ID: 1161943265

View in Genome Browser
Species Human (GRCh38)
Location 19:7419055-7419077
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 4, 1: 0, 2: 4, 3: 16, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161943256_1161943265 24 Left 1161943256 19:7419008-7419030 CCGCACTCGGCCTCTGTACCCCA No data
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140
1161943262_1161943265 -5 Left 1161943262 19:7419037-7419059 CCCACACTCGGCCTCTGTACCCC 0: 5
1: 3
2: 4
3: 18
4: 187
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140
1161943263_1161943265 -6 Left 1161943263 19:7419038-7419060 CCACACTCGGCCTCTGTACCCCA No data
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140
1161943255_1161943265 25 Left 1161943255 19:7419007-7419029 CCCGCACTCGGCCTCTGTACCCC 0: 1
1: 5
2: 2
3: 18
4: 168
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140
1161943259_1161943265 6 Left 1161943259 19:7419026-7419048 CCCCAGATGTACCCACACTCGGC 0: 4
1: 0
2: 4
3: 13
4: 100
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140
1161943257_1161943265 14 Left 1161943257 19:7419018-7419040 CCTCTGTACCCCAGATGTACCCA No data
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140
1161943261_1161943265 4 Left 1161943261 19:7419028-7419050 CCAGATGTACCCACACTCGGCCT 0: 6
1: 1
2: 2
3: 7
4: 78
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140
1161943260_1161943265 5 Left 1161943260 19:7419027-7419049 CCCAGATGTACCCACACTCGGCC 0: 4
1: 2
2: 6
3: 11
4: 64
Right 1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG 0: 4
1: 0
2: 4
3: 16
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900529334 1:3145043-3145065 ACCCTAGATGTCCCTGCACTTGG + Intronic
900568416 1:3346691-3346713 ACCCCGGCTGCACCCAGACTGGG + Intronic
901588834 1:10321901-10321923 AACCCAGATGCACCCACAGCAGG - Intronic
906154149 1:43604218-43604240 CCCCCAGATGCAGCCACACTCGG - Intronic
906260136 1:44380674-44380696 AACCCAGATGTCCCCTCCCTTGG - Intergenic
907113685 1:51950038-51950060 ACCCCAGACTCAGCCACACTGGG - Intronic
907334460 1:53691240-53691262 CCTCCAGCTGTACCCACAGTGGG + Intronic
910091272 1:83467040-83467062 ACCCCAGATTCACCCACTCCTGG - Intergenic
910260089 1:85285612-85285634 AGCCTAGATGTTCCCACTCTAGG - Intergenic
913046589 1:115078463-115078485 ACCCCACATATCCTCACACTGGG - Intronic
913226893 1:116708379-116708401 AGCCCAGATGTGCCCACTCCTGG - Intergenic
914788837 1:150858433-150858455 ACATCAGATGTACCATCACTGGG - Exonic
916169192 1:161987981-161988003 AGCTCAGATGCTCCCACACTTGG + Intronic
918175768 1:182043707-182043729 TCCCAGGTTGTACCCACACTAGG - Intergenic
921213084 1:212916414-212916436 AACCCAGAGGTTCCCAAACTTGG + Intergenic
1063157900 10:3396990-3397012 ACCCCACATACACCCACTCTGGG - Intergenic
1068525000 10:58118196-58118218 ACCCCAGCTGAGCCCAGACTTGG + Intergenic
1069630297 10:69893539-69893561 CTCCCAGATGGACCCACCCTTGG + Intronic
1069825943 10:71255136-71255158 ACCCGAGAAGAACCCACAGTGGG + Intronic
1076636198 10:131883828-131883850 ACCCCAGAGGCACCTACGCTAGG + Intergenic
