ID: 1161943316

View in Genome Browser
Species Human (GRCh38)
Location 19:7419262-7419284
Sequence ACCCCAGGTGTGCCCACACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 8, 3: 26, 4: 228}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161943310_1161943316 3 Left 1161943310 19:7419236-7419258 CCGATGTACCCACACTCGGCCTC 0: 2
1: 0
2: 1
3: 7
4: 83
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228
1161943306_1161943316 13 Left 1161943306 19:7419226-7419248 CCTCTGTACCCCGATGTACCCAC 0: 2
1: 1
2: 0
3: 1
4: 78
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228
1161943304_1161943316 24 Left 1161943304 19:7419215-7419237 CCCACACTCGGCCTCTGTACCCC 0: 5
1: 3
2: 4
3: 18
4: 187
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228
1161943312_1161943316 -6 Left 1161943312 19:7419245-7419267 CCACACTCGGCCTCCGCACCCCA 0: 1
1: 0
2: 7
3: 27
4: 297
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228
1161943311_1161943316 -5 Left 1161943311 19:7419244-7419266 CCCACACTCGGCCTCCGCACCCC 0: 1
1: 0
2: 11
3: 19
4: 208
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228
1161943308_1161943316 5 Left 1161943308 19:7419234-7419256 CCCCGATGTACCCACACTCGGCC 0: 2
1: 4
2: 1
3: 6
4: 38
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228
1161943305_1161943316 23 Left 1161943305 19:7419216-7419238 CCACACTCGGCCTCTGTACCCCG No data
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228
1161943309_1161943316 4 Left 1161943309 19:7419235-7419257 CCCGATGTACCCACACTCGGCCT 0: 6
1: 1
2: 2
3: 7
4: 78
Right 1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG 0: 1
1: 1
2: 8
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161943316 Original CRISPR ACCCCAGGTGTGCCCACACT CGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900434088 1:2619207-2619229 ACCCCAGCTGAGCCCAACCTAGG + Intronic
900797433 1:4717230-4717252 GCCCCAGGTATTCCCACAGTGGG - Intronic
901294832 1:8153052-8153074 AGCCCAGTTGTGCCCAGAATTGG + Intergenic
902771508 1:18647824-18647846 ACCCCACCTGCGCCCACATTTGG - Intronic
903779365 1:25811529-25811551 ACCCCAGGTGAGCGCACAGGAGG + Exonic
904319790 1:29689449-29689471 TCCCCAGCTGTGCCCACCCGGGG + Intergenic
905175201 1:36130981-36131003 TCTCCAGGCCTGCCCACACTAGG + Intergenic
907559821 1:55378145-55378167 ACCTCAGGTGAGCCCACAATCGG + Intergenic
907740641 1:57162453-57162475 ACCCAATGTGTGTTCACACTAGG + Intronic
910041089 1:82852175-82852197 GCCCCAGGTGTGACTACAGTGGG - Intergenic
911024952 1:93426674-93426696 TGGCCAGGTGTGCACACACTCGG + Intergenic
913226893 1:116708379-116708401 AGCCCAGATGTGCCCACTCCTGG - Intergenic
913479644 1:119275374-119275396 AGGCCAGGTGAGCCCACACAGGG - Intergenic
915624712 1:157107538-157107560 ACCCCAGCTGTGCCCCATCTTGG + Intergenic
920017420 1:202924498-202924520 ATGCCAGGTGTGGCCACTCTGGG + Intronic
