Intergenic
900400436 1:2470822-2470844 CAGGCTCGTGGCAGCCACGGTGG - Intronic
900438725 1:2643120-2643142 GAGCCCCCAGGCCGCCCCAGTGG + Intronic
900656242 1:3759428-3759450 GAGGCACAAGGCAGCCACGTCGG - Intronic
901069113 1:6508458-6508480 GAAGGCAGAGGCAGCCCCAGTGG + Intronic
901317627 1:8319317-8319339 GTGGCCCAAGGCAACCCCGTGGG + Intronic
901640948 1:10692719-10692741 GAGACCGGAGGCAGCCCTGAGGG - Intronic
901696654 1:11012802-11012824 GCGGCCCGAGGCAGACGCAGCGG + Intronic
901810726 1:11765679-11765701 GAAGCCATGGGCAGCCCCGGGGG - Intronic
903483373 1:23670829-23670851 CAGGGCCGAGGCAACCCTGGTGG - Intergenic
904620589 1:31772850-31772872 GAGCCCAGAGACGGCCCCGGCGG - Intergenic
905213114 1:36387957-36387979 GAAGCCTGAGGAAGCCCCTGGGG - Intergenic
905304028 1:37005305-37005327 GAGGCCAGAGTCAGCCCTAGTGG - Intronic
905449363 1:38046879-38046901 GAGGCGGGAGGCAGCTCCGCGGG - Intergenic
906038247 1:42766593-42766615 GCGGCCCGAGGCAGCGGCGCAGG + Exonic
906718463 1:47988001-47988023 GAGGCCCCAGACACCCCTGGAGG - Intronic
907237753 1:53063166-53063188 GAGGCTCCTGGCAGCCTCGGGGG + Intronic
910549739 1:88462728-88462750 GGCGCCCGCGGCAGCCCCAGCGG - Intergenic
912503957 1:110142947-110142969 GAGCCCCAAAGCAGCCCCAGAGG - Intergenic
913592231 1:120341061-120341083 GAGGCCGGAAGCAGCCCCGCCGG + Intergenic
914598575 1:149176885-149176907 GAGGCCGGAAGCAGCCCCGCCGG - Intergenic
915318659 1:155043947-155043969 AAGGCCCGGGGCAGCCCAGCTGG - Intronic
916075180 1:161196532-161196554 GAGGCCCCAGTCAGCACCGCAGG - Intronic
919977677 1:202623364-202623386 GGGGCCAGAGGCAGCCCCCTGGG - Intronic
922718287 1:227887878-227887900 GTGGCGCGGTGCAGCCCCGGGGG - Intergenic
922756706 1:228101018-228101040 GAAGCCCGAGGCTGCTCCTGTGG - Exonic
922792709 1:228318930-228318952 GCCCCCCGAGGCAGCCCAGGAGG + Exonic
924503008 1:244653705-244653727 GGGTCCCGGGGCAGCCCCGGGGG - Intronic
1063453740 10:6168815-6168837 CAGGAGCGAGGCAGCCCCAGTGG + Intronic
1064340084 10:14477840-14477862 GAGGGCAGTGGCAGCCCTGGGGG - Intergenic
1067227548 10:44385553-44385575 GCGGCCCAAGGCAGCCGAGGGGG + Intronic
1067375776 10:45727000-45727022 AAGGCCCGAGGCAGCGGCGCGGG - Intergenic
1067549902 10:47226954-47226976 GAGGCTGGAGGCAGCCAGGGAGG + Intergenic
1067883486 10:50067688-50067710 AAGGCCCGAGGCAGCGGCGCGGG - Intergenic
1069452291 10:68527342-68527364 GACGGCCGCGGCAGCCCTGGCGG - Exonic
1070555950 10:77527834-77527856 GGAGCCCGAGCCAGCCCCTGGGG - Intronic
1071288587 10:84171926-84171948 GATGGCCGAGGCAGCCCCTTAGG - Intergenic
1071618179 10:87094983-87095005 GAGGCCCGGGGAGGCCGCGGCGG - Intronic
1073266388 10:102230737-102230759 GCGGCCGGAGCCAGCCCGGGGGG + Exonic
1073266417 10:102230799-102230821 GGTGCCCGGGGCAGCCGCGGCGG + Exonic
1073434447 10:103507778-103507800 GAGGGCAGAGGCAGCACCTGCGG + Intronic
1074864029 10:117534842-117534864 GAGGCCCGAGGGAGCCTCTGGGG - Intergenic
1076794272 10:132791188-132791210 GAGGACCGAGGCTGTCCAGGTGG + Intergenic
1077011745 11:381822-381844 GAGTCCCGAGGCAGCTGCTGGGG + Exonic
1077035517 11:492593-492615 GGGCCCCGAGGCAGACCCGGGGG - Intergenic
1077221723 11:1420918-1420940 GAGGGCCGAGGGGGCCCTGGGGG - Intronic
1077361854 11:2144372-2144394 GGGGCCCGGAGCACCCCCGGTGG + Intronic
1077472776 11:2772046-2772068 GAGGTCGGAGGGAGCCCCAGCGG - Intronic
1079470017 11:20769284-20769306 GAGCCTCTAGACAGCCCCGGAGG + Intronic
1081810434 11:45911131-45911153 GAGGCCAGAGCCAACCCCAGAGG - Intronic
