ID: 1161943272

View in Genome Browser
Species Human (GRCh38)
Location 19:7419084-7419106
Sequence TACCCTGATGTACCCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 2, 2: 1, 3: 11, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161943266_1161943272 5 Left 1161943266 19:7419056-7419078 CCCCAGATGTACCCACACTCGGC 0: 4
1: 0
2: 4
3: 13
4: 100
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77
1161943264_1161943272 13 Left 1161943264 19:7419048-7419070 CCTCTGTACCCCAGATGTACCCA No data
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77
1161943269_1161943272 -6 Left 1161943269 19:7419067-7419089 CCCACACTCGGCCTCTGTACCCT 0: 1
1: 5
2: 2
3: 19
4: 146
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77
1161943268_1161943272 3 Left 1161943268 19:7419058-7419080 CCAGATGTACCCACACTCGGCCT 0: 6
1: 1
2: 2
3: 7
4: 78
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77
1161943263_1161943272 23 Left 1161943263 19:7419038-7419060 CCACACTCGGCCTCTGTACCCCA No data
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77
1161943267_1161943272 4 Left 1161943267 19:7419057-7419079 CCCAGATGTACCCACACTCGGCC 0: 4
1: 2
2: 6
3: 11
4: 64
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77
1161943270_1161943272 -7 Left 1161943270 19:7419068-7419090 CCACACTCGGCCTCTGTACCCTG 0: 1
1: 2
2: 6
3: 23
4: 282
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77
1161943262_1161943272 24 Left 1161943262 19:7419037-7419059 CCCACACTCGGCCTCTGTACCCC 0: 5
1: 3
2: 4
3: 18
4: 187
Right 1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG 0: 1
1: 2
2: 1
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161943272 Original CRISPR TACCCTGATGTACCCACACT TGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901140227 1:7024308-7024330 CACCCTGATGTGCCCACACATGG - Intronic
911852831 1:102840261-102840283 TATTCTGAAGTAGCCACACTTGG - Intergenic
913547145 1:119880281-119880303 GGCCCTGATGTATACACACTGGG - Intergenic
915814231 1:158949912-158949934 TGCCATGATGTAGCCACAATTGG + Intronic
916119353 1:161513721-161513743 TGGCCTCATGTACCCACCCTTGG - Intronic
916129115 1:161595379-161595401 TGGCCTCATGTACCCACCCTTGG - Intronic
917408106 1:174730652-174730674 TATCCTGTTGAACCCACACTGGG - Intronic
918175768 1:182043707-182043729 TCCCAGGTTGTACCCACACTAGG - Intergenic
1063813355 10:9740924-9740946 TAACCAGATGAACCCCCACTGGG + Intergenic
1066683469 10:37958394-37958416 TACCATTATGTACCCACAATAGG - Intronic
1068120326 10:52777877-52777899 TTCCCTGTTGTACCCAGGCTTGG - Intergenic
1069152669 10:64984737-64984759 CACCCTGATGTGCCCACAGTTGG + Intergenic
1069788306 10:71003878-71003900 GACCCTGAGTTACCCACACAAGG + Intergenic
1076918876 10:133441150-133441172 GACCCTGATGTACCCTGACCTGG - Intergenic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1092629237 12:10360839-10360861 CAGCATGAGGTACCCACACTGGG - Intergenic
1101071399 12:101079927-101079949 AAGTCTGAAGTACCCACACTAGG + Intronic
1102269413 12:111519660-111519682 CACCGTGATATACCAACACTTGG + Intronic
1105967638 13:25399145-25399167 TACCCAGCAGTCCCCACACTGGG - Intronic
1106431006 13:29680614-29680636 CACCCTTCTGTTCCCACACTTGG - Intergenic
1117067041 14:52021499-52021521 TACCATTAAGTACACACACTGGG + Intronic
1120202590 14:81553935-81553957 TACCCTGCTGTGCCCAAACCAGG + Intergenic
1120388210 14:83872534-83872556 TATCATGATGTACCAACACTCGG + Intergenic
1126421028 15:48472257-48472279 TGCACTGATTTAACCACACTTGG + Intronic
1129281735 15:74490316-74490338 CACCCTGCTGTAGCCACACCGGG + Intergenic
1129787477 15:78319365-78319387 CTCCCTGATGCACACACACTGGG - Intergenic
1134031770 16:10997931-10997953 TAAGCTGCTGTACCCACACCTGG + Intronic
1134063699 16:11213510-11213532 ATCCCTGAAGGACCCACACTAGG - Intergenic
1136559636 16:31031489-31031511 TGCCCTGATGAACCCACAGAGGG - Intergenic
1137558879 16:49490352-49490374 TACCCTGATCTTCCCACTCTTGG - Exonic
1139766803 16:69237501-69237523 TGACCTGATGAACCCAGACTTGG - Intronic
1143514229 17:7411397-7411419 TTCCCTGCTTTGCCCACACTGGG + Intronic
1145786768 17:27598752-27598774 TTCCCTGATGTCCCCAGATTGGG + Intronic
1148431547 17:47647830-47647852 TGCCCTGCAGTAGCCACACTGGG - Intergenic
1150496166 17:65609461-65609483 CAGCCAGATGTCCCCACACTGGG - Intronic
1151145735 17:72039213-72039235 TACCCTGTTGTACCCAGCTTAGG + Intergenic
1153812730 18:8766018-8766040 CACCCTTATGTACCCACAGGAGG + Intronic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161943300 19:7419203-7419225 TACCCCGATGTACCCACACTCGG + Intronic
1161943307 19:7419232-7419254 TACCCCGATGTACCCACACTCGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1167666934 19:50827690-50827712 TTCCCTCATCTCCCCACACTGGG - Exonic
924967449 2:91414-91436 CACCCAGTGGTACCCACACTGGG - Intergenic
930533227 2:52615584-52615606 TAGCCTCTTGCACCCACACTTGG - Intergenic
931969195 2:67567161-67567183 CCCACTGATCTACCCACACTGGG - Intergenic
935662948 2:105485635-105485657 TACCCTAATCAACCCACACCTGG + Intergenic
947146573 2:227072271-227072293 TACCTTTATGTACACAAACTAGG + Intronic
1168905682 20:1401737-1401759 TATTCTGAAGTAGCCACACTTGG - Intergenic
1172757461 20:37296547-37296569 TGCCATGATGTACCATCACTGGG + Intronic
1184244919 22:43231050-43231072 TACCCTGTGGGCCCCACACTGGG - Intronic
949596149 3:5549172-5549194 TACACCGATGTACCCTCACAGGG + Intergenic
953803417 3:46047089-46047111 TATTCTGAAGTAGCCACACTTGG + Intergenic
960181443 3:114585106-114585128 TCCCCTCAGGGACCCACACTTGG - Intronic
968818723 4:2834791-2834813 TACCCAGCTGTCCCCAGACTGGG - Exonic
971571232 4:28213474-28213496 TACCCTCATCTAGTCACACTTGG - Intergenic
975305725 4:72846919-72846941 GATCCTGATGTATCCAGACTGGG + Intergenic
977700399 4:100015496-100015518 TGCCCTGATATACCCACATAGGG + Intergenic
978378999 4:108106549-108106571 TGCACTGATGTACACACATTAGG + Intronic
979308927 4:119179213-119179235 CACCCAGCTGTATCCACACTGGG + Intronic
979750641 4:124274821-124274843 TACCCTCATGTAGCCTAACTGGG - Intergenic
994820196 5:104639874-104639896 TATACTTATGTACCCTCACTTGG - Intergenic
997367593 5:133335791-133335813 GGCCCTGATGCACCAACACTGGG + Intronic
997656658 5:135560125-135560147 TACCCTTATTTCCCCACAGTTGG - Intergenic
998814164 5:145995392-145995414 TTCCCTGATGTACCCAACCCCGG + Intronic
1001288129 5:170438349-170438371 TGCCCTGCTGTCCCCACACGAGG - Intronic
1001711527 5:173782460-173782482 TGCCCTGAGATCCCCACACTTGG + Intergenic
1005399230 6:25414700-25414722 TGCCCTGTTGTACCCACAAGTGG + Intronic
1005781869 6:29201314-29201336 TGGCCTGGTGTGCCCACACTTGG + Intergenic
1010720711 6:79280300-79280322 TACCCTGATGTACAAGTACTTGG - Intergenic
1010930080 6:81791077-81791099 TACCCTGATCGGCCCAGACTAGG - Intergenic
1011697570 6:89925995-89926017 CACCCTGATGTTCTCACAATAGG + Intergenic
1032412597 7:131708465-131708487 AACTCCCATGTACCCACACTTGG + Intergenic
1034398725 7:150847373-150847395 TTCCCTGGTGTACCCCCAGTAGG + Intronic
1037602879 8:20412913-20412935 TTCCCTCATGTACACACAGTGGG - Intergenic
1040542699 8:48374177-48374199 TACCCTGCTGTGCCCAGACATGG + Intergenic
1043306911 8:78806262-78806284 TTTCCTGAAGTCCCCACACTGGG - Intergenic
1045106048 8:98893722-98893744 TACAGTGAAGTACCCGCACTTGG + Intronic
1047669302 8:127126991-127127013 TTGCATGATGTAACCACACTAGG + Intergenic
1049719000 8:144106999-144107021 CACCCTGTTGTACCCACTCCAGG - Intronic
1052032429 9:23643908-23643930 CACCCTGATCAACCCAGACTTGG + Intergenic
1060054729 9:120403707-120403729 TAACCTGGTGTAGCCACACAGGG - Intronic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1185819232 X:3185598-3185620 TACAATGATGAACACACACTGGG - Intergenic
1193920180 X:87415303-87415325 TATCATGATGTGCCCACATTAGG + Intergenic
1195681555 X:107550937-107550959 TACCCTGTGGTTCCCATACTGGG + Intronic
1195879579 X:109578379-109578401 TACTCTGCTTTAGCCACACTGGG + Intergenic
1198440069 X:136654506-136654528 TTCCCTGATGCAACAACACTGGG - Intronic