920031535 1:203040307-203040329 ACCCCAGCAGCGCCCCCACTGGG - Intronic
920437833 1:205959631-205959653 ACCACAGGTGTCCCCACCATGGG + Intergenic
922800430 1:228362449-228362471 CGCCCAGGTGGGCCGACACTGGG - Intronic
923287974 1:232515116-232515138 ACCCCAGCTGTGCCCAAGATGGG - Exonic
1062925051 10:1309904-1309926 GCCCCAGGTGTGCCCGCAGGTGG - Intronic
1068525000 10:58118196-58118218 ACCCCAGCTGAGCCCAGACTTGG + Intergenic
1069958929 10:72068341-72068363 ACCCCAGGGGTCCCCACAGCTGG + Intronic
1070523538 10:77275615-77275637 AGGCCAGCTGTGCCCTCACTAGG - Intronic
1076659811 10:132048035-132048057 ACCCCAGCTAAACCCACACTGGG - Intergenic
1076701201 10:132274180-132274202 ACGCTGGGTGTGGCCACACTGGG + Intronic
1077466928 11:2737913-2737935 CCCCCAGGTGTGCCTCCCCTGGG - Intronic
1077992180 11:7422117-7422139 ATGGCAGGGGTGCCCACACTGGG - Intronic
1079239480 11:18712452-18712474 ACCAAAGGTCTGCCCAGACTAGG + Intronic
1079560345 11:21812891-21812913 ACCCCTCTTGTGCCCACACGTGG + Intergenic
1081044175 11:38250941-38250963 ACTCCAAGTGTGCACACACCTGG + Intergenic
1085314751 11:75537903-75537925 GCCCCTGGTGTGTTCACACTAGG + Intergenic
1087037974 11:93773401-93773423 CAGCCAGGTGTGCACACACTTGG - Intronic
1088913994 11:114213058-114213080 ACCCCCTGTGTGCCCACAGGGGG + Intronic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1090064524 11:123491652-123491674 ACCCCAGGCTTGCCCACCCTGGG + Intergenic
1090949662 11:131462765-131462787 ACCCTAGGTGGGCCCGCTCTAGG - Intronic
1091570861 12:1684210-1684232 ACCTCAGGTGTGGCTAGACTTGG + Intergenic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1091760933 12:3086876-3086898 ACCCTGGCTGTGCGCACACTTGG + Intronic
1092395452 12:8121931-8121953 ACCCCAACTGGGCCAACACTAGG - Intergenic
1095193354 12:39284395-39284417 ACCCCAAGTCTGCCCAAACTTGG - Intergenic
1097170793 12:57111488-57111510 CCCCCACGTGTTCCCCCACTCGG - Intronic
1097243424 12:57591601-57591623 ACCCCAGGTGTTCCCCCAGCAGG + Intronic
1101347956 12:103903895-103903917 ACTCCAGGTGGGGCCACTCTGGG - Intergenic
1101919184 12:108919007-108919029 CCCCCACTTGTACCCACACTTGG + Intronic
1101919250 12:108919276-108919298 ACCCCACCTGTACCCACACTTGG + Intronic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1102701107 12:114840175-114840197 ACCCCAGATGGGTACACACTAGG + Intergenic
1103536599 12:121637750-121637772 CCCCCAGGCCTGCCCACACCTGG - Intronic
1103562261 12:121798952-121798974 ACCCCAGGTGTTACCAGGCTAGG + Intronic
1104280356 12:127371119-127371141 ACCCCAGGTGGGAGAACACTAGG - Intergenic
1104805485 12:131586797-131586819 CAGCCAGGTGTGCACACACTTGG + Intergenic
1104805488 12:131586800-131586822 ACCCCAAGTGTGTGCACACCTGG - Intergenic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1107024459 13:35785414-35785436 GCCCCAGGTGTGAGCTCACTGGG - Intronic
1107889452 13:44901532-44901554 CCCCCAGGTGGGAACACACTGGG + Intergenic