1083199159 11:61109401-61109423 GAGGCCCCAGGCAGTGGCGGTGG - Intronic
1084179391 11:67438889-67438911 CGGGCCCGAGGCAGCCCTGGAGG - Exonic
1084273524 11:68040870-68040892 TAGGCCCAGGGCTGCCCCGGGGG - Intronic
1084296252 11:68214557-68214579 GAGACCCTGGGCAGCCCCGCAGG - Intergenic
1084839264 11:71831574-71831596 GAGGCGGGGGGCAGCCCCGGGGG + Intergenic
1085396674 11:76210095-76210117 CATGCCCGAGCCACCCCCGGGGG - Intronic
1089091899 11:115885294-115885316 GATTCCCTAGGCAGCCCTGGTGG - Intergenic
1089378318 11:118010806-118010828 GAGCCCAGAGGCAGTCACGGGGG - Intergenic
1090422301 11:126583842-126583864 CAGGCCCGAGGCAGCCAGGTAGG + Intronic
1091772612 12:3162859-3162881 GAGAGCTGAGGCAGCCCTGGAGG + Intronic
1092902709 12:13074914-13074936 GAGGCCCAAGGTAGTCCCAGGGG + Intronic
1093262331 12:16954120-16954142 TGGGCCCCAGGCAGCCCAGGAGG + Intergenic
1095261711 12:40105815-40105837 GGGGCCCGGGGCTGCCCGGGGGG + Exonic
1096345513 12:50842866-50842888 GAGGCGCGAGTGAGGCCCGGAGG - Intergenic
1099369393 12:81811627-81811649 GAGACCAGAGGGAGCCCCTGGGG + Intergenic
1102566626 12:113801454-113801476 GAGGCGCAAGGCTGCTCCGGGGG - Intergenic
1102725731 12:115062934-115062956 GAGGCCCAAGGGAGCCGGGGAGG + Intergenic
1104038083 12:125112317-125112339 GAGCCCGGAGGCAGCCTTGGGGG + Intronic
1104860648 12:131921649-131921671 TAGCCCCAGGGCAGCCCCGGAGG + Exonic
1104962330 12:132494111-132494133 GAGGCCTGAGGAAGCCCCGCTGG + Intronic
1104981376 12:132574394-132574416 GCCCCCCGAGGCCGCCCCGGGGG - Exonic
1104988558 12:132611279-132611301 GAGGCCAGGGACAGCCCAGGGGG + Intergenic
1105547792 13:21364505-21364527 GAGCCCCGAGGCTGCCTCTGAGG + Intergenic
1105695451 13:22884068-22884090 GATGGCCGAGGCAGCCCCTTAGG + Intergenic
1106269405 13:28138872-28138894 GAGGCCCGGGGCAGCCCCGGCGG - Exonic
1107988401 13:45796084-45796106 GGGACCCGAGGGAGCCCCTGAGG + Intronic
1111975995 13:94967940-94967962 GACGCACGGGGCAGCCGCGGAGG + Intergenic
1113311868 13:109140400-109140422 GAGGCCCGCGGGCGCCCCGGGGG + Exonic
1113672461 13:112184294-112184316 CAGGCACGTGGCAGCCCCCGAGG - Intergenic
1113961206 13:114127273-114127295 GACCCCGGAGGCAGCCCTGGGGG - Intronic
1118353010 14:64987383-64987405 GAGGACAGAGGCAGCCCGTGCGG + Intronic
1121351158 14:93174173-93174195 GTGTCATGAGGCAGCCCCGGTGG + Intergenic
1121710961 14:96039156-96039178 GAGGCCCGAGGCCGCCCCGCTGG - Intergenic
1122388326 14:101363961-101363983 GGGGCCCGAGGCAGCATCTGTGG - Intergenic
1122582233 14:102777866-102777888 GAGGCGGGAGGCAGCCCGGCTGG - Intronic
1122691524 14:103534040-103534062 GAAGCCCGTGGCTGCCCTGGTGG + Intronic
1122817246 14:104319788-104319810 GAAGCCAGAGGCAGAGCCGGAGG - Intergenic
1122918007 14:104867666-104867688 GAGCCCCGTGGCAGCCTGGGAGG - Intronic
1122970598 14:105150612-105150634 GAGGCCCGGAGAAGCCCTGGGGG + Exonic
1123216026 14:106810072-106810094 GAGTCCCGAGGAAGCCCAGGAGG - Intergenic
1202898669 14_GL000194v1_random:23788-23810 GCGGCCCGAGGCACACCCTGTGG + Intergenic
1123464558 15:20505964-20505986 GAGGCCCGAGGCTGCCCCGCGGG + Intergenic
1123653556 15:22495077-22495099 GAGGCCCGAGGCTGCCCCGCGGG - Intergenic
1123743976 15:23303937-23303959 GAGGCCCGAGGCTGCCCCGCGGG - Intergenic
1124275287 15:28321931-28321953 GAGGCCCGAGGCTGCCCCGCGGG + Intronic
1124307417 15:28589670-28589692 GAGGCCCGAGGCTGCCCCGCGGG - Intergenic
1124370642 15:29103146-29103168 GAGGCCAGGAGCAGGCCCGGTGG + Intronic
1124370784 15:29103680-29103702 GTGGCCCGAGGGAGCCCAAGTGG + Intronic
