ID: 1161942204

View in Genome Browser
Species Human (GRCh38)
Location 19:7412408-7412430
Sequence TAAGTGTCTCGGTGAGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161942204_1161942208 9 Left 1161942204 19:7412408-7412430 CCGCCTTCTCACCGAGACACTTA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1161942208 19:7412440-7412462 TTTTTAAATTATACCATTTTAGG 0: 1
1: 3
2: 8
3: 166
4: 1354
1161942204_1161942210 19 Left 1161942204 19:7412408-7412430 CCGCCTTCTCACCGAGACACTTA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1161942210 19:7412450-7412472 ATACCATTTTAGGCCAGGAACGG 0: 1
1: 0
2: 7
3: 68
4: 657
1161942204_1161942209 14 Left 1161942204 19:7412408-7412430 CCGCCTTCTCACCGAGACACTTA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1161942209 19:7412445-7412467 AAATTATACCATTTTAGGCCAGG 0: 1
1: 0
2: 15
3: 98
4: 664
1161942204_1161942212 22 Left 1161942204 19:7412408-7412430 CCGCCTTCTCACCGAGACACTTA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1161942212 19:7412453-7412475 CCATTTTAGGCCAGGAACGGTGG 0: 1
1: 2
2: 51
3: 409
4: 2615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161942204 Original CRISPR TAAGTGTCTCGGTGAGAAGG CGG (reversed) Intronic
900669888 1:3845005-3845027 TTAGTGTCTCAGAGAGAAAGAGG + Intronic
900911738 1:5601495-5601517 TAAGTGTGTCGTGGATAAGGAGG + Intergenic
902588784 1:17458724-17458746 GAAGTCTCTTGGGGAGAAGGGGG - Intergenic
903675416 1:25061701-25061723 TGAGTGTCTCAGTGAGGAGGTGG - Intergenic
906116776 1:43362314-43362336 TAAGTGGCTAGGTGAAAAGCCGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
915106788 1:153539845-153539867 TCAGGGTCTCACTGAGAAGGAGG - Intronic
923749480 1:236734316-236734338 TAAGTGTATGGGGGCGAAGGGGG + Intronic
1063323453 10:5073996-5074018 TAATTATCTCGGTGAGCAGACGG - Intronic
1063387778 10:5626949-5626971 TATGTTTCACAGTGAGAAGGAGG + Intergenic
1064598098 10:16966419-16966441 TAAGGGTCCAGGTGAGAAGGAGG - Intronic
1064769673 10:18710804-18710826 TCATTGACTCGGGGAGAAGGAGG - Intergenic
1067902798 10:50259632-50259654 TAACTATCTCTGTGACAAGGGGG - Intergenic
1073474388 10:103743325-103743347 TCAGTGACTCGGTGAGTTGGGGG - Intronic
1077467977 11:2742689-2742711 CAAGAGCCTCGGAGAGAAGGAGG + Intronic
1078699690 11:13668796-13668818 TCTGCGTCTAGGTGAGAAGGGGG + Exonic
1079630255 11:22666475-22666497 TTAGTGTCTGGGGGACAAGGAGG + Intronic
1084946071 11:72639237-72639259 TAAGTGTCTCTGTGAGGATGGGG + Intronic
1087819209 11:102692289-102692311 AAAGTGTCTCAGTGAGGGGGAGG + Intronic
1088727308 11:112650898-112650920 TAAGTGACTAGGTAGGAAGGAGG - Intergenic
1089252872 11:117178183-117178205 TAACTGTCTCTGAGAGAAGAGGG + Intergenic
1090306209 11:125693383-125693405 TAAGTGGGTAGGGGAGAAGGAGG - Intergenic
1091349655 11:134882746-134882768 TGGGTGTCTCGGGGAGAAGCAGG + Intergenic
1093770803 12:23015437-23015459 TAATTTTTTCGGAGAGAAGGAGG + Intergenic
1100517453 12:95342088-95342110 TAAGTGCCCAGGTGAGAAGCTGG + Intergenic