1108854478 13:54775750-54775772 ACCCCAAGTGTGTGCACACCTGG + Intergenic
1108854481 13:54775753-54775775 TGTCCAGGTGTGCACACACTTGG - Intergenic
1109622263 13:64925630-64925652 GCCCCAAGTGTGCACACACCTGG + Intergenic
1109622267 13:64925633-64925655 AGCCCAGGTGTGTGCACACTTGG - Intergenic
1110670328 13:78169584-78169606 AGGCCAGGTGTGCACACACTTGG - Intergenic
1115221151 14:31059812-31059834 ACCCCAGGCTTGGCCACACTGGG + Intronic
1116485538 14:45444185-45444207 ACCCAAAGAGTCCCCACACTGGG + Intergenic
1117285535 14:54282795-54282817 ACCCCAAGTGTGCACACACATGG + Intergenic
1121879476 14:97487190-97487212 ACCTCAGGTGTGACCATATTTGG - Intergenic
1122248727 14:100423346-100423368 GGTCCAGGTATGCCCACACTGGG - Intronic
1122268274 14:100556808-100556830 AACCCAGCTGTCCCCTCACTAGG - Intronic
1122334012 14:100954917-100954939 AGCCCAGGTGTGTCCATTCTGGG - Intergenic
1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG + Exonic
1128312798 15:66641957-66641979 ACCACTGGTTTGCCCACACCAGG - Intronic
1129183492 15:73891729-73891751 GCCCCAGGTGTGAGCACACCTGG - Intergenic
1131177255 15:90217823-90217845 CCCACAGGTGAGCCCACACCTGG + Exonic
1132744178 16:1429850-1429872 TCGCCAGGTGTGCCCCCGCTTGG - Intergenic
1132753691 16:1471433-1471455 ACCCCGTCTGTGGCCACACTGGG + Intronic
1132794469 16:1712647-1712669 TCCCCAGGTGGCCCCCCACTGGG + Intronic
1133091875 16:3411104-3411126 ACACCAGGGGTGCTCAAACTGGG + Intronic
1133314028 16:4870966-4870988 AGATCAGGTGTGCCCACACTGGG + Exonic
1133344738 16:5062337-5062359 GCCCCAGGAGAGCCCACGCTGGG + Intronic
1133818972 16:9219768-9219790 ACACCAGGTGGTCCAACACTAGG + Intergenic
1133990318 16:10701604-10701626 ACACCATGTGTGCACACACTGGG - Intergenic
1133990489 16:10703014-10703036 ACACCATGTGTGAACACACTGGG - Intergenic
1133990739 16:10705323-10705345 ACACCATGTGTGCACACCCTGGG - Intergenic
1135582595 16:23641195-23641217 ACCCCAGGCCTGCCGACACCGGG + Exonic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1138505454 16:57476075-57476097 ACCCCCGGTGTCCCCAGGCTGGG - Intronic
1138572534 16:57884847-57884869 ACTCCAGGAGTGCCCACCCCTGG - Intronic
1138977325 16:62223461-62223483 ACGCCAAGTGTACCCACACATGG + Intergenic
1140514963 16:75535082-75535104 ACCGGAGGTGTCCCCACACTCGG - Intronic
1141174179 16:81708340-81708362 ACCCCAGGTAACCCCACCCTGGG + Intronic
1141271070 16:82541672-82541694 ACCCCAGGTGTGCGCTCACTGGG - Intergenic
1141859719 16:86708365-86708387 GGCCCAGGTGTGTCCAGACTCGG + Intergenic
1142534962 17:608148-608170 AGCCCAGGGGTTCACACACTTGG + Intronic
1143625845 17:8109806-8109828 ACCCCAGGTGTCCTCACAAGGGG + Intronic
1144366752 17:14551731-14551753 ACCCCAGGTCTGCTAAAACTTGG + Intergenic
1147184907 17:38707758-38707780 ACACCACGTGTGCCCAGCCTGGG - Exonic
1147875389 17:43617145-43617167 AGCCCAGAGGTGCACACACTGGG - Intergenic
1149246345 17:54712634-54712656 ACTACAGGTGTGTCCACAGTTGG + Intergenic