1124493325 15:30171728-30171750 GGGGCCAGAGGCAGCCCCCTGGG - Intergenic
1124750209 15:32366597-32366619 GGGGCCAGAGGCAGCCCCCTGGG + Intergenic
1126112061 15:45181140-45181162 GAGGCCCACGCCAGCCTCGGAGG - Intronic
1128455193 15:67827982-67828004 GTGGCCCGAGGCGGCGCCGGGGG - Intronic
1128539133 15:68512737-68512759 GAGGCCCGAGGCAGAGTCAGAGG + Intergenic
1129231657 15:74200408-74200430 GAGGCCCCAGGAAGCCACTGAGG + Intronic
1129252918 15:74318621-74318643 GAGGCCTGGGGCAGCCTTGGGGG - Intronic
1129262677 15:74377419-74377441 GAGGCCAGAGCCAGCACTGGGGG + Intergenic
1129350798 15:74955080-74955102 GAGGCCAGGGCCAGCCCGGGAGG + Exonic
1131336761 15:91556294-91556316 GAGGCCCGAGGCACCTCGGGTGG + Intergenic
1132799919 16:1746947-1746969 GGGGCCTCAGGCAGCCACGGCGG + Intronic
1132952292 16:2570067-2570089 CAGGCCAGAGACAGCCCAGGTGG - Intronic
1132959272 16:2613066-2613088 GACGCCCCAGGCAGCCCCCATGG - Intergenic
1132962059 16:2630103-2630125 CAGGCCAGAGACAGCCCAGGTGG + Intergenic
1132972332 16:2695041-2695063 GACGCCCCAGGCAGCCCCCATGG - Intronic
1133382754 16:5345114-5345136 GAGGGTCGAGGCAGCCCCCTGGG - Intergenic
1134441592 16:14302263-14302285 GAGGCCGGGTGCAGCCCCGTCGG + Intergenic
1135994112 16:27235547-27235569 GAAGCCCGCGGCAGCCTCCGTGG - Intronic
1136146160 16:28317768-28317790 GAGGCCTGAGGCAGCCCAGGGGG + Intronic
1136913856 16:34163427-34163449 GAGGCGCGAGGGAGCCTCCGAGG - Intergenic
1137267956 16:46884310-46884332 CAGGCCCGGGGCGGCCCCGACGG + Intergenic
1137621883 16:49881587-49881609 GAGGCTCGAGGCAGCAGAGGAGG + Intergenic
1138023384 16:53503752-53503774 GAGGCCCGAGGCCGCCACGTCGG + Intronic
1138105742 16:54286358-54286380 GCGGGCAGAGGCAGCTCCGGCGG - Exonic
1138532989 16:57645327-57645349 GAGGAACGAGGGAGCCCCGGAGG - Intronic
1139761458 16:69187452-69187474 GGGCCCCGAGGCGGCGCCGGCGG - Exonic
1139923436 16:70473310-70473332 GGGGCCCGGGGCAGCCCTCGCGG - Exonic
1142160252 16:88553868-88553890 GAGGAAGGAGTCAGCCCCGGTGG + Intergenic
1142237276 16:88928169-88928191 GAGGCGTGAGGCAACCCTGGTGG - Intronic
1142806198 17:2372427-2372449 GAGGCCCGCGGAGGCCCCCGGGG - Exonic
1142870416 17:2816150-2816172 GAGGCCCGAGCCGGCTCCGGGGG + Intronic
1143058998 17:4184430-4184452 GGGGCCAGGGGCAGCCCCTGTGG - Intronic
1143125113 17:4636873-4636895 GAGGACAGAGACAGCCCAGGAGG - Intronic
1143403400 17:6660285-6660307 GAGGACAGAGACAGCCCAGGAGG + Intergenic
1143495060 17:7307984-7308006 GAGCCGCGAGGCAGCCACGCGGG + Intronic
1144849357 17:18236188-18236210 GGGGCCCAAGGCAGCCACGTAGG - Intronic
1145238935 17:21228302-21228324 CAGGCCCAAGGCAGCTCCTGAGG - Intergenic
1145865520 17:28238780-28238802 GAGGGTCGAGGCAGCCCCTTAGG - Intergenic
1146056517 17:29584051-29584073 GAGGCCAGAGGCAGGACCTGTGG - Intronic
1148090925 17:45022111-45022133 GAGGCCCGGCCCAGCCCGGGAGG + Intergenic
1148804435 17:50257230-50257252 GAGGGGCAGGGCAGCCCCGGTGG + Intergenic
1149549968 17:57532875-57532897 GAGGCCCCAGGCTGCCCCACAGG - Intronic
1149649515 17:58268147-58268169 GAGGGCCGAGGCAGCCACCCTGG - Exonic
1150124486 17:62627631-62627653 GAGGGAGGAGGCAGCCCGGGCGG - Exonic
1151597781 17:75088500-75088522 GAGGAGGGAGGCAGCCCCAGAGG - Intronic
1151713882 17:75821738-75821760 GAAGCCCGGGGCTGCCCTGGGGG + Intronic
1152204438 17:78967105-78967127 GGGGCCCGCGGCAGGCCCGCTGG + Intergenic
1152238073 17:79148775-79148797 GAGGCTGCAGGGAGCCCCGGCGG - Intronic
1152366526 17:79859827-79859849 GGGGCCTGAGGCAGCATCGGTGG + Intergenic