1076659811 10:132048035-132048057 ACCCCAGCTAAACCCACACTGGG - Intergenic
1083656530 11:64232423-64232445 ACCCCAGCTGCACCCAGACCGGG + Exonic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1093071700 12:14712189-14712211 AACCCAAATTTCCCCACACTGGG - Intergenic
1096622925 12:52875487-52875509 ACCCCACATGTACTGACTCTTGG - Intergenic
1097130572 12:56808144-56808166 ACCCCAGAGGTACCTCCAGTGGG - Intergenic
1101919184 12:108919007-108919029 CCCCCACTTGTACCCACACTTGG + Intronic
1101919250 12:108919276-108919298 ACCCCACCTGTACCCACACTTGG + Intronic
1101926828 12:108978717-108978739 ACCCCAGAAAACCCCACACTAGG - Intronic
1102476036 12:113189147-113189169 ACCCCAAATGTCTCTACACTTGG - Intronic
1102701107 12:114840175-114840197 ACCCCAGATGGGTACACACTAGG + Intergenic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1108505046 13:51105255-51105277 GCCCCAGCTGTAACCACACAGGG - Intergenic
1114757628 14:25278335-25278357 ACCCCAGATTTTTACACACTGGG + Intergenic
1115243259 14:31270158-31270180 CCCCCAGATTCAGCCACACTGGG + Intergenic
1118421562 14:65611054-65611076 ACCCCTATTGTAGCCACACTGGG - Intronic
1121327120 14:93027585-93027607 ACTCCAGATGTTCCAACACAGGG + Intronic
1122268274 14:100556808-100556830 AACCCAGCTGTCCCCTCACTAGG - Intronic
1125733265 15:41906338-41906360 ACCCCAGACTCAGCCACACTGGG + Intronic
1132972823 16:2697207-2697229 ACCCCAGAGGAACCCACATATGG - Intronic
1134063699 16:11213510-11213532 ATCCCTGAAGGACCCACACTAGG - Intergenic
1134510483 16:14842650-14842672 ACCCCAGAAGTCCCCATCCTGGG + Intronic
1134698124 16:16241138-16241160 ACCCCAGAAGTCCCCATCCTGGG + Intronic
1134973713 16:18553539-18553561 ACCCCAGAAGTCCCCATCCTGGG - Intronic
1135597723 16:23756223-23756245 AATGCAGATGTACCCACACCAGG + Intronic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1137839704 16:51628950-51628972 TCACCAGTTGTACCAACACTGGG + Intergenic
1138977325 16:62223461-62223483 ACGCCAAGTGTACCCACACATGG + Intergenic
1140514963 16:75535082-75535104 ACCGGAGGTGTCCCCACACTCGG - Intronic
1141271070 16:82541672-82541694 ACCCCAGGTGTGCGCTCACTGGG - Intergenic
1145942079 17:28747836-28747858 CCCCCAGATCTACCCAGACCCGG + Exonic
1146001252 17:29131877-29131899 GGCCCACAGGTACCCACACTGGG - Intronic
1146941818 17:36848568-36848590 ACCCCATCTGCACCCCCACTAGG - Intergenic
1147466458 17:40614850-40614872 TCCCCAGCTGCACCCACACCAGG - Intergenic
1147875389 17:43617145-43617167 AGCCCAGAGGTGCACACACTGGG - Intergenic
1148473954 17:47914852-47914874 TCCCCAGACTTACCCACCCTGGG - Intronic
1150496166 17:65609461-65609483 CAGCCAGATGTCCCCACACTGGG - Intronic
1151508977 17:74546783-74546805 AACCCAGGTCTATCCACACTCGG + Intergenic
1153428363 18:4989954-4989976 ACCCCAGAAGTACCTCCAGTGGG - Intergenic
1159904749 18:74078997-74079019 ACCCACGATGTACCCACAGCAGG + Intronic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1160969645 19:1761854-1761876 CCCCCACATCTGCCCACACTCGG - Intronic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161943251 19:7418995-7419017 ACCCCAGGTGCACCCGCACTCGG + Intronic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161943300 19:7419203-7419225 TACCCCGATGTACCCACACTCGG + Intronic
1161943307 19:7419232-7419254 TACCCCGATGTACCCACACTCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1161943473 19:7419906-7419928 ACCCCAGATACACCCACACTCGG + Intronic
1161943481 19:7419936-7419958 ACCCCAGGTGTACTCACACTCGG + Intronic
1161943488 19:7419966-7419988 ACCCCAGGTGCGCCCACACTCGG + Intronic
1164670516 19:30069750-30069772 ACCTCAGATGTGACCTCACTTGG + Intergenic
1166012260 19:39951228-39951250 AGCCCAGTTGGAGCCACACTGGG + Intergenic
1167102733 19:47414209-47414231 AACTCAGATATAACCACACTTGG - Intronic
1167658627 19:50782733-50782755 ACCCCTGCTGAACCCACAGTTGG - Intergenic
924967449 2:91414-91436 CACCCAGTGGTACCCACACTGGG - Intergenic
925341218 2:3138765-3138787 ACTCCAGGTGTGGCCACACTGGG - Intergenic
926109715 2:10174015-10174037 ACTCCAAATGCAGCCACACTGGG - Intronic
926500914 2:13650978-13651000 ACCCCAGATTCAGCCACCCTGGG - Intergenic
929034743 2:37679909-37679931 ATCCCAGAAGTACACACCCTGGG + Intronic
931969195 2:67567161-67567183 CCCACTGATCTACCCACACTGGG - Intergenic
936064451 2:109319895-109319917 ACCCCAGATGTAACCACCGGGGG - Intronic
936379164 2:111968903-111968925 AGCCCAGAAGGAGCCACACTGGG - Intronic
947582571 2:231330660-231330682 GCCCCAGCTGTACCCTCACCAGG - Intronic
1168804193 20:663101-663123 TCCCCAGATGGACACACTCTGGG + Exonic
1175371267 20:58494838-58494860 ACCCCACTTGTACCCACCCTGGG + Intronic
1175669075 20:60885865-60885887 ACACCATATGTACACACACGTGG - Intergenic
1175946321 20:62560730-62560752 ACCCCAGTTGCACTCACAGTGGG - Intronic
1179222869 21:39425236-39425258 ATCTCAGATGTGTCCACACTTGG - Intronic
1181023785 22:20116611-20116633 ACCCCATCTGTCCCCACACAGGG - Exonic
1181051843 22:20241657-20241679 ACCCCGTATGTACACACACCTGG + Exonic
1181407590 22:22695587-22695609 ACCACAGATGCACCCCCACAGGG + Intergenic
1183833703 22:40434861-40434883 TCCCCATCTCTACCCACACTGGG + Intronic
1184457219 22:44617878-44617900 ACCACACATGTACACACACACGG + Intergenic
953054300 3:39375467-39375489 TCCCCATTTCTACCCACACTAGG - Intergenic
954370669 3:50168244-50168266 ACCCCAGCTGCACCCTCCCTGGG - Intronic
954663575 3:52238834-52238856 CCCCCAGATGTGCCCACCCCAGG + Intronic
956558186 3:70543968-70543990 ACCCCAGACTCAGCCACACTGGG - Intergenic
957624779 3:82643350-82643372 ACCCCAGAAGTACCTGCAGTGGG + Intergenic
958991555 3:100851822-100851844 ATCCCAGGTGTTCCAACACTTGG - Intronic
961542703 3:127610851-127610873 ACCCCAGATCTTCGCAGACTAGG - Intronic
961912207 3:130329756-130329778 ACCCCAGATGAACACAAAATTGG + Intergenic
964865409 3:161253965-161253987 AGTCCAGATGTTCCCAAACTTGG + Intergenic
967224346 3:187276548-187276570 ACCCCATGTGCACCCACACCTGG + Intronic
972996993 4:44892797-44892819 TCCCCAAATATAGCCACACTAGG - Intergenic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
976922249 4:90455006-90455028 ACCCCAGAGGTACCTCCATTGGG - Intronic
978371007 4:108029588-108029610 ACCCCAGGTGTATCAACAGTGGG - Intronic
978412832 4:108443876-108443898 ACCCCAGATCTGGCCCCACTTGG + Intergenic
978508233 4:109484255-109484277 ACCTCAGATAAACCCACACTGGG - Intronic