1151508977 17:74546783-74546805 AACCCAGGTCTATCCACACTCGG + Intergenic
1152107143 17:78337264-78337286 ACCCCGGTTGTGCCCGCAGTAGG - Intergenic
1152124627 17:78438918-78438940 ACCCCAGCAGAGCCGACACTGGG + Intronic
1152768109 17:82151826-82151848 ACGCCAGGGGTGCCCACCCAAGG + Intronic
1153964318 18:10166450-10166472 ACCACAGGCGTGCCCTCCCTTGG + Intergenic
1154502331 18:15003068-15003090 ACCCAGGGTGTGGCCAGACTTGG + Intergenic
1158422117 18:57304364-57304386 AACCCAGGTTTGCCAGCACTGGG + Intergenic
1160908977 19:1466168-1466190 ACCCCAGGTGTGGGCAGCCTCGG + Exonic
1160969645 19:1761854-1761876 CCCCCACATCTGCCCACACTCGG - Intronic
1161445815 19:4318571-4318593 ACCCCAACTCTGACCACACTGGG - Intronic
1161511567 19:4675113-4675135 ACCCCAGGAGTCCCCACAGATGG + Intergenic
1161582149 19:5086871-5086893 AGCCCAGGTCTGCCCCCACAGGG + Intronic
1161943251 19:7418995-7419017 ACCCCAGGTGCACCCGCACTCGG + Intronic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1161943328 19:7419291-7419313 CACCTGGGTGTGCCCACACTTGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1161943473 19:7419906-7419928 ACCCCAGATACACCCACACTCGG + Intronic
1161943481 19:7419936-7419958 ACCCCAGGTGTACTCACACTCGG + Intronic
1161943488 19:7419966-7419988 ACCCCAGGTGCGCCCACACTCGG + Intronic
1163167967 19:15510552-15510574 TGTCCAGGTGTGGCCACACTTGG + Intronic
1163167969 19:15510555-15510577 ATCCCAAGTGTGGCCACACCTGG - Intronic
1164670516 19:30069750-30069772 ACCTCAGATGTGACCTCACTTGG + Intergenic
1165416327 19:35696013-35696035 ACACCAGGAGTGCACACACACGG + Intergenic
1165951224 19:39474808-39474830 ATCCCAGCTCTGCCCACTCTGGG - Intronic
1166687257 19:44802791-44802813 ACCCCAGCCATGCCCACTCTGGG - Intergenic
1166720071 19:44991471-44991493 ATCCCAGCTCTGCCCACCCTAGG - Intronic
1166868179 19:45853774-45853796 ATCCCAGCCCTGCCCACACTGGG + Intronic
1166970396 19:46563270-46563292 GCCCCAGGAGAGCCCAGACTTGG - Intronic
1167154329 19:47729159-47729181 GCCCCAGCTCTGACCACACTGGG - Intronic
1168121471 19:54254548-54254570 TCCCCAGGCATGCCCACACTTGG - Intronic
1168687803 19:58358833-58358855 ACCCCAGCTGAGCCAGCACTGGG - Intronic
925341218 2:3138765-3138787 ACTCCAGGTGTGGCCACACTGGG - Intergenic
926141614 2:10371481-10371503 AGCCAAGGTGGGGCCACACTGGG - Intronic
926304490 2:11628143-11628165 AACACAGCTCTGCCCACACTGGG - Intronic
928374142 2:30761388-30761410 ACGGCAGCTGAGCCCACACTTGG + Intronic
932054812 2:68433138-68433160 CAGCCAGGTGTGCACACACTCGG - Intergenic
932257728 2:70301796-70301818 ACCCCAGGGCCGCCCACACCCGG + Intronic
932644710 2:73488318-73488340 CAGCCAGGTGTGCGCACACTTGG - Intronic
932813873 2:74845975-74845997 GGCACAGGTGTGCCCACCCTGGG - Intronic
933134343 2:78713021-78713043 TCCCCATTTTTGCCCACACTGGG + Intergenic
933678938 2:85081564-85081586 ACCCTTGGTGTGCACAGACTGGG - Intergenic
935127210 2:100235219-100235241 AGCCCAGGTGTGCACAGCCTCGG + Intergenic