1152377832 17:79927888-79927910 GGGGCCAGAGCCAGCCCCGCAGG + Intergenic
1152432062 17:80253995-80254017 GAGGCCTGTGGCAGCCTCAGAGG + Intergenic
1152468060 17:80476742-80476764 GCGAGCGGAGGCAGCCCCGGTGG - Intronic
1152728972 17:81960777-81960799 GCGGACCGAGGCGGCGCCGGCGG - Exonic
1153008104 18:514706-514728 GAGGTCCGAGGAGGGCCCGGAGG - Intergenic
1153008115 18:514736-514758 GAGGTCCGAGGAGGGCCCGGAGG - Intergenic
1153008159 18:514859-514881 GAGGTCCGAGGAGGGCCCGGAGG - Intergenic
1153008203 18:514982-515004 GAGGTCCGAGGAGGGCCCGGAGG - Intergenic
1153008306 18:515260-515282 GAGGTCCGAGGAGGGCCCGGAGG - Intergenic
1153457175 18:5295123-5295145 GCGGCCCGCGGCGGCCCCGGCGG + Intronic
1157370859 18:47110016-47110038 AAGGGCAGAGGCAGCCCTGGTGG - Intronic
1157506388 18:48229745-48229767 GAGGCCCGAGGAAGACGTGGGGG + Intronic
1157535290 18:48453143-48453165 GAGGCCCCAGACAGCCCCTTGGG - Intergenic
1157599640 18:48886044-48886066 CAGGCCCCGGGCAGCCGCGGGGG + Intergenic
1160148504 18:76383142-76383164 GAGTCCCGAGCCACCCCAGGAGG + Intronic
1160408129 18:78656680-78656702 GAGGACAGAGGCCACCCCGGAGG - Intergenic
1160706315 19:531812-531834 GAGGCAGGCGGCGGCCCCGGTGG + Exonic
1160753822 19:747634-747656 GAGGCCGGGGGCGGCCCCTGGGG - Exonic
1160798789 19:957614-957636 GAGGATCGAGGGAGCCCAGGAGG + Intronic
1160877018 19:1301262-1301284 GCGGCTCGAGGCACGCCCGGTGG + Intergenic
1160909789 19:1469172-1469194 GGGGACCGAGGCGGGCCCGGGGG + Exonic
1160936133 19:1596001-1596023 GAGGCCCTCGCCAGCCCAGGAGG - Intergenic
1161271537 19:3392523-3392545 GACTCCCGAGACAGCCCCTGAGG + Intronic
1161388895 19:4011129-4011151 GAAGCCAGAGGCAGTCCCAGTGG - Intronic
1161412408 19:4123861-4123883 GAGCCCCGATGCTGGCCCGGAGG - Exonic
1161701204 19:5796635-5796657 GAGGCCGGAGCCAGGCGCGGTGG + Intergenic
1161721522 19:5905084-5905106 GAGGCCCGGGGCCGGCCAGGTGG + Intronic
1161939833 19:7395335-7395357 GAGGCCCGAGGCAGCCCCGGGGG - Intronic
1162341868 19:10096188-10096210 GGGGCCCGGGGCGGGCCCGGGGG - Exonic
1162369606 19:10270874-10270896 GAGGCCGGGAGCAGCCCCCGGGG + Exonic
1162744651 19:12791719-12791741 GAGGCCCGGAGCGGCCCCGCAGG + Exonic
1163241670 19:16067482-16067504 GAGGGCGGAGGCACCCCGGGAGG + Intronic
1163507997 19:17719635-17719657 GGGGCCCGCGGGAGCCCGGGAGG + Intronic
1164835578 19:31353133-31353155 GAGGCCAGAAGCGGCCGCGGCGG + Intergenic
1165121251 19:33560217-33560239 CAGGCCCGGGGCAGCCTCAGGGG + Intergenic
1165750496 19:38256461-38256483 GAGGCCTGAGGCGGCCGGGGTGG - Exonic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166302144 19:41917416-41917438 GAGGCCCGAGGCGGCTCCCGAGG - Intronic
1167331603 19:48859625-48859647 GAGGGCCCCGGCGGCCCCGGTGG - Exonic
1167606030 19:50481606-50481628 GTGGCCCGAGGCAGGCTAGGAGG + Intronic
1167984769 19:53305160-53305182 GAGGCCCGATCCAGACCCTGAGG - Intergenic
1168103406 19:54153011-54153033 GGGGCCCGAGGCTGCCCCGGGGG - Intronic
1168276095 19:55279553-55279575 GAGGCCGGGGGCAGCGCCAGGGG + Exonic
924965668 2:74143-74165 GAGGCCTGAGGAAGCCCCTGTGG - Intergenic
924968554 2:101195-101217 GAGGCCCCTGGCAGGCCCGGGGG + Intergenic
925730530 2:6917306-6917328 GAGGCCCGGAGCCGCCCCGCAGG - Intergenic
925924087 2:8658227-8658249 GATGCCCGATGCAGCCTCAGAGG + Intergenic
927451146 2:23210494-23210516 GAGGCCTGAGGAAGCCCTTGGGG + Intergenic
927519571 2:23690669-23690691 GAGTCCGGAGGCGGCCCCGCAGG - Intronic
932621862 2:73269439-73269461 GAACCCCGAGGCAGCGGCGGCGG + Exonic
934527380 2:95060061-95060083 GAGGCCCCACGCAGCCCCCCAGG + Intergenic