979308927 4:119179213-119179235 CACCCAGCTGTATCCACACTGGG + Intronic
982249359 4:153388956-153388978 GCCCCAGATTCAGCCACACTGGG - Intronic
985509610 5:305379-305401 CCCCCAGCTACACCCACACTAGG - Intronic
988088823 5:26508365-26508387 ACCCCAGACCCAGCCACACTGGG + Intergenic
989459738 5:41683616-41683638 GCCCCAGATACAGCCACACTGGG - Intergenic
990488366 5:56280680-56280702 GCCCCATATGTCTCCACACTAGG + Intergenic
991965531 5:72086666-72086688 TCACCAGCTGTAGCCACACTAGG + Intergenic
998229424 5:140350566-140350588 AGCCCAGAGTTACCCAAACTTGG + Intergenic
998394241 5:141808133-141808155 ACCCCAGCTCTACCCCCACCTGG + Intergenic
998396791 5:141823877-141823899 ACCCCTCATGTGCCCAAACTTGG - Intergenic
999507971 5:152218130-152218152 AACCCAGTTGTACCTACTCTTGG - Intergenic
1004840188 6:19575329-19575351 ACTCCAAATATAGCCACACTGGG + Intergenic
1007410047 6:41656354-41656376 ACACCACATCTACCCACACACGG + Intergenic
1008086925 6:47255143-47255165 ACCACAGATGCACACTCACTGGG - Intronic
1012584402 6:100904767-100904789 AACCCAGAATGACCCACACTAGG + Intergenic
1017363536 6:153604873-153604895 ACCTCAGCTGTACCCCCACAAGG + Intergenic
1017972602 6:159326474-159326496 GCCCCAGATGGACACAGACTGGG - Intergenic
1022135042 7:27439324-27439346 ACCTCAGATAGAACCACACTAGG + Intergenic
1023432850 7:40112677-40112699 ACCCCAAATATAGTCACACTGGG + Intergenic
1024291867 7:47810878-47810900 TCCCCACATATATCCACACTAGG - Intronic
1027512205 7:79096854-79096876 ACTCCAGATGATCCCAAACTAGG + Intronic
1029532717 7:101136044-101136066 ACCCAAGTTGTTCCCACAGTGGG + Intronic
1032412597 7:131708465-131708487 AACTCCCATGTACCCACACTTGG + Intergenic
1033410216 7:141110756-141110778 ACCCCAGATACAGCCACACTAGG - Intronic
1034887704 7:154810717-154810739 ACCCCAGGTACAGCCACACTGGG + Intronic
1038046085 8:23766539-23766561 ACCACAGATGTATCCAGGCTTGG + Intergenic
1040541596 8:48362058-48362080 ACTCCAAATGCAGCCACACTGGG + Intergenic
1045833199 8:106489366-106489388 ACCCCAGCAGTACCCTCACTTGG + Intronic
1048485919 8:134847643-134847665 ACCCCAGACTCAACCACACTTGG + Intergenic
1049159595 8:141088894-141088916 ACCCCACATGTACCCAGAAGAGG - Intergenic
1049178825 8:141209982-141210004 CCCCCAGATGAACCCACATTTGG + Intronic
1052744986 9:32432034-32432056 CCCCCAGATGTTCCCAGATTTGG + Intronic
1053205802 9:36185655-36185677 ACTCCAAATATAGCCACACTTGG - Intergenic
1053260530 9:36659656-36659678 ACCCCAGATGTACACAGAGCCGG - Intronic
1058196092 9:101978270-101978292 ACCCCAGATGTGACCTCAGTTGG - Intergenic
1059107946 9:111527480-111527502 TCCCCAGAAGTAACCACTCTTGG - Exonic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1061827899 9:133273388-133273410 CCCCCAGATTTCCACACACTGGG + Intronic
1185717463 X:2354242-2354264 ACTCCAGATGTCCCATCACTGGG + Intronic
1191071172 X:56401492-56401514 TCCCCAGACCTAGCCACACTGGG - Intergenic
1192360581 X:70436312-70436334 CCCCCAGATGAAACCACATTTGG + Intergenic
1197838279 X:130718360-130718382 ACCCCTGAGGTACCCATGCTAGG - Intronic
1198686562 X:139233809-139233831 AGGCCAGAAGTACCCACACTTGG + Intergenic
1201261127 Y:12159976-12159998 ACAACTGATGAACCCACACTGGG + Intergenic