936474087 2:112824478-112824500 ACCTCAGCTGTGCTCACTCTTGG + Intergenic
938501505 2:131833240-131833262 ACCCAGGGTGTGGCCAGACTTGG + Intergenic
938780020 2:134576363-134576385 CCCCCAGGTGTGGCCATACCAGG - Intronic
939643679 2:144670474-144670496 CCTCCAGCTGAGCCCACACTTGG + Intergenic
941151352 2:161919102-161919124 TGGCCAGGTGTGCACACACTTGG + Intronic
941151355 2:161919105-161919127 ACCCCAAGTGTGTGCACACCTGG - Intronic
942868128 2:180699944-180699966 GGGCCAGGTGTGCACACACTTGG - Intergenic
946482015 2:220066303-220066325 AGCCCAGGAGTGCCCAGAGTAGG + Intergenic
947541919 2:230985633-230985655 ACACCATGTGGGCCCACACTTGG + Intergenic
948575472 2:238946954-238946976 CAACCAGGTGTGCACACACTTGG - Intergenic
948752475 2:240140429-240140451 TCCCCAGGGCTGCCCACACTGGG - Exonic
948853616 2:240720047-240720069 TCTCCAGCTGTGCCCACAGTGGG + Intronic
1171120436 20:22563879-22563901 AACCAAGGTGAGCCCACCCTGGG - Intergenic
1172469404 20:35180393-35180415 ATCCCAGGGCTGCCCTCACTCGG + Intergenic
1172939639 20:38645664-38645686 ACCCCCAGAGAGCCCACACTGGG - Intronic
1174520208 20:51123545-51123567 ACTCCAGGCATGCCCACACTGGG - Intergenic
1174563514 20:51447902-51447924 ACCCCAGGTCAGCCCACAACTGG - Intronic
1174775961 20:53343288-53343310 ACGGCAGGTGCGGCCACACTGGG + Intronic
1175371267 20:58494838-58494860 ACCCCACTTGTACCCACCCTGGG + Intronic
1178426019 21:32478900-32478922 AGTCCAGGCCTGCCCACACTTGG - Intronic
1179222869 21:39425236-39425258 ATCTCAGATGTGTCCACACTTGG - Intronic
1179611946 21:42557647-42557669 ACCCACTGGGTGCCCACACTGGG + Intronic
1180219868 21:46351876-46351898 ACACCAGGTGAGCCCGCACTTGG - Intronic
1180694555 22:17743418-17743440 ACCCAAGGGGTTCTCACACTTGG - Intronic
1181023785 22:20116611-20116633 ACCCCATCTGTCCCCACACAGGG - Exonic
1181549129 22:23626684-23626706 ACTGCAGGTGAGGCCACACTGGG + Intronic
1181799536 22:25335479-25335501 ACTGCAGGTGAGGCCACACTGGG - Intergenic
1182554993 22:31124424-31124446 ATCCCAGGTCTGGGCACACTGGG - Intronic
1182935929 22:34221546-34221568 GACTCAGGTGGGCCCACACTGGG - Intergenic
1183269783 22:36853851-36853873 GCCCCAGGTCTGCACAGACTGGG - Intergenic
1184198456 22:42947910-42947932 AAGCCAGGTGCCCCCACACTGGG + Intronic
1185179353 22:49350243-49350265 CCCACAGGGGTGTCCACACTGGG - Intergenic
950163748 3:10778775-10778797 ATACCAGGGGTGCCCATACTGGG - Intergenic
951836411 3:26988207-26988229 GTTCCAGGTGTGCCCAGACTGGG + Intergenic
952280368 3:31917153-31917175 ATCCCACCGGTGCCCACACTAGG + Intronic
953234233 3:41092178-41092200 ACCCCATGCATGTCCACACTGGG - Intergenic
953371995 3:42396828-42396850 AGCCAAGGCGTGTCCACACTGGG - Intergenic
954663575 3:52238834-52238856 CCCCCAGATGTGCCCACCCCAGG + Intronic
958414178 3:93854474-93854496 ACCCCAGGTGTGGCTTCACTAGG - Intergenic
958991555 3:100851822-100851844 ATCCCAGGTGTTCCAACACTTGG - Intronic
959484206 3:106908700-106908722 CAGCCAGGTGTGCCCACATTTGG + Intergenic