934715452 2:96540423-96540445 GAGGGCCGAGGCAGGCTAGGTGG - Intronic
934755113 2:96819236-96819258 GCTGCCAGAGGCAGCCCCTGAGG + Intronic
937124650 2:119465896-119465918 GAGGCACGTGTCAGCCCCGCCGG + Intronic
938289069 2:130140039-130140061 GAGGCCCCAGGCAGTCCCGGAGG - Exonic
938467460 2:131532899-131532921 GAGGCCCCAGGCAGCCCCGGAGG + Exonic
938536485 2:132253116-132253138 GAGCCCAGAGGCAACCCTGGGGG + Intronic
941666454 2:168247616-168247638 GAGGGAGGAGGCAGCGCCGGCGG + Exonic
946411986 2:219520072-219520094 AAGGGTCCAGGCAGCCCCGGGGG + Intronic
947333314 2:229053538-229053560 GAAGCCCCATGCAGCCCCTGGGG - Intronic
947751612 2:232535549-232535571 GAGGCCCGAGGCTGGCTCAGGGG + Exonic
948468113 2:238161850-238161872 GAGAACCCAGGCAGCCCCAGGGG + Intronic
948642735 2:239385787-239385809 GAGTGCCGAGGAAGCCACGGAGG + Intronic
1169262475 20:4148835-4148857 GGGGCCCGAGCCAGCCGCCGCGG - Exonic
1171177206 20:23061455-23061477 GAGGTCTGAGGCACCCCCAGTGG - Intergenic
1171180199 20:23085931-23085953 GAGGCGGGAGGCAGCCCTGACGG - Exonic
1171767167 20:29296756-29296778 GAGGCACGAGGGAGCCCCCGAGG + Intergenic
1171810208 20:29741173-29741195 GAGGCGCGAGGGAGCCCCGGAGG + Intergenic
1171865373 20:30484887-30484909 GAGCCTGGAGGCAACCCCGGGGG + Intergenic
1171971359 20:31567085-31567107 GAGGGCAGAGGCAGGTCCGGGGG - Intronic
1173565145 20:44033181-44033203 GGGGCCAGAGGCAGGCACGGGGG + Intronic
1175851660 20:62097196-62097218 GTGGCCCGAGGCGGGCCCTGGGG + Intergenic
1175903973 20:62370912-62370934 GAGGCAGGTGGCAGCCCTGGGGG - Intergenic
1175994284 20:62805274-62805296 CGCGCCCGAGGCACCCCCGGGGG - Intronic
1176140497 20:63542737-63542759 GAGGCCCGGCCCAGCCCCGTGGG + Intronic
1176178769 20:63740178-63740200 GCCGCCCGGCGCAGCCCCGGCGG - Intronic
1176236490 20:64056084-64056106 GAGGCCAGTGGCGGCCCTGGCGG - Intronic
1176236497 20:64056103-64056125 GAGGCAAGAGGCATCCCCAGAGG - Intronic
1176273107 20:64246742-64246764 GAGGCGCGGGCCAGCCCTGGGGG + Intergenic
1176301792 21:5102121-5102143 GAGGCTCCAGGGAGCCCCGTGGG + Intergenic
1176548726 21:8212740-8212762 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1176556621 21:8256949-8256971 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1176567657 21:8395775-8395797 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1176575560 21:8439991-8440013 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1176618350 21:9039777-9039799 GCGGCCCGAGGCACACCCTGTGG + Intergenic
1179304803 21:40144421-40144443 GAGCCCCGGGGCAGACCCGAGGG + Intronic
1179534364 21:42041893-42041915 CAGGCAGGGGGCAGCCCCGGGGG - Intergenic
1179802609 21:43818026-43818048 CAGGCCCGGGGCAGCCCCTGGGG - Intergenic
1179855239 21:44159779-44159801 GAGGCTCCAGGGAGCCCCGTGGG - Intergenic
1179968204 21:44818615-44818637 AGGGCCCGGGGCAGCCCCGTAGG - Intronic
1180920986 22:19521575-19521597 GAGGCCCAAGGCTGCCTGGGAGG - Intergenic
1181277171 22:21694481-21694503 GAGCCCCGAGGCTGGCCTGGTGG - Intronic
1181283623 22:21736503-21736525 GGGGCCAGACGCAGACCCGGGGG - Intergenic
1181478236 22:23181356-23181378 CAGGCCCGGGGCAGCCGCGTCGG + Exonic
1181671427 22:24427285-24427307 GTGCGACGAGGCAGCCCCGGAGG - Intronic
1183165141 22:36141809-36141831 GATGCCAGAGGCAGCGCCAGTGG + Exonic
1183504485 22:38201834-38201856 GAGAATCGCGGCAGCCCCGGGGG + Intronic
1183601697 22:38843884-38843906 GAGGCCCCCGGCAGGCGCGGCGG + Exonic
1184086637 22:42269924-42269946 GGGGCCCCTGGCAGCCCCGGGGG - Intronic
1184109083 22:42384637-42384659 GAGGCACGAGGCAGCCAGGCAGG - Exonic
1184200057 22:42962546-42962568 GAGGCCCAAGGCAGAACTGGGGG + Intronic
1184472160 22:44702187-44702209 GAGGCCGGGGGCGGACCCGGGGG - Intronic
1185059821 22:48600417-48600439 GGGGCCCGAGGCAGCCCTTGTGG + Intronic
1203253609 22_KI270733v1_random:129045-129067 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1203261665 22_KI270733v1_random:174124-174146 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
952356937 3:32593189-32593211 GGCGCCCGAGGCAGCCTCGAGGG + Intergenic
954200357 3:49020379-49020401 GCGGGCTGAGGCAGCCCTGGGGG + Intronic
954400686 3:50318002-50318024 GAGCCCCCAGGAAGCCCAGGAGG - Exonic
955386598 3:58485791-58485813 GAGGCCCTAGGCAGGCGCAGTGG - Intergenic
956785220 3:72636895-72636917 GAGGCCTGAGGCAGCTCATGGGG - Intergenic
956995859 3:74825543-74825565 GACGGCCGAGGCAGCCCCTTAGG + Intergenic
960987387 3:123289877-123289899 GAGGCCGGAGGCAGCCATGTAGG + Exonic
961037340 3:123651760-123651782 GAGGCCAGAGGCTGGCCCTGTGG - Intronic
961749619 3:129087517-129087539 GAGCCCAGAGGCGGCCCAGGTGG - Intergenic
961831796 3:129626883-129626905 GAGGCCGGAAGCGGCCCCGGAGG + Intergenic
961920285 3:130418262-130418284 GAGGCCTGAGGCAGGCACGCAGG - Intronic
962263125 3:133927565-133927587 CAGGCCCGAGGGCGCCCCGGCGG + Intergenic
962432240 3:135330197-135330219 GAGCCCTGAGGCAGGCGCGGTGG - Intergenic
962676951 3:137764579-137764601 CAGCGCCCAGGCAGCCCCGGGGG - Exonic
966182197 3:177197557-177197579 GAGGCCCGCGGCGGCGGCGGCGG + Intergenic
967184228 3:186931208-186931230 GAGGCCCGCGGCAGCGGAGGGGG + Intronic
968519287 4:1028436-1028458 GGGGCTCCAGGCAGCCCCTGAGG - Intergenic
968520895 4:1034262-1034284 GAGGCCTGAATCAGCCCCGGGGG + Intergenic
968548022 4:1208397-1208419 GAGGCTGCAGGCAGCTCCGGGGG - Intronic
968628395 4:1638120-1638142 GAGGCCGGGGGCAGCCTTGGGGG - Intronic
968653845 4:1770354-1770376 GGGCCCCGCGGCAGCCCGGGCGG + Intergenic
969178124 4:5415509-5415531 GGGGCCTGAGGAAGCCCCAGAGG + Intronic
969218778 4:5745948-5745970 AAGGCCCGAGGCAGGCACAGTGG + Intronic
969617533 4:8262352-8262374 GAGCCCCTGGGCAGGCCCGGAGG - Intergenic
971027147 4:22599763-22599785 GAGGGCCGAGGCAGCCCCTTAGG + Intergenic
972274749 4:37546708-37546730 GATGGCCGAGGCAGCCCCTTAGG + Intronic
975778717 4:77818731-77818753 CAGGCCCGAGGCAGCGCCGTGGG + Intronic
978463146 4:108979958-108979980 GAGGAGCGAAGCAGGCCCGGGGG + Intronic
979033160 4:115678477-115678499 GAGGCCCGGCGCAGCACTGGCGG - Intergenic
979468942 4:121072371-121072393 GAAGCCCGCGCCAGCCCCGCGGG - Exonic
982183504 4:152772955-152772977 GAGGCTGGAGGCAGCCGAGGCGG - Intronic
982712198 4:158768919-158768941 GAGGAGCGCGGCGGCCCCGGCGG - Intergenic
984768676 4:183419324-183419346 GGTGCCTGAGGCAGCCCCGAGGG + Intergenic
985895573 5:2748635-2748657 GCGGCCGCGGGCAGCCCCGGTGG + Exonic
986928979 5:12795005-12795027 GAGGCCTGCGGCAGCCCTGGAGG - Intergenic
989638038 5:43556936-43556958 GAGGCCCGAGTGAGGCGCGGCGG - Exonic
992796056 5:80255974-80255996 GAGGCGCGAGGCAGCCAGGAGGG - Exonic
993901200 5:93585066-93585088 GTGGCCGGGGGCAACCCCGGCGG + Exonic
995808111 5:116076970-116076992 GAGTCCAGAGGAAGCTCCGGAGG - Intergenic
997528960 5:134570590-134570612 GAGGCTGCAGGCAGCCCAGGTGG - Intronic
997718248 5:136058015-136058037 CAGGCCTGAGGCACCCCTGGGGG + Intronic
998114574 5:139526385-139526407 GACGGCCGAGGCAGCCCCTTAGG + Intergenic
998282388 5:140823833-140823855 GGGTCCCGAGGCTGCCCTGGTGG + Exonic
999322735 5:150625163-150625185 GAGCCCCCACGCAGCCCAGGAGG - Intronic
999366697 5:151028094-151028116 GAGGCGGCAGGCAGCCCTGGGGG + Exonic
1000605077 5:163318983-163319005 GACGGCCGAGGCAGCCCCTTAGG - Intergenic
1001702859 5:173720382-173720404 AAGGCAAGAGGCAGCCTCGGAGG - Intergenic
1002281129 5:178130768-178130790 GAGGCCCGGGGCCGGGCCGGAGG + Intergenic
1002518419 5:179775926-179775948 GAGGCCGTAGGCCGGCCCGGAGG + Exonic
1003028303 6:2578537-2578559 GAAGCTGGAGGCAGCCCCAGAGG - Intergenic
1003068227 6:2921019-2921041 GAGGCCTGAGGCAGGCACAGGGG - Intergenic
1003556028 6:7141119-7141141 GCGGCCCGAGGGGGCCCCTGCGG - Intronic
1004914594 6:20320175-20320197 GAGGCCGGAAGCAGCCGCGTTGG + Intergenic
1007346044 6:41229950-41229972 GGGGCCAGAGGCAGCCCCTAAGG - Intronic
1007733932 6:43968683-43968705 GAGACCGGAGGCAGCCAAGGTGG + Intergenic
1015786576 6:136924529-136924551 GAGGTCAGGGGCAGCCCCCGAGG + Exonic
1015855163 6:137616520-137616542 GAGGCCTGAGGCAGTGCCTGTGG - Intergenic
1018931552 6:168243266-168243288 GAGGGCAGAGGCAGCCTGGGTGG + Intergenic
1019134054 6:169897245-169897267 GAGGCCCTGGGCTGCCCAGGTGG - Intergenic
1019404898 7:877890-877912 GAGGCAAGGGGCAGGCCCGGAGG - Intronic
1019410461 7:904523-904545 GGGGCCCGGGGCTGCCCCCGGGG - Intronic
1019513716 7:1430518-1430540 CAGGGCAGGGGCAGCCCCGGGGG + Intronic
1019733196 7:2638516-2638538 CAGCCCGGAGGGAGCCCCGGGGG + Intronic
1019736131 7:2650629-2650651 GAGGCAGGAGGCAGACCCGAGGG + Intronic
1020037663 7:4974439-4974461 CGGGCCCGAGGCCGCCGCGGAGG + Intergenic
1020162155 7:5781185-5781207 CGGGCCCGAGGCCGCCGCGGAGG - Intronic
1022099385 7:27160338-27160360 GCGGCCAGAGACAGCCCGGGCGG + Intergenic
1022113895 7:27246666-27246688 GGGTCCGGAGGCTGCCCCGGAGG - Intronic
1022667938 7:32428746-32428768 GAGGCGCCAGCCAGCCCTGGGGG + Intergenic
1023841605 7:44101481-44101503 GAGGCACCAGGCAGCTCTGGAGG + Intergenic
1024637277 7:51301149-51301171 GTGGCCCAGGGCAGCGCCGGAGG - Intronic
1024965375 7:55019105-55019127 GAGTCCCGAGCTAGCCCCGGCGG + Exonic
1025189805 7:56887839-56887861 GAGGCCTGAGCCACCCCCAGAGG - Intergenic
1025682134 7:63689082-63689104 GAGGCCTGAGCCACCCCCAGAGG + Intergenic
1028639729 7:93029083-93029105 GAGCCCCCAGGCACCCCCTGGGG + Intergenic
1029507565 7:100971511-100971533 GCGGGCAGAGGCAGCCTCGGAGG - Intronic
1029665662 7:101993469-101993491 GAGGCCTGAGCCACCCCCAGAGG - Intronic
1032074046 7:128827888-128827910 GAGGCCGGAGGAAGCCAGGGAGG - Intergenic
1032127456 7:129205372-129205394 GAGGCCCGTGACGGCCCCGAAGG - Exonic
1032130760 7:129225383-129225405 GAGGCCCTGGTCAGCCCCGACGG + Exonic
1032490635 7:132321653-132321675 CAGGCAGGAGGGAGCCCCGGGGG + Intronic
1033044306 7:137947501-137947523 GAGGCTCAGGGGAGCCCCGGAGG - Intronic
1034335965 7:150323608-150323630 GGGGCCCGTGCCGGCCCCGGGGG + Intronic
1034488640 7:151381458-151381480 GAGGAGCGAGGAAGCCCGGGCGG - Exonic
1034492540 7:151401538-151401560 GAGGACAGAGGCAGCCGCAGAGG + Intronic
1034956428 7:155338235-155338257 GAGGCCAGAGGCAGGCACAGAGG + Intergenic
1034956449 7:155338334-155338356 GAGGCCAGAGGCAGGCGCAGAGG + Intergenic
1034956487 7:155338499-155338521 GAGGCCAGAGGCAGGCACAGAGG + Intergenic
1034956501 7:155338565-155338587 GAGGCCAGAGGCAGGCACAGAGG + Intergenic
1035315815 7:157997199-157997221 GAGCCGCCAGGCAGCCCCGCAGG - Intronic
1035625598 8:1068504-1068526 GAGGTCTGAGGCTTCCCCGGTGG + Intergenic
1035872749 8:3153673-3153695 GAGGACTGAGGCAGCCCTGCAGG + Intronic
1036190170 8:6662951-6662973 GAGGCCCGTGCCAGTCCCGAAGG + Intergenic
1037762393 8:21750563-21750585 GAGTGCCGCGGCAGCCCCGGTGG - Intronic
1037818596 8:22124885-22124907 GGGGCAAGAGGGAGCCCCGGGGG + Intronic
1038409235 8:27345274-27345296 GAGGCCCGAGGAAGCTGGGGTGG - Intronic
1040301449 8:46190059-46190081 CAGGCCCGAGGCAGTCCTAGGGG - Intergenic
1041226587 8:55706584-55706606 GACGGCCGAGGCAGCCCCTTAGG + Intronic
1042591579 8:70402989-70403011 CGGGCCCGTGTCAGCCCCGGGGG - Intronic
1049095640 8:140546665-140546687 GAGGCCATAGGCAGCCCCTGTGG - Intronic
1049406209 8:142452820-142452842 GAGCCCCGCGGCGTCCCCGGAGG - Intronic
1049555472 8:143279296-143279318 GGGCTCCGAGCCAGCCCCGGGGG - Intergenic
1049687124 8:143943482-143943504 GAGGCCTGTGGCAGCCGCCGTGG - Intronic
1052963206 9:34318511-34318533 GAGCCCCAAGGCAGCCACGCTGG + Intronic
1053066283 9:35071887-35071909 GAGGCCCCAGCCGGGCCCGGTGG - Intronic
1053222818 9:36326006-36326028 GAGGCCCTCGACAGCCCCTGAGG + Intergenic
1056045502 9:82711428-82711450 GAGGCCCCAGTCAGCCCCTGTGG - Intergenic
1056539198 9:87556880-87556902 CACGCCCAAGGCAGCCCAGGAGG - Intronic
1057619023 9:96619128-96619150 GAGGCCCCGGGCAGCCCGGTGGG + Intronic
1060794592 9:126505212-126505234 GAGGCCTGTGGCAGCGCCGCTGG + Exonic
1060881923 9:127123288-127123310 GAGGGTGGAGGCAGCCCTGGAGG + Intronic
1061043225 9:128151405-128151427 GGGGCCCCAGGCAGGCCAGGAGG + Intronic
1061226548 9:129283973-129283995 AAGGGCCGAGGCAGCTCCGGGGG - Intergenic
1061422623 9:130480468-130480490 GGGTCCCGAGGCAGGCCCTGAGG - Intronic
1061836746 9:133334431-133334453 GAGGCCTGAGGCAGCCAAAGAGG - Exonic
1061969316 9:134035418-134035440 CAGACCCGAGGCAGCCCTTGTGG - Intronic
1062044781 9:134419979-134420001 GAGGTCCCAGCCAGCCCAGGAGG + Intronic
1062252193 9:135603949-135603971 GAGCCCACAGGCAGCCCCCGAGG + Intergenic
1062379572 9:136280773-136280795 GAGGCCTGAGGAAGGCCTGGGGG - Intergenic
1062457410 9:136646168-136646190 CAGTCCAGAGGCGGCCCCGGGGG - Intergenic
1062536672 9:137024107-137024129 GAGGCCCCAGGCACAGCCGGGGG - Intronic
1062586820 9:137253298-137253320 GAGGCCTGGGAAAGCCCCGGGGG - Exonic
1062632941 9:137474511-137474533 GGAGCGCGAGGCAGCCCTGGAGG + Intronic
1062634053 9:137480716-137480738 GAGACCCGGGGCTGCCCAGGCGG + Intronic
1203759614 EBV:5320-5342 AAGGCAGGACGCAGCCCCGGAGG - Intergenic
1203470011 Un_GL000220v1:112193-112215 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1203477832 Un_GL000220v1:156165-156187 GAGCCCGGAGGCACCCCCGGGGG - Intergenic
1203360498 Un_KI270442v1:216912-216934 GAGGCGCGAGGGAGCCACCGAGG + Intergenic
1187373295 X:18728080-18728102 GAGGTCAGAGGCTGCCCCTGAGG + Intronic
1187826084 X:23334482-23334504 GGGGCCCGGGGCAGCCCCCGCGG - Exonic
1187859562 X:23667901-23667923 GGGCCCGGAGGCAGCCCAGGGGG - Intronic
1192561539 X:72131137-72131159 GCGGGCGGAGGCAGCGCCGGCGG + Exonic
1197769748 X:130082493-130082515 GGGGCCTGAGCCAGCCCCAGAGG - Intronic
1197804388 X:130385166-130385188 GAGGACAGAGGCAGCTGCGGAGG + Exonic
1198313744 X:135445921-135445943 GAGGCCTGGGGCAGCCCTGAAGG - Intergenic
1198844344 X:140894178-140894200 GAGGACTGAGCCAGCCACGGTGG - Intergenic
1200119048 X:153781861-153781883 CAGGCCCCAGGCAGCTCCAGGGG - Intronic
1201077938 Y:10200628-10200650 GAGGCAGGAGGGAGCCCCCGAGG - Intergenic
1201151737 Y:11098619-11098641 GCGGCCCGAGGCACACCCTGTGG + Intergenic
1201372716 Y:13282815-13282837 GACGGCCGAGGCAGCCCCTTAGG + Intronic