1103841203 12:123866528-123866550 TAAGTGTGTCGGTGTGTCGGTGG - Intronic
1106419850 13:29577199-29577221 AAAGTGGCTGGGAGAGAAGGTGG - Intronic
1109376448 13:61500446-61500468 TATGTGTCTCTGTGAGAGGTAGG - Intergenic
1110659267 13:78039757-78039779 TATATGTCAAGGTGAGAAGGTGG + Intergenic
1114129018 14:19767326-19767348 TTAGTGTCTCTGTTAGAAGATGG - Intronic
1114459960 14:22879995-22880017 TAAGGCTCTTGGTGGGAAGGTGG + Exonic
1115358217 14:32472369-32472391 TAAGTGTCTTGATCATAAGGTGG + Intronic
1121794638 14:96724884-96724906 TAAGTGTCTTTGTAAGAGGGAGG - Intergenic
1121819193 14:96952620-96952642 TAAGAGTGTCGGTGTGGAGGAGG + Intergenic
1123571970 15:21621548-21621570 TTAGTGTCTCTGTTAGAAGATGG - Intergenic
1123608584 15:22064142-22064164 TTAGTGTCTCTGTTAGAAGATGG - Intergenic
1124190725 15:27574327-27574349 TAAGTCCCTGGGTGACAAGGTGG - Intergenic
1125167667 15:36727789-36727811 TAACTCTCTCTGTGAGAAGTAGG + Intronic
1125907217 15:43404095-43404117 TAATTATCTCAGTGAGATGGGGG - Exonic
1129659325 15:77544178-77544200 TAATTTCCTCGGTCAGAAGGAGG - Intergenic
1130107742 15:80941770-80941792 TAAATGTCTCGGTGGGTGGGAGG + Intronic
1202980826 15_KI270727v1_random:355938-355960 TTAGTGTCTCTGTTAGAAGATGG - Intergenic
1132766701 16:1537974-1537996 TAAAGGTGTCGGTGAGAACGTGG - Intronic
1133111562 16:3551009-3551031 TAAGTGGGTAGGTGAGTAGGTGG - Intronic
1135040675 16:19114715-19114737 GAAGTGTCTCGAGGAGAAGGCGG - Exonic
1141190029 16:81817899-81817921 TTACTGTTTCGGGGAGAAGGGGG + Intronic
1143265287 17:5632355-5632377 TAAGTGTGTTTGTGGGAAGGGGG - Intergenic
1144524049 17:15974850-15974872 GAAGTGTCTCTTTGAGAATGTGG + Exonic
1149094245 17:52821439-52821461 TAAGTGTTTAGGGCAGAAGGTGG - Intergenic
1155838549 18:30618833-30618855 TAAGTGTTTAAGTGAAAAGGAGG + Intergenic
1156331271 18:36126072-36126094 CAAGTGCCTTGCTGAGAAGGTGG + Intronic
1157745160 18:50128831-50128853 GAAGTGGCCCAGTGAGAAGGGGG + Intronic
1161942204 19:7412408-7412430 TAAGTGTCTCGGTGAGAAGGCGG - Intronic
1163805547 19:19394843-19394865 TAAGTGTATCTGTGAGAGGTGGG + Intronic
1164706288 19:30322761-30322783 TAAGGGGCTCGGTGGGCAGGAGG - Intronic
1165657096 19:37543559-37543581 TAAGTGTTTCGCTGATGAGGTGG - Intronic
925800846 2:7599002-7599024 CAAGTGCCTTGGTGGGAAGGGGG + Intergenic
927115815 2:19901364-19901386 TAAGTCTCTGGGTGCGAATGAGG + Intronic
935109724 2:100081455-100081477 GAAGTGCCTGGGTGAGCAGGTGG - Intronic
936125250 2:109783754-109783776 GAAGTGCCTGGGTGAGCAGGTGG + Intergenic
936219443 2:110587714-110587736 GAAGTGCCTGGGTGAGCAGGTGG - Intergenic
941419978 2:165271722-165271744 TGATTGTCTCTGGGAGAAGGAGG - Intronic
944500671 2:200356471-200356493 TAAGTGTTTAGCTTAGAAGGAGG + Intronic
945049562 2:205810254-205810276 CAAGTGACTGGGTGAGAAAGAGG - Intergenic
946868257 2:224061708-224061730 CAAGTGTGTGGGAGAGAAGGAGG - Intergenic
947164763 2:227250649-227250671 GAAGTGTCTGGGTTGGAAGGTGG + Intronic
947226467 2:227845274-227845296 TTAGGGTCTCTGTGATAAGGTGG - Intergenic
947392850 2:229656686-229656708 TAAGTGTCTAGGTGTGAGAGTGG - Intronic
948568092 2:238898983-238899005 TATGTGCCTGGGTCAGAAGGTGG + Intronic
1169911552 20:10651471-10651493 TGAATGTCTCGGTGAGAGAGGGG - Intronic
1181371977 22:22425925-22425947 GAAGTGGCTCGGTGAGCCGGGGG - Intergenic
1181870239 22:25892484-25892506 TAAGAGGCACGGTGACAAGGTGG - Intronic
1185236586 22:49716957-49716979 TAAGTGTCTCTGTGTGAAGTGGG - Intergenic
954942455 3:54386938-54386960 TAACTGTCACTGTTAGAAGGTGG - Intronic
955476388 3:59340539-59340561 CAGGTGTCTTGGTGAGAAAGTGG - Intergenic
956158723 3:66325615-66325637 TAAGTAACTAGGTGATAAGGGGG + Intronic
959239057 3:103765193-103765215 TAAGTCTCACAGTGAGAAGATGG + Intergenic
961815312 3:129547265-129547287 TCAGTGTCTTGGGGAGAGGGGGG + Intronic
964119259 3:153164848-153164870 GAAGTGTCTCAGTGACAAGTTGG + Exonic
975974471 4:80079288-80079310 AAAGTGTCTACGTGGGAAGGTGG + Intronic
978203270 4:106048209-106048231 TAAAGGTCTCGGTCAGTAGGTGG + Intronic
983021530 4:162682797-162682819 TCAGTGTCTGGGTGAGGAAGAGG - Intergenic
990615605 5:57504295-57504317 GAGGTGTCTAGGTGAGCAGGAGG + Intergenic
991927343 5:71718812-71718834 CAAGTGTGGCGGTGAGAAGGGGG - Intergenic
992865463 5:80953065-80953087 TAAGTGTCTCATTCTGAAGGAGG + Intergenic
994853718 5:105090337-105090359 TCAGTGTCTCGATGAGGGGGTGG - Intergenic
1002394961 5:178945588-178945610 TATGTGTCTCTGTGTGTAGGGGG + Intronic
1003498480 6:6685037-6685059 TAAGTTTCACAATGAGAAGGTGG + Intergenic
1004481147 6:16020398-16020420 TGTGTGTCTAGGTGTGAAGGTGG - Intergenic
1011558386 6:88591660-88591682 TTAGAGGCTCCGTGAGAAGGAGG - Intergenic
1014281180 6:119443999-119444021 CCAGGGTCTCTGTGAGAAGGTGG + Intergenic
1018295988 6:162344625-162344647 TGAGTATCTCGGTGGGCAGGGGG - Intronic
1019919645 7:4155255-4155277 TAAGTGTCTCTGTGAGCTGCAGG - Intronic
1026303612 7:69120793-69120815 TATTTATCTCGGTGAGAAGAGGG + Intergenic
1026677012 7:72436531-72436553 TAAGTCTCTTGGTGACTAGGAGG + Intronic
1027571242 7:79870102-79870124 GAAAGGTCTCGCTGAGAAGGTGG + Intergenic
1027831017 7:83177950-83177972 TAAGTGTGTGTGTGAGGAGGCGG - Intergenic
1033583258 7:142755329-142755351 TAGGAGCCTCTGTGAGAAGGAGG - Intronic
1034839700 7:154384333-154384355 TAAATGCCTCTGGGAGAAGGAGG + Intronic
1035930675 8:3776652-3776674 CAAGTGCCTTGGTGGGAAGGAGG - Intronic
1037117597 8:15245367-15245389 AAAGTGTCAGGGCGAGAAGGAGG + Intergenic
1040044562 8:42949399-42949421 CAAGTGACTTAGTGAGAAGGGGG + Intronic
1045404810 8:101855199-101855221 TAAGTGTCTAGAAGAGAAGAGGG - Intronic
1049522502 8:143101033-143101055 TACGAGTCTTGGTGAAAAGGTGG + Intergenic
1050640211 9:7659527-7659549 AAAGTGCCTCAGTCAGAAGGGGG - Intergenic
1059591088 9:115663021-115663043 TATATGTTTCAGTGAGAAGGTGG - Intergenic
1059930936 9:119260002-119260024 TAAGGGTCTAGCTGAGAATGTGG - Intronic
1060841193 9:126794335-126794357 TCAGTGTCTTGGTGAGAATCTGG - Intergenic
1061709124 9:132475581-132475603 GAAGTGTCTCGGTTAGGAGCAGG + Intronic
1194752860 X:97704223-97704245 TAAGTGTCATGGAGAGCAGGGGG + Intergenic