959897023 3:111617033-111617055 GCCCCAAGTGTGCACACACCTGG - Intronic
961355948 3:126340107-126340129 GTCCCAGCTGTGCCCACAGTGGG - Intergenic
961445568 3:126979458-126979480 GCTCCTGGTGTGACCACACTGGG - Intergenic
962824606 3:139088820-139088842 AGCCTAGGTGTGCACACACTTGG - Intronic
965261290 3:166489423-166489445 CCTCCAGGTGTGCACACACTGGG + Intergenic
965399951 3:168202827-168202849 ACACCATGTGTGTACACACTGGG - Intergenic
967167065 3:186790634-186790656 AATCCATGTGTGCCCAAACTTGG - Intronic
967224346 3:187276548-187276570 ACCCCATGTGCACCCACACCTGG + Intronic
967826668 3:193882642-193882664 GCCCAAGCTGTGCCCACAATTGG - Intergenic
976639894 4:87327409-87327431 AAACCAGGTATGCCAACACTAGG + Intergenic
976729031 4:88244289-88244311 CGGCCAGGTGTGCACACACTTGG + Intergenic
978371007 4:108029588-108029610 ACCCCAGGTGTATCAACAGTGGG - Intronic
978412832 4:108443876-108443898 ACCCCAGATCTGGCCCCACTTGG + Intergenic
982881874 4:160730161-160730183 AGCCCATGTGTTCCCACTCTGGG + Intergenic
985263790 4:188139644-188139666 ACAAAAGCTGTGCCCACACTCGG - Exonic
985754485 5:1704916-1704938 ACCCCAGCTGGGGTCACACTGGG + Intergenic
986251859 5:6066997-6067019 ACTCCAGGTATGCCCACATTAGG + Intergenic
989536078 5:42565120-42565142 GCTCCAGGTGTGGCCACACTGGG + Intronic
990996212 5:61734576-61734598 CTCCCAGGTGGGACCACACTGGG - Intronic
992404897 5:76447628-76447650 ACCCCAGCTTAGCTCACACTTGG - Intronic
992521576 5:77556920-77556942 ACCCCAGGTGCCCCCTCCCTTGG - Intronic
994245469 5:97471437-97471459 AGGCCAGGTGTGCCCAGGCTTGG - Intergenic
995744221 5:115387041-115387063 ACCCCAGGTGAGCCAGCCCTGGG + Intergenic
996702686 5:126465857-126465879 ACACCAGGTGTGCACACCCAAGG - Intronic
997341413 5:133147924-133147946 ACCCCAGGTCTGATCACACTGGG + Intergenic
998396791 5:141823877-141823899 ACCCCTCATGTGCCCAAACTTGG - Intergenic
999725126 5:154430656-154430678 ACCCCAGGTGTCCCTAAGCTGGG - Intergenic
999887237 5:155936923-155936945 GCCCCGGGTGTGCGCACACCTGG + Intronic
1001491878 5:172161833-172161855 TGCCCAGGTGTGCACACTCTTGG + Intronic
1003193368 6:3893461-3893483 AACCCTGGTGTGTCCACAGTTGG + Intergenic
1005781869 6:29201314-29201336 TGGCCTGGTGTGCCCACACTTGG + Intergenic
1005854253 6:29848577-29848599 TCTGCAGCTGTGCCCACACTTGG - Intergenic
1006193017 6:32220962-32220984 CCCCCAGGTGTGTCCTCACAGGG - Exonic
1012245900 6:96925096-96925118 ACTCCGGGTCTGCCCCCACTTGG - Intronic
1012252667 6:96996095-96996117 AGCCCAGGGCTGCCCACGCTGGG - Intronic
1014077742 6:117256292-117256314 CCGCCAGGTGTGTCGACACTTGG - Intergenic
