ID: 1161940964

View in Genome Browser
Species Human (GRCh38)
Location 19:7403766-7403788
Sequence GGCTCAAGAGATCCTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 2, 1: 5, 2: 39, 3: 123, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161940960_1161940964 0 Left 1161940960 19:7403743-7403765 CCCAGGCTGGTCTTGAACTCCTT 0: 251
1: 19899
2: 39563
3: 59101
4: 51484
Right 1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG 0: 2
1: 5
2: 39
3: 123
4: 328
1161940961_1161940964 -1 Left 1161940961 19:7403744-7403766 CCAGGCTGGTCTTGAACTCCTTG 0: 276
1: 20044
2: 92361
3: 163139
4: 184231
Right 1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG 0: 2
1: 5
2: 39
3: 123
4: 328
1161940959_1161940964 8 Left 1161940959 19:7403735-7403757 CCGTGTTGCCCAGGCTGGTCTTG 0: 7244
1: 56014
2: 129015
3: 176709
4: 169220
Right 1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG 0: 2
1: 5
2: 39
3: 123
4: 328
1161940957_1161940964 13 Left 1161940957 19:7403730-7403752 CCTCGCCGTGTTGCCCAGGCTGG 0: 2
1: 73
2: 867
3: 3829
4: 6178
Right 1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG 0: 2
1: 5
2: 39
3: 123
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161940964 Original CRISPR GGCTCAAGAGATCCTCCTGC TGG Intronic
901729807 1:11271237-11271259 AGCTCAAGAGATCCTCCCGCCGG + Intergenic
902510096 1:16961841-16961863 GACTCAAGCGATCCTCCCACTGG + Intronic
902934541 1:19755355-19755377 ACCTCAAGTGATCCGCCTGCAGG + Intronic
903078344 1:20788880-20788902 GGCTAAAGAGATCCTCCTTTTGG - Intergenic
903216010 1:21843610-21843632 GGCTCTTGACTTCCTCCTGCCGG - Intronic
903294995 1:22338049-22338071 GCCTCAAGTGATCCTCCTCCTGG - Intergenic
903698017 1:25223779-25223801 GGCTCAAGTGATCCTCCCAGAGG - Intronic
903904294 1:26672854-26672876 GGCTCAAGCAATCCTCCCACTGG + Intergenic
904194535 1:28775294-28775316 GGCTCTGGAGCTCCGCCTGCGGG + Intergenic
904577140 1:31512193-31512215 GGCTCACGTGATCCTCCTGTTGG - Intergenic
904686020 1:32261342-32261364 AGTTCAAGAGATTCTCCTGCTGG + Intronic
904735300 1:32627801-32627823 GGCTCAAGCGATCCTCCCTTTGG - Intronic
904977861 1:34472410-34472432 GGCTCAAGTCAACCTCCTCCTGG - Intergenic
905059671 1:35129082-35129104 GTTTCAAGAGATTCTCCTGCTGG + Intergenic
906397242 1:45476911-45476933 GGCTCAAGGGATCCTCCCCTTGG - Intronic
906480035 1:46193775-46193797 ACCTCAAGAGTTCCTCCTGGAGG + Intronic
907053220 1:51343849-51343871 GGCTCAAGCGATCCTCCCGCTGG + Intronic
908779469 1:67676464-67676486 GGCTCAAGTGATCCTCCCCTAGG - Intergenic
910406445 1:86896150-86896172 GGTTCAAGCAATTCTCCTGCAGG - Intronic
910609174 1:89121942-89121964 GGCTCCAGAGATCAACTTGCCGG - Exonic
912243834 1:107940109-107940131 GCATCAAGAGCTCCTCCAGCTGG - Intronic
912345360 1:108958645-108958667 GGCTCAAGTGATCCGCCTGCTGG - Intronic
912621460 1:111163504-111163526 GGCGCAAGTGATCCTCCTACAGG - Intronic
912998038 1:114551530-114551552 GGCTCAAGCAATCCTCCTGCTGG - Intergenic
915536498 1:156539315-156539337 GGGTTAAGAGATCCCCCTGTTGG - Intronic
915610208 1:156985982-156986004 GGCTCAAGCGATCCTCCCATTGG + Intronic
916077093 1:161207628-161207650 GGTTCAAGTGATTCTCCTACAGG - Intronic
916397770 1:164410693-164410715 GGTTCCAGTGATTCTCCTGCCGG - Intergenic
917203568 1:172544322-172544344 AGCTCAATAGATCATCATGCTGG + Intronic
917977769 1:180251185-180251207 GGCGCATCAGAGCCTCCTGCCGG + Intronic
918191406 1:182178449-182178471 GGCTCAAGCGATCCTCCCACTGG + Intergenic
920286138 1:204881223-204881245 GGCTCAACAGATGCATCTGCTGG - Intronic
921066094 1:211622865-211622887 ACCTCAAGAAATCTTCCTGCAGG - Intergenic
921431973 1:215076499-215076521 GCCTCAGGAGCTCCACCTGCAGG + Intronic
921710790 1:218371065-218371087 GGCTCAAGTGATCCTCCCACCGG - Intronic
922755260 1:228093072-228093094 GGCTCCTGGCATCCTCCTGCTGG + Intronic
924484010 1:244462046-244462068 GCCTTAAGTGATCCTCCTGCCGG + Intronic
1063376398 10:5557184-5557206 GGATCAGGAGATCTTCCTCCAGG + Intergenic
1064379109 10:14824507-14824529 GGTTCAAGCGATTCTCCTGCCGG - Intronic
1064851000 10:19708575-19708597 GGCTCAAGTGATTCTCCTGCCGG + Intronic
1065121330 10:22533075-22533097 GCCTCAAGTGATCCCCCTGCAGG + Intergenic
1065805238 10:29388041-29388063 GGCTTAAGAGCTGCTCCTTCTGG - Intergenic
1065812923 10:29459057-29459079 GCCTCAAGCGATCCTCCTGCTGG + Intronic
1065943847 10:30589177-30589199 GGCTTAAGAGCTGCTCCTTCTGG + Intergenic
1066633050 10:37475490-37475512 GGCTCAAGTGACTCTCCCGCAGG - Intergenic
1067317614 10:45182889-45182911 GGCTCAAGTAATTCTCCTGCAGG - Intergenic
1067773954 10:49148151-49148173 GGTTCAAGCGATTCTCGTGCAGG - Intergenic
1069833577 10:71295216-71295238 GGACCAAGAGATCCAGCTGCAGG - Intronic
1070017005 10:72543440-72543462 GGCTCACGTGATCCTCTTTCTGG - Intronic
1070182901 10:74031685-74031707 GGCTCAAGTAATCTGCCTGCGGG - Intronic
1070183754 10:74039678-74039700 GGCTCAAGTGATCCTCCGTCCGG - Intronic
1070610811 10:77931186-77931208 GCCTCAAGAGATCCACCTCTTGG + Intergenic
1071185130 10:83034566-83034588 GGAGCAAGAGACTCTCCTGCTGG - Intergenic
1072037544 10:91577347-91577369 GGTTCAAAAGATTCTCCTGGTGG - Intergenic
1072509313 10:96102727-96102749 GCCTCAAGTGATCCTCCTGCAGG - Intergenic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1073316461 10:102584411-102584433 GGCTCAAGAGATCCTCTCACTGG + Intronic
1074529333 10:114286348-114286370 GGCGCGAGAGCTGCTCCTGCTGG + Exonic
1074912916 10:117927848-117927870 GTCTCAAGATCTCCTCCTGGAGG + Intergenic
1075139788 10:119821963-119821985 GGTTCAAGTGATTCTCCTCCTGG + Intronic
1077169618 11:1160388-1160410 GGCTGAGGAGATGCTCCTGGAGG + Intronic
1077657834 11:4039193-4039215 GGCTCAAGTGATCCTCTCACAGG - Intronic
1079055568 11:17203770-17203792 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1080018385 11:27532023-27532045 GGCTCAAGTGATTCTCCAGTGGG - Intergenic
1080307305 11:30850679-30850701 AGCTCAAGACATCCTCGTCCAGG + Intronic
1080781316 11:35432477-35432499 GGCTCAGGAGATGCTCGTCCCGG + Exonic
1081196202 11:40164012-40164034 GTAGCAAGAGATTCTCCTGCTGG + Intronic
1081227402 11:40541276-40541298 GGCTCAAGTGATCCTCTTGCAGG + Intronic
1082063746 11:47882146-47882168 GGCTCAAGGGATCCTCCTGCAGG - Intergenic
1082779279 11:57273870-57273892 GGCTCATGATATTCTCTTGCTGG - Intergenic
1082792874 11:57359344-57359366 GGCTGCAGAGGTCCACCTGCAGG + Intronic
1086343576 11:85872182-85872204 TCCTCAAGAGATCCACCTGCTGG + Intronic
1088024109 11:105156945-105156967 GCCTCAAGAGATCCTCCCACTGG + Intergenic
1088244041 11:107799685-107799707 GGTTCAAGTAATTCTCCTGCTGG + Intronic
1089667635 11:120030515-120030537 GGCTCAAGAGACCCTGCAGAAGG + Intergenic
1090089100 11:123678667-123678689 GGCTCAAGCAATCTTCCTGCTGG + Intergenic
1090093204 11:123717831-123717853 GGTTCAAGCGATTCTCCGGCAGG + Intergenic
1091165453 11:133471897-133471919 GTTTCCAGAAATCCTCCTGCTGG - Intronic
1093621978 12:21302629-21302651 GGTTCAAGTGATCCACCTCCCGG + Intronic
1095456974 12:42397836-42397858 GGTTCAAGTGATTCTCTTGCTGG + Intronic
1095974551 12:47930241-47930263 GGCTAAAGAGCTCCTGCTCCAGG + Intronic
1096198412 12:49663880-49663902 GGCTCAAGTGATCCTCCTTGAGG - Intronic
1096265772 12:50121371-50121393 GGCTCAAGCGATCCTCCAGCCGG - Intergenic
1097268061 12:57756922-57756944 GGCTTAAGAGCTCCCCCTGGAGG - Exonic
1097275704 12:57812085-57812107 GGCTCAAGTGATCCTCATCAGGG + Intronic
1097884235 12:64712754-64712776 AGCTCGAGTGATCCTCCTGCTGG + Intergenic
1098318704 12:69218580-69218602 GCCTCAAGTGATACTCTTGCTGG - Intergenic
1098485051 12:71011011-71011033 GACTCAAGCAATCCTCCTGCCGG + Intergenic
1098703280 12:73655862-73655884 GGCTCAAGTGATCCTCCACCTGG - Intergenic
1098948987 12:76619462-76619484 TGCTCAAGAGACCCTCCAGGTGG - Intergenic
1101866018 12:108520035-108520057 GGCTCAAAAAGTCTTCCTGCAGG - Exonic
1102265861 12:111484347-111484369 GGTTCAAGTCATCCTCCAGCTGG + Intronic
1102507300 12:113391823-113391845 GGCTCAAGCGATCCTCCCACAGG + Intergenic
1102876847 12:116455605-116455627 GGAGCTGGAGATCCTCCTGCAGG + Intergenic
1102979721 12:117231854-117231876 GGCTCAAGACTTCCATCTGCTGG + Intronic
1103085267 12:118057999-118058021 AGCTCAAGCGATTCTCCTGCAGG + Intronic
1103516295 12:121510370-121510392 GGTTCAAGTGATCCTCCTGCTGG + Intronic
1103985296 12:124763101-124763123 GGCTAAACAGATCCTACTGAAGG - Intergenic
1104004593 12:124883064-124883086 GGCTCAAGAGATCCTTCCACCGG - Intergenic
1105277723 13:18945150-18945172 GGCTCAAATGATCCTCCCACGGG - Intergenic
1106207360 13:27612516-27612538 GGCTCAAGTGATCTTTCTGTTGG - Intronic
1106722642 13:32451780-32451802 GGCTCAAGCAATCCTCCTGCTGG + Intronic
1106992232 13:35435123-35435145 GGTTCAAGCGATTCTTCTGCTGG + Intronic
1107065961 13:36214563-36214585 GGCTGTGGAGCTCCTCCTGCTGG - Exonic
1107339818 13:39394169-39394191 GCCTCAAGCAATCCTCCTGCCGG + Intronic
1108309045 13:49167471-49167493 GGCTCAAGAAATCCTCGTCTTGG - Intronic
1108993122 13:56689469-56689491 GGATCCAGCAATCCTCCTGCTGG + Intergenic
1109658978 13:65434011-65434033 GGTTCAAGTGATTCTCCTGCTGG + Intergenic
1110091348 13:71452224-71452246 GGCTCCAGTGATCTTCCTGTAGG + Intronic
1110503891 13:76261773-76261795 GGAGCAAGAGATTCTCCTGCTGG - Intergenic
1110584680 13:77175050-77175072 GGCTCAAGCAATCCTCCCACCGG + Intronic
1111051810 13:82892601-82892623 GGTTGAAGTGATTCTCCTGCTGG - Intergenic
1114202908 14:20539636-20539658 GGCTCAAGATATCCTCTGACAGG + Intergenic
1114509488 14:23246229-23246251 GGTTCAAGCGATTCTCCTGGGGG + Intronic
1115262522 14:31468666-31468688 GGCTCAAAAGATCCACCCACCGG - Intergenic
1115739565 14:36373748-36373770 GACTCTAGAGATCCTTCTGGTGG + Intergenic
1115813382 14:37134859-37134881 GACTCAAGTGATCCTTTTGCTGG - Intronic
1115988152 14:39123988-39124010 GGCTCAGGCAATCCTCCTGCTGG + Intronic
1116328774 14:43569177-43569199 AGATCAAGTGATCCTCCTGCCGG + Intergenic
1116637672 14:47417943-47417965 GGCTCATGTAGTCCTCCTGCTGG + Intronic
1116846230 14:49867404-49867426 CCCTCAAGTGATCCGCCTGCCGG - Intergenic
1118204301 14:63707630-63707652 GGTTCAAGCAATTCTCCTGCTGG + Intronic
1119840610 14:77790138-77790160 GGCTCAAGCAATTCTCCTGCTGG + Intergenic
1120851781 14:89178240-89178262 AGCTCAAGTGATCCACCCGCCGG + Intronic
1121783766 14:96639522-96639544 GGTTCAAGTGATTCTCCTGGGGG + Intergenic
1121854948 14:97259618-97259640 GGTTCAAGCGATTCTCCTACTGG + Intergenic
1122078421 14:99250329-99250351 GGTTCAAGAGATTCTCCTGCTGG - Intronic
1122218463 14:100219970-100219992 GGTTCAAGCAATTCTCCTGCTGG + Intergenic
1122417582 14:101557804-101557826 GCCTCAGGAGGTCCTCCTGCAGG + Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1125193072 15:37015808-37015830 GGCTCTAGATATCCTCGTGGTGG + Intronic
1125573919 15:40742114-40742136 GGCTGAAACAATCCTCCTGCTGG + Intronic
1125660572 15:41391508-41391530 GGTTCAAGAGATCCTCCTGCTGG - Intronic
1126013090 15:44321818-44321840 GACTCAAGTGATTCTCCTGCTGG - Intronic
1126549620 15:49912866-49912888 GGCTCAAATGATCCTCCTGTGGG + Intronic
1128019757 15:64380469-64380491 GGCTCAAACAATCCTCCTACTGG - Intronic
1128042535 15:64588036-64588058 GGCTTAAGAGATCCTCCTACTGG - Intronic
1128172207 15:65522955-65522977 GGCTCAAGTAATCCTCTGGCCGG + Intergenic
1129050070 15:72773963-72773985 GGCTCAGGTGATCCTCCCACAGG + Intronic
1129757714 15:78108604-78108626 GGCTCCAGAGGCCCCCCTGCAGG + Intronic
1130562048 15:84966462-84966484 GGCTCAAGCAGTCCTCCTGGGGG + Intergenic
1134073699 16:11276122-11276144 GGCGCAAAAGACGCTCCTGCAGG - Exonic
1134140069 16:11710715-11710737 GGCTCAGGTGATCTTCCTGCAGG - Intronic
1134266964 16:12700994-12701016 GCCTCAAGTGACCCTCCCGCCGG - Intronic
1134489708 16:14687540-14687562 GCCTCAAGCGATCCTCCTTCTGG + Intronic
1134532656 16:14996621-14996643 AGCTCAAGTTATCCTTCTGCTGG - Intronic
1134540331 16:15058864-15058886 GCTTCAAGAGATCCTTTTGCTGG + Intronic
1135590130 16:23699137-23699159 GGCTCAGGAAATCCTGCTGCAGG + Intronic
1136150138 16:28342147-28342169 GACTCAAGCGATCCTCCTACTGG - Intergenic
1136166374 16:28455962-28455984 GACTCAAGCGATCCTCCTACTGG - Intergenic
1136196599 16:28659070-28659092 GACTCAAGCGATCCTCCTACTGG + Intergenic
1136212939 16:28773195-28773217 GACTCAAGCGATCCTCCTACTGG + Intergenic
1136257666 16:29053110-29053132 GACTCAAGCGATCCTCCTACTGG + Intergenic
1136528050 16:30845808-30845830 GGCTCAAGAGATCCTTCAGCTGG + Intronic
1139855432 16:69975948-69975970 GACTCAAGCGATCCTCCTACTGG - Intergenic
1139863378 16:70044113-70044135 AGCTCAAGTTATCCTTCTGCTGG + Intergenic
1139885148 16:70203065-70203087 GACTCAAGCGATCCTCCTACTGG - Intergenic
1140367367 16:74392450-74392472 GACTCAAGCGATCCTCCTACTGG + Intergenic
1140571522 16:76111957-76111979 GGCTCAAGTGTTTCTCCTGTTGG + Intergenic
1142122945 16:88396322-88396344 AACTCAAGAGACCCTCCTGCAGG + Intergenic
1142219245 16:88845252-88845274 GGTTCAAGCGATTCTCCTGCCGG - Intronic
1142282100 16:89154023-89154045 GGCGCCTGAGTTCCTCCTGCTGG + Intronic
1142790356 17:2259444-2259466 GGCCCAAGTGATCCTCTTACAGG - Intronic
1143533819 17:7523647-7523669 GGTTCAAGCAATTCTCCTGCTGG - Intergenic
1144126575 17:12208170-12208192 GGCTCAAGCAGTCCTCTTGCTGG + Intergenic
1144958517 17:19031905-19031927 GGGTCAAGGGCTCCACCTGCTGG + Intronic
1146509353 17:33432430-33432452 GGCTCAAGCGATCCTCCCAAAGG - Intronic
1146719169 17:35111255-35111277 GGTTCAAGCGATTCTCCTACAGG - Intronic
1147016723 17:37497820-37497842 GGCTCAAGTGATACTCTGGCTGG - Intronic
1147037142 17:37690246-37690268 GGCTGAAGAGATCCCACTCCAGG - Intronic
1147289181 17:39427983-39428005 GACTCAAGTGATCCTCTTGCCGG - Intronic
1147479556 17:40746272-40746294 GGCTCAAGCAATCCCACTGCAGG + Intergenic
1147624194 17:41888712-41888734 GGTTCAATTGATCCTCCTACCGG - Intronic
1147893382 17:43733420-43733442 GGCTCAATTGAGCCTCCTGGTGG + Intergenic
1147960261 17:44163084-44163106 GGTTCAAGAGATTTTCCTGCCGG + Intergenic
1147981692 17:44278703-44278725 GGCTCAAGCAATCCACCCGCCGG - Intergenic
1149436210 17:56635509-56635531 GGCTCAAGAGATCCTTCTACTGG - Intergenic
1150246890 17:63682733-63682755 GGAGCAAAAGATTCTCCTGCTGG - Intronic
1150907181 17:69350230-69350252 GGTTCAAGTGATTCTCCTGCCGG - Intergenic
1151348144 17:73515885-73515907 AGCTCATTTGATCCTCCTGCAGG - Intronic
1151795907 17:76345509-76345531 GGCTCAGGTGATCCTCCCACTGG - Intronic
1151837329 17:76591006-76591028 GGCTATAGAGTTCCTCATGCTGG + Intergenic
1152071401 17:78135513-78135535 GGCTCAAGCGATCCTCCCGCCGG + Intronic
1152595801 17:81237015-81237037 GGCTCAGGAGGTACTCCAGCAGG + Exonic
1203166536 17_GL000205v2_random:102288-102310 GGCGCAAGAGAATCACCTGCGGG - Intergenic
1153027428 18:684294-684316 GGCTCAAGAAATCCACAGGCTGG - Intronic
1153070900 18:1103117-1103139 GCCTCAAGATACCCTCCTCCTGG - Intergenic
1153491573 18:5655009-5655031 GGCTTAAGGCATCCTCCTCCTGG + Intergenic
1154116856 18:11618917-11618939 GACTCAAGCGATCCTCCTACTGG - Intergenic
1154959534 18:21294366-21294388 AGCTCAAGAGATGCTTCTGGTGG + Intronic
1155195344 18:23469096-23469118 GACTGGAGAGATTCTCCTGCTGG - Intronic
1155521286 18:26671546-26671568 GACTCAAGCAATCCTCCTGTTGG - Intergenic
1157957908 18:52119542-52119564 GACTCAAGCAATCCTCCTGCAGG + Intergenic
1159987464 18:74860198-74860220 GGCTCAAGGGATCCTCCTTCTGG - Intronic
1159988432 18:74873610-74873632 GGTGCAAGCGGTCCTCCTGCTGG - Intronic
1161057148 19:2196294-2196316 GGCTCAAGTGATCCTCCAAAAGG - Intronic
1161687500 19:5710490-5710512 GGCTCAAGCGATCCTCCCACAGG + Intronic
1161803415 19:6428300-6428322 GGTTCAAGCGATTCTCCTGCTGG - Intronic
1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1162399257 19:10434985-10435007 GGCTCAAGCGATGCTCCAACAGG + Intronic
1162516094 19:11148742-11148764 GGCTCACGCCATTCTCCTGCTGG + Intronic
1162902734 19:13805102-13805124 GGCTGATGAGATCCTCCTGCTGG + Exonic
1163316380 19:16542962-16542984 GGTTCAAAACATCCTCCTCCTGG + Intronic
1163423832 19:17229966-17229988 GGCTCAAGATCTCTTCCCGCAGG + Intergenic
1163588841 19:18179178-18179200 GGCTCAAGCGATCCTTCTTGAGG + Intergenic
1163616077 19:18329262-18329284 GGCTCAGGTGATCCACCGGCCGG - Intergenic
1163819526 19:19487996-19488018 GGTACAAGAAATCCTCCTCCAGG - Intronic
1163842012 19:19617245-19617267 GACTCAAGTGATCCTCCCACTGG + Intronic
1163952453 19:20602508-20602530 GGTTCAAGCGATTCTCCTGCTGG + Intronic
1164684576 19:30158395-30158417 GGTTCAAGCGATTCTCCCGCCGG + Intergenic
1165617649 19:37216389-37216411 GGTTCAAGTGATTCTCCTGCAGG + Intronic
1165662753 19:37596397-37596419 GGTTCAAGGGATCCTCCAGCTGG + Intronic
1166322287 19:42025877-42025899 GGCTCAAGCAATCCTCCTGACGG - Intronic
1166503009 19:43354715-43354737 GGTTCAAGAAGTTCTCCTGCAGG + Intronic
1166507443 19:43380017-43380039 GGTTCAAGAAGTTCTCCTGCAGG - Intergenic
1166560176 19:43727607-43727629 GGCTCGCGAGATCCTGCAGCAGG + Intergenic
1166839109 19:45685558-45685580 GGCTCAATTGATCCTCCTGCCGG - Intergenic
1167054516 19:47101106-47101128 GGCTCAAGTGATCCGCCTGTTGG - Intronic
1167106139 19:47430821-47430843 GGTTCAAGCGATTCTCTTGCCGG + Intronic
1167430848 19:49453570-49453592 GGCTCAAGGGAGCGTCCTACAGG - Intronic
1168282108 19:55311462-55311484 GGCTCAAGGGAGCCTACTGGTGG - Intronic
1168626252 19:57920602-57920624 GGTTCAAGCGATTCTCCTACCGG + Intergenic
927706796 2:25301427-25301449 GGTCCCTGAGATCCTCCTGCAGG - Intronic
928483925 2:31710763-31710785 CCCTCTAGAGATCCCCCTGCAGG + Intergenic
930308747 2:49711187-49711209 GACACAAGCTATCCTCCTGCTGG + Intergenic
931509543 2:62975650-62975672 GGCTCAAGTCATCCTCCCACTGG - Intronic
931616273 2:64161852-64161874 GGTTCAAGTGATTCTCCTGCTGG + Intergenic
931656545 2:64514030-64514052 AGCTCAAGAGTTACTCCTCCTGG - Intergenic
931690297 2:64830051-64830073 CGCTCAAGTGATCCTCCTGCAGG - Intergenic
933864404 2:86502668-86502690 GGCTCAAGTGATCCTTCCCCTGG - Intergenic
935271639 2:101439807-101439829 GGTTCAAGCGATTCTCCTGTCGG + Intronic
937226971 2:120375667-120375689 GGCACAGGAGGTCTTCCTGCAGG + Intergenic
938031830 2:128001288-128001310 GGCTTAAGCGGTCCTCCTGCTGG - Intronic
939212020 2:139187785-139187807 GGATCCAGAAATCCTCCTTCTGG - Intergenic
939930993 2:148232568-148232590 GGCTCAAGTGATCCTCCTGGTGG + Intronic
940233012 2:151478252-151478274 GGCCAAAGTGATCCACCTGCCGG - Exonic
940575864 2:155503302-155503324 TGGGCAAGAGATCCTCCAGCAGG + Intergenic
941937804 2:170999990-171000012 GGCTCAAGTGGTCTTCCTGCTGG + Intronic
942178682 2:173358294-173358316 GGCTCAAGTGATCCTCCCACCGG - Intronic
942386298 2:175446970-175446992 GCCTCAAGGGATCTTCCTGTTGG + Intergenic
942552853 2:177137799-177137821 GGCTCCAGAGAGCCAGCTGCGGG - Intergenic
942993866 2:182237379-182237401 AGTTCAAGAGATTCTCCTGCTGG - Intronic
944275858 2:197836815-197836837 AGCTTAAGGGATCCTCCTACAGG + Intronic
944322666 2:198366354-198366376 TGTTCAAGTGACCCTCCTGCTGG + Intronic
944714297 2:202363178-202363200 GGCTCAAGAGATCTACCGCCTGG + Intergenic
945237086 2:207641033-207641055 GCCTCAAGCAATCCTCCTGCTGG + Intergenic
945959733 2:216120650-216120672 GGTTCAAGTGAACCTCCTACCGG + Intronic
945977728 2:216283714-216283736 GGCTCAGCAGCTCCCCCTGCAGG + Exonic
947425952 2:229983077-229983099 GGCTCAAACAATCCTCCTGCCGG + Intronic
947621005 2:231591077-231591099 AGCTCAAGAAATCCTCCTCCTGG + Intergenic
948093828 2:235317500-235317522 GGTTCAAGTGACTCTCCTGCTGG - Intergenic
948134998 2:235629766-235629788 GGCTCAAGGGATCCTCCAGAGGG - Intronic
948725945 2:239934086-239934108 GCCCCAGGCGATCCTCCTGCTGG + Intronic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1170362791 20:15565803-15565825 GCCTCAAGTGACCCTCCTACAGG + Intronic
1170958107 20:21000359-21000381 GGCTCAGGTTATCCTCATGCAGG - Intergenic
1171388178 20:24784270-24784292 GGCTCAGGACCTCCTCCTGGTGG - Intergenic
1171493284 20:25537312-25537334 GGCTCAAGTGATCCTTCTACCGG + Intronic
1172149207 20:32778836-32778858 GGCTTCAGTGATCCTCCAGCTGG - Intronic
1172369930 20:34381377-34381399 GGATCAAGTGATTCTCCTGCTGG + Intronic
1172643064 20:36453222-36453244 GCCTCAAGAGATCCTCCCTACGG - Intronic
1173701680 20:45077498-45077520 GGTTCAAGCGATTCTTCTGCTGG + Exonic
1174025452 20:47570207-47570229 GGCTCAAGCAATCCGCCTGCTGG - Intronic
1174432637 20:50481626-50481648 GGCTCAAGGGAACTTCCTGATGG + Intergenic
1174810621 20:53642370-53642392 GGTTCAAGCGATTCTCCTACTGG + Intergenic
1175109033 20:56633099-56633121 GGCTCAAGTAATTCTCCAGCAGG - Intronic
1175568322 20:59998530-59998552 GGGACAAGAGAACCTCATGCTGG + Intronic
1175943794 20:62549711-62549733 GGCTCAGGAGCTCCCCCTTCCGG - Intergenic
1176142143 20:63549439-63549461 GGCTCAAGCCGTCCTCCTGCCGG + Intronic
1176335002 21:5588257-5588279 GGCGCAAGAGAGTCACCTGCGGG + Intergenic
1176392755 21:6232691-6232713 GGCGCAAGAGAGTCACCTGCGGG - Intergenic
1176405219 21:6356808-6356830 GGCGCAAGAGAATCACCTGCGGG + Intergenic
1176431938 21:6632295-6632317 GGCGCAAGAGAATCACCTGCGGG - Intergenic
1176468664 21:7083483-7083505 GGCGCAAGAGAGTCACCTGCGGG + Intronic
1176492225 21:7465261-7465283 GGCGCAAGAGAGTCACCTGCGGG + Intergenic
1176508417 21:7673122-7673144 GGCGCAAGAGAGTCACCTGCGGG - Intergenic
1176937845 21:14887317-14887339 GGTTCAAGTGATTCTCCTGCTGG + Intergenic
1177220013 21:18180374-18180396 GGCTCAAGCAATCCTCCTGCTGG + Intronic
1177828593 21:26111503-26111525 GGCTCAAGCGATCCTCTGGCTGG - Intronic
1178474979 21:32930302-32930324 GGTTCAAGCAATCCTCCTGCTGG + Intergenic
1178546878 21:33499996-33500018 GGCTCAAGCAGTCCTCCTGCAGG + Intergenic
1179806114 21:43838374-43838396 GGTTCAAGTGATTCTCCTGCTGG - Intergenic
1179979452 21:44888642-44888664 GGCTCCAGAGCTCCGGCTGCGGG - Intronic
1180037627 21:45257840-45257862 TGCCCATGAGATCCTCATGCTGG + Intergenic
1180123521 21:45769973-45769995 GGCTAAACAAAACCTCCTGCAGG - Intronic
1180689684 22:17702538-17702560 GGCTCAAGTGATCCTGCCTCAGG + Intronic
1182832245 22:33313581-33313603 GGCCAGAGAGATTCTCCTGCTGG + Intronic
1183235214 22:36611655-36611677 GGCTCAAGAGATCCCAGTGGAGG - Intronic
1183452331 22:37903881-37903903 GGTTCAAGCCATTCTCCTGCTGG + Intergenic
1183477758 22:38045313-38045335 GGCTCAAGCAATCTTCCTGTGGG - Intergenic
1184029509 22:41883678-41883700 GCCTCAGGTGTTCCTCCTGCAGG - Intronic
1184126614 22:42491815-42491837 GCCTCAAGAAATCCTCCCACCGG - Intergenic
1184168473 22:42744411-42744433 AGCTCAAGTGATCCTCCCACTGG - Intergenic
1185068349 22:48643089-48643111 GGCTCCAGGCATCCACCTGCTGG + Intronic
1185368773 22:50449073-50449095 GGTTCAAGCGATTCTCCTACAGG - Intronic
950028554 3:9836870-9836892 GGTTCAAGCGATTCTCCTGCTGG - Intronic
950780795 3:15389947-15389969 GGCTCAAGGGATCCTCCCAAGGG + Intronic
950894610 3:16437425-16437447 GGCTCAAGCGATTCTCCTTGAGG - Intronic
951654637 3:24991894-24991916 GGGTGAAGAGGTCCTCATGCTGG - Intergenic
951981556 3:28572794-28572816 GGTGCAAGCGATTCTCCTGCCGG + Intergenic
952300010 3:32096672-32096694 TACTCAAGAGATCCTCCTACTGG + Intergenic
953163450 3:40443263-40443285 GGTTCAAGCGATTCTCCTGCTGG - Intergenic
953860132 3:46537222-46537244 GGCTCAAGCGATCCTCCCACAGG + Intronic
953928516 3:46994487-46994509 GGCTCTGCAGAACCTCCTGCAGG - Exonic
954067135 3:48115853-48115875 GCCTCAAGTGATCCACCTGTGGG + Intergenic
954303045 3:49711210-49711232 GGCTCATGTGATCCTCCTACAGG - Intronic
955225887 3:57060202-57060224 GGCTCAAGAGATCCTCCCACAGG - Intronic
955379555 3:58426642-58426664 GGCTCAAGCAATCCTCCTATAGG + Intergenic
956081333 3:65559801-65559823 AGCTCAAGGGATCCTCCTGCTGG - Intronic
956133360 3:66075045-66075067 GGTTCAAGTGATTCTCCCGCCGG - Intergenic
956522420 3:70120560-70120582 AGTGCAAGAGCTCCTCCTGCTGG - Intergenic
956855951 3:73274905-73274927 AGCTCAAGTGACCCTCCTTCAGG + Intergenic
957255358 3:77828814-77828836 AGCCCTAGAGATCATCCTGCTGG - Intergenic
957431885 3:80121101-80121123 GGCTCAAATGATCCTCCCGCTGG - Intergenic
959358366 3:105360124-105360146 GGCTCAAGAGAGCCTCCCAAAGG + Intergenic
959445148 3:106430184-106430206 GGCTCAAGTGATCTTTCTGTTGG + Intergenic
960148208 3:114225858-114225880 GGGTCATGAGACCCACCTGCAGG + Intergenic
960934288 3:122887817-122887839 GCCTCAAGCGATCCTCCTGCCGG + Intergenic
962176953 3:133165302-133165324 AGCTCTTGAGATCCTCCTGAGGG + Intronic
962353833 3:134677160-134677182 GGTTCAAGCAATTCTCCTGCCGG - Intronic
962964107 3:140337694-140337716 GGCTCAAGAAATCCTACTGAAGG - Intronic
963105641 3:141645011-141645033 GGCATAAGAGAGCCTCCTGGCGG + Intergenic
964107909 3:153058659-153058681 GGCTCAAGTGATCCTCCTGCTGG + Intergenic
964847782 3:161062367-161062389 GCCTCAAGTGATCCGCCTGCTGG - Intronic
966604415 3:181808181-181808203 GGCTCAAGCGGTCCTCCCGCTGG + Intergenic
966693901 3:182769656-182769678 GGGTCAATGGATCCTCCTCCGGG + Intergenic
966871959 3:184296463-184296485 GGTTCAAGCGATTCTCCTGCTGG - Intronic
967186168 3:186946476-186946498 GGTTCAAGTGATCCTCCCGCCGG + Intronic
967571667 3:191036456-191036478 GACTGGAGAGATTCTCCTGCTGG + Intergenic
969326199 4:6445620-6445642 GACTCAAGTGATCCCCCTGCCGG - Intronic
969363655 4:6681331-6681353 GGCACAAGGGCTCCCCCTGCCGG + Intergenic
970394086 4:15647948-15647970 GGCTCAAGTGATCCTCCTGCTGG + Intronic
970858381 4:20674449-20674471 GATTCAAGAGATTCTCCTGCTGG + Intergenic
971128341 4:23778757-23778779 GGTTCAAGAGATTCTCCTTTGGG + Intronic
972330182 4:38057126-38057148 GTCTCTAGACATCTTCCTGCAGG - Intronic
972453870 4:39232603-39232625 GGTTCAAGCAATTCTCCTGCTGG - Intronic
972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG + Intergenic
973940038 4:55898021-55898043 GGCTCAAGCGATCCCCCAACTGG - Intronic
975045717 4:69801267-69801289 GTTTCAAGAGATGCTCTTGCTGG - Intergenic
976688581 4:87843636-87843658 TGCTCAAGAGCTCCTCATGGAGG + Intronic
977614911 4:99077396-99077418 GGCTGAAGTGAACCTCCTGCAGG - Intronic
978393444 4:108251998-108252020 GGCTGAAAAGATCCTCATGGTGG - Intergenic
978445591 4:108777098-108777120 GGTTCGAGTGATTCTCCTGCCGG - Intergenic
979714170 4:123817162-123817184 GCATCAAGAAATCCTCCTCCGGG - Intergenic
981004273 4:139859321-139859343 GGCTAAAGCAATCCTCCTGCCGG + Intronic
981982379 4:150809749-150809771 GGCTCAAGTGATCCTTGAGCTGG - Intronic
983409938 4:167383364-167383386 GACTAAAGAGACCCTCCAGCCGG + Intergenic
985211102 4:187595551-187595573 GGCTCAAGTAATCCTCCTCCTGG - Intergenic
985307192 4:188556318-188556340 GGTTCAAGCGATTCTCCTGCTGG + Intergenic
985974398 5:3404595-3404617 TCCACAAGAGATCTTCCTGCTGG - Intergenic
986370107 5:7071617-7071639 GGTTCAAGTGATTCTCCTGCAGG + Intergenic
986453995 5:7897120-7897142 TTCTCAAGAGATGCTCCTGTTGG + Exonic
987719017 5:21610996-21611018 GACTCAAGAAGTCCTCCTACCGG + Intergenic
988526145 5:31988863-31988885 GCCTCAAGACACCCTCCTGTAGG + Intronic
988613224 5:32748048-32748070 GTCTCAAAAGATTTTCCTGCCGG - Intronic
988790896 5:34606592-34606614 GGCTCAATACAACCTCCTTCTGG - Intergenic
989946494 5:50238306-50238328 CGCTCCAGATATCCACCTGCAGG + Intergenic
991120508 5:63008252-63008274 GGCTGAAGGGTTCCTCCAGCGGG - Intergenic
991746030 5:69741805-69741827 GGCTCAGGAGATACCCCAGCTGG - Intergenic
991751675 5:69813436-69813458 GGCTCAGGAGATACCCCAGCTGG + Intergenic
991797632 5:70321763-70321785 GGCTCAGGAGATACCCCAGCTGG - Intergenic
991825408 5:70617119-70617141 GGCTCAGGAGATACCCCAGCTGG - Intergenic
991830962 5:70688329-70688351 GGCTCAGGAGATACCCCAGCTGG + Intergenic
991889974 5:71321084-71321106 GGCTCAGGAGATACCCCAGCTGG - Intergenic
991965803 5:72089399-72089421 GGTTCATGAGATCCTTCTGGGGG + Intergenic
992782862 5:80143735-80143757 GGGTCAAGATGGCCTCCTGCTGG - Exonic
992909830 5:81385213-81385235 GGCTCAAGCGATCCACCCACTGG - Intronic
993730376 5:91415272-91415294 GGCGCAAGCGATCCTCCAGTCGG - Intergenic
995114442 5:108463395-108463417 GACTAGAGAGATTCTCCTGCTGG - Intergenic
996381139 5:122863627-122863649 GGCTGAAGTGATCCTCCAGCAGG + Intronic
998117169 5:139546988-139547010 GCTTCAAGAGATTCTCCTGCCGG + Intronic
998139912 5:139693910-139693932 GGCTCAAGGGATGCTACTCCAGG + Intergenic
1000406262 5:160891550-160891572 GGTTCAAGGGATTCTCGTGCTGG + Intergenic
1001102987 5:168829439-168829461 GGTCCAAGAGATCCTCTTGGTGG + Intronic
1001642902 5:173257848-173257870 GGCTCAAGTGATCTTCCCACCGG + Intergenic
1001758104 5:174186216-174186238 GTCTCAGCAGACCCTCCTGCAGG - Intronic
1001804515 5:174571827-174571849 TTCTCAGGAGATCCCCCTGCTGG - Intergenic
1002016586 5:176328787-176328809 TGCTCAAGTGATCCTCCTACTGG - Intronic
1002083736 5:176755309-176755331 GCCTCAAGCAATCCTCCTACTGG - Intergenic
1002087138 5:176783105-176783127 GGCTCAAGCCATCCAACTGCTGG + Intergenic
1002127463 5:177057195-177057217 GGTTCAAGTGATTCTCCTGCTGG - Intronic
1002285255 5:178158290-178158312 GACTCAGGTGGTCCTCCTGCAGG - Intergenic
1002603215 5:180366787-180366809 GGCTCAAGAGATTCTCATGCTGG + Intergenic
1003009288 6:2411115-2411137 TCCTAAAGAGATCCTCTTGCTGG + Intergenic
1003065684 6:2902256-2902278 GGGTCAAGAGAACCTCCTCCAGG - Intronic
1003086451 6:3064663-3064685 GGGTCAAGAGAACCTCCTCTAGG + Intronic
1005215178 6:23518395-23518417 GGCTCAAGCAATCCTCCCACTGG + Intergenic
1007298097 6:40844006-40844028 GGCTCAGGAGATCCTCTGGCTGG + Intergenic
1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG + Intergenic
1008652016 6:53573516-53573538 GTCTCATGTGATCCTCCTTCAGG - Intronic
1008790018 6:55219051-55219073 GGCTCAAGTGATCCTTCACCTGG + Intronic
1011567935 6:88699566-88699588 GGCTCAAGTGATCCTTTTACTGG - Intronic
1011601952 6:89067737-89067759 GGCTCAAGTGATCCTCTGGCTGG + Intergenic
1013447816 6:110248686-110248708 GGCTCAAGTGATCCACCTGCTGG - Intronic
1015466220 6:133551617-133551639 GGCTCATGAGTTCCTCCTTGTGG + Intergenic
1016381147 6:143481869-143481891 GGCTCAAGCAATCCTCTTGGTGG - Intronic
1017119861 6:151014108-151014130 GGTTCAAGCGATTCTCATGCTGG - Intronic
1019338660 7:497043-497065 GGCCGAGGACATCCTCCTGCAGG - Intergenic
1019536037 7:1530521-1530543 GCCTCCAGAGATCTTCCCGCAGG + Intergenic
1019980170 7:4615557-4615579 GCCTCAAGCGATCCTCCTGGTGG - Intergenic
1020060178 7:5145503-5145525 GGCTCAATGAATCCTCCTGCTGG + Intergenic
1020077603 7:5268716-5268738 GGCTCAAGTGATCGTCCTGCTGG - Intergenic
1020418879 7:7976823-7976845 GGCTCAAGTGATCCTCCTTGAGG - Intronic
1021337319 7:19419741-19419763 GGTTCAAGCGATTCTCCTGCCGG - Intergenic
1021459446 7:20869537-20869559 GGCTAAGGAGAAGCTCCTGCAGG + Intergenic
1022539750 7:31124670-31124692 AGCTCAAGGGCTCCTCCTGCTGG - Intergenic
1023767331 7:43523540-43523562 GGTTCAAGCAATTCTCCTGCTGG - Intronic
1023821568 7:43983432-43983454 GTCTCAAGTGATCCTCCTGCTGG - Intergenic
1024277068 7:47686586-47686608 GGCTCAAGGGATTCTCCTGCTGG + Intergenic
1024683238 7:51716684-51716706 GGCTCAAGCAATCCTCCCACTGG - Intergenic
1025201526 7:56964959-56964981 CGCTCAAGTGATCATCCTGCTGG + Intergenic
1025670418 7:63611971-63611993 CGCTCAAGTGATCATCCTGCTGG - Intergenic
1026359443 7:69590297-69590319 GGCTCAAGCAATCCTCCCTCTGG - Intergenic
1026399244 7:69992650-69992672 GCCTCAAGGGATCCTCCCACTGG - Intronic
1026967042 7:74446709-74446731 ACCTCAAGTGATCCTCCTGCTGG - Intergenic
1026991607 7:74589144-74589166 GGCTGAAGTGATCCTCTTGCTGG - Intronic
1027131724 7:75596003-75596025 GGCTCAAGCAGTCCTCCCGCTGG - Intronic
1027237819 7:76308378-76308400 GGCTTAAGTGATCCTCCTGCAGG - Intergenic
1027243527 7:76349760-76349782 ACCTCAAGTGATCCACCTGCAGG - Intronic
1029241980 7:99169519-99169541 GGTTCAAGCGATTCTCCTGTCGG - Intergenic
1029260829 7:99301663-99301685 GGCTCAAGCGCCGCTCCTGCAGG - Intergenic
1029262526 7:99312895-99312917 GGCTCAAGTGATCCTCCTTCAGG - Intergenic
1029449426 7:100632644-100632666 GGCTCAAGCGATCCTCCCACCGG + Intronic
1029626760 7:101724676-101724698 AGCTCAAGTGATCCTCCTGTGGG - Intergenic
1029749830 7:102536853-102536875 GTCTCAAGTGATCCTCCTGCTGG - Intergenic
1029767780 7:102635958-102635980 GTCTCAAGTGATCCTCCTGCTGG - Intronic
1029838484 7:103338032-103338054 GGCTCAAGCAATCCTCCACCTGG - Intronic
1029985159 7:104916291-104916313 GGCTCAAAAAATCCTCCTGTTGG - Intergenic
1030067125 7:105668482-105668504 GGCTCAAGAGAAACTCTTGAGGG - Intronic
1030067232 7:105669311-105669333 ACCTCAAGTGATCCGCCTGCTGG + Intronic
1030531710 7:110718946-110718968 AGATCAAGGGGTCCTCCTGCTGG + Intronic
1031237765 7:119197926-119197948 GGCTGGACAGATCCTCCTACAGG - Intergenic
1032374217 7:131393721-131393743 GGCTCAAGTGATCCTTCATCTGG + Intronic
1032443904 7:131963636-131963658 GGCTCAAGTGATCCTCCTGTAGG + Intergenic
1032461069 7:132111902-132111924 GCCTCAAGTGATCCTCCTGCCGG + Intergenic
1034174973 7:149092573-149092595 GGTTCAAGTGATTCTCCTGCTGG + Intergenic
1034508102 7:151511741-151511763 GGTTCAAGTGATTCTCCTGCAGG + Intronic
1036963546 8:13271906-13271928 GCCTCAAGCAGTCCTCCTGCTGG + Intronic
1037423800 8:18732602-18732624 AGCTCAAGATATCCTGCTGGAGG - Intronic
1037940262 8:22945896-22945918 GGCCCAAGACACCCTCGTGCAGG - Intronic
1039063858 8:33592969-33592991 GGCTTAAGAAATCCTCCTGCTGG + Intronic
1039262550 8:35787712-35787734 GGCTTATGTGATCCTCCTACTGG + Intronic
1039611974 8:38927262-38927284 GCCTCAAGTGATCCTCCCACAGG - Intronic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1040928064 8:52706471-52706493 GGTTCAAGAGATTCTCCTTTGGG + Intronic
1041259748 8:56010770-56010792 TGCTCACGGGCTCCTCCTGCTGG - Intronic
1041734668 8:61097127-61097149 GGCCTCAGTGATCCTCCTGCAGG - Intronic
1041841575 8:62278360-62278382 GGACCCAGAGATCCTACTGCTGG + Intronic
1042267110 8:66920333-66920355 GGTTCAAGTGATTCTCCTGCTGG + Exonic
1042719543 8:71812522-71812544 GACTCACGAGGTCCTGCTGCAGG + Intergenic
1043658997 8:82710954-82710976 GCCTCAAGAAATTCTCCTGTCGG - Intergenic
1043952706 8:86326919-86326941 GGTTCAAGTGATTCTCCTACAGG - Intergenic
1045608270 8:103803703-103803725 GGAGCAAGAGATTCTTCTGCTGG + Intronic
1046010804 8:108544443-108544465 AGATCTAGAGATCCTACTGCTGG + Intergenic
1046477052 8:114759196-114759218 GGCTCAAGTGATCCTCCACTTGG + Intergenic
1047399767 8:124536255-124536277 GGCTAAAGAAATTCTCATGCTGG + Intronic
1048180547 8:132190443-132190465 GGAGCTAGAGATTCTCCTGCTGG + Intronic
1049184763 8:141244227-141244249 GGCACAGGGGAACCTCCTGCAGG - Intronic
1050287398 9:4117920-4117942 GCCGCACGAGCTCCTCCTGCTGG + Exonic
1050739696 9:8805697-8805719 GGTTCAAGAAATTCTCCTGCTGG + Intronic
1051010769 9:12411120-12411142 GGTTCAAGCGATCCACCTCCTGG - Intergenic
1051622889 9:19069862-19069884 GCCTCAAGTGATCCTCCTGCCGG - Intronic
1052951600 9:34217892-34217914 GCCTCAAGTGATTCTCATGCTGG + Intronic
1054791799 9:69263680-69263702 GTTTCAAGAGATCCTCCAGAAGG - Intergenic
1055294530 9:74820667-74820689 GCCTCAAGTGATCCTCCACCTGG - Intronic
1055598528 9:77890895-77890917 GCCTCAAGTGATCCTCCTACTGG - Intronic
1056246215 9:84697666-84697688 GGCTGTGGAGATCCTCCTGGAGG + Intronic
1056405152 9:86266820-86266842 GGCTCAAGCGATCCTCCCACAGG + Intronic
1056912848 9:90718956-90718978 GCCTCCAGGGAGCCTCCTGCTGG - Intergenic
1057211882 9:93204934-93204956 GGCTGAAGAGCTCATCATGCTGG + Intronic
1058465016 9:105218288-105218310 GGTTCCAGCGATTCTCCTGCTGG - Intergenic
1058501957 9:105629128-105629150 GGCTCAAGTGATCCTCTCACCGG - Intronic
1060837494 9:126767395-126767417 GCCTCAAGAGATCCACCCACAGG - Intergenic
1061242187 9:129381249-129381271 CGCTCAAGAAATGCTACTGCCGG + Intergenic
1203426638 Un_GL000195v1:46659-46681 GGCGCAAGAGAATCACCTGCGGG - Intergenic
1203439601 Un_GL000195v1:176413-176435 GGCGCAAGAGAATCACCTGCGGG + Intergenic
1186050681 X:5591631-5591653 GGCTCAAGCGATATACCTGCTGG + Intergenic
1186102144 X:6168564-6168586 GGCTCTAGAAGTCCTCCTGCTGG + Intronic
1186205018 X:7191753-7191775 GGGGAAAGAGCTCCTCCTGCAGG - Intergenic
1186782246 X:12924717-12924739 GCCTCAAGATATCCTCCAGGTGG - Intergenic
1188231428 X:27668836-27668858 GATTCAAGCGATTCTCCTGCTGG - Intronic
1189689248 X:43598859-43598881 GGATCCAGAGAGCCTCTTGCAGG + Intergenic
1190231945 X:48589123-48589145 GCCACAAGAGATCTTCCTGGCGG + Intergenic
1196234435 X:113262104-113262126 GGCTCAGGAGATCCCCTTGTGGG - Intergenic
1196680236 X:118462951-118462973 AACTCAGGCGATCCTCCTGCCGG - Intergenic
1196795515 X:119499397-119499419 GGTTCAAGTGATCCTCCTGCCGG + Intergenic
1197716382 X:129710001-129710023 GCCTCGAGTGATCCTCCTGTCGG - Intergenic
1199768220 X:150956100-150956122 ACCTCAAGAAATTCTCCTGCAGG + Intergenic
1200068297 X:153515453-153515475 TGCCCAAGGGATGCTCCTGCTGG + Intergenic
1200204636 X:154307052-154307074 GTCTCAAGAGATCCTCCTGCTGG - Intronic
1200971807 Y:9160679-9160701 GGCTCAGGAGATAGGCCTGCTGG - Intergenic
1201494922 Y:14582666-14582688 GGCCCTAGAAATCCTCCTGCTGG - Intronic
1201505603 Y:14696079-14696101 GGAGCAAGAGATTCCCCTGCTGG - Intronic
1201854114 Y:18521720-18521742 GGCTCAACAGATACTTCTACAGG + Intergenic
1201879207 Y:18798664-18798686 GGCTCAACAGATACTTCTACAGG - Intronic
1202047788 Y:20751807-20751829 GGCTCAAGGAATCCTCTTGCTGG - Intergenic
1202139218 Y:21703614-21703636 GGCTCAGGAGATAGGCCTGCTGG + Intergenic