1017730515 6:157311614-157311636 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730583 6:157312124-157312146 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730660 6:157312696-157312718 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730665 6:157312730-157312752 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730721 6:157313138-157313160 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730745 6:157313308-157313330 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730751 6:157313342-157313364 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730835 6:157313885-157313907 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730840 6:157313919-157313941 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730884 6:157314188-157314210 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017730895 6:157314256-157314278 AGGCCAGGTGAGCGCACACTGGG - Intronic
1017764383 6:157594694-157594716 AACCCTGGTGTGCCCCCACATGG - Intronic
1019058417 6:169239089-169239111 ACCCCCAGGGTGCCCACACGTGG + Intronic
1020586707 7:10078769-10078791 GCCCCAGGTATGCACACACCCGG - Intergenic
1021205555 7:17775636-17775658 GCCTCAGGTGTGCCCATTCTAGG - Intergenic
1022010280 7:26302730-26302752 ACCCCAGTTTTGCCATCACTAGG + Intronic
1026023405 7:66727715-66727737 TCCCCAGGTGTGCCCACTTCTGG - Intronic
1029392720 7:100286332-100286354 TCTCCAGGTCTGCTCACACTTGG - Intergenic
1029532717 7:101136044-101136066 ACCCAAGTTGTTCCCACAGTGGG + Intronic
1030302274 7:107986304-107986326 ACCCCAGGTTTTCCCAAAGTCGG + Exonic
1030514124 7:110519675-110519697 TGGCCAGGTGTGCACACACTTGG - Intergenic
1030747571 7:113186011-113186033 CCCCTAGGTGTGCCCAGAGTAGG - Intergenic
1031718191 7:125134798-125134820 ACCCCAGGTGTGGCTCCAGTGGG + Intergenic
1031858124 7:126946360-126946382 ACCACAGGTGGCACCACACTGGG - Intronic
1034276472 7:149826090-149826112 GTCCCTGGTGTGCCCACACCAGG + Intergenic
1034887704 7:154810717-154810739 ACCCCAGGTACAGCCACACTGGG + Intronic
1035048274 7:155983354-155983376 TCCCCAGCTCTGCCCACCCTGGG - Intergenic
1035274520 7:157739654-157739676 TCCCCAGGTGTGACCAGACAAGG + Intronic
1039650391 8:39334918-39334940 AACCCAGGTGATCCTACACTAGG - Intergenic
1041955992 8:63558673-63558695 CAGCCAGGTGTGCGCACACTTGG + Intergenic
1041955995 8:63558676-63558698 GCCCCAAGTGTGCGCACACCTGG - Intergenic
1045484737 8:102622172-102622194 AGCCCAGCACTGCCCACACTGGG - Intergenic
1045833199 8:106489366-106489388 ACCCCAGCAGTACCCTCACTTGG + Intronic
1046187081 8:110734992-110735014 CAGCCAGGTGTGCGCACACTCGG - Intergenic
1049230109 8:141477536-141477558 ACGCCAGGTCTCCCCACCCTGGG + Intergenic
1049696975 8:143989067-143989089 ACCCCAGGCTTCCCCTCACTAGG + Intronic
1052946951 9:34176264-34176286 GCCCCAGGTGAGTCAACACTGGG + Intergenic
1057468472 9:95337413-95337435 CAGCCAGGTGTGCACACACTTGG + Intergenic
1058196092 9:101978270-101978292 ACCCCAGATGTGACCTCAGTTGG - Intergenic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1062498161 9:136841290-136841312 ACCCAGGGTGTGGCCAGACTTGG - Intronic
1190362425 X:49661979-49662001 ACCCCAGCTGGGCCCACAGAAGG - Intergenic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic