ID: 1161943338

View in Genome Browser
Species Human (GRCh38)
Location 19:7419320-7419342
Sequence CACCCGGGTGTGCCCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 119}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161943321_1161943338 22 Left 1161943321 19:7419275-7419297 CCACACTCGGCCCCCGCACCTGG 0: 1
1: 0
2: 1
3: 25
4: 245
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943327_1161943338 9 Left 1161943327 19:7419288-7419310 CCGCACCTGGGTGTGCCCACACT 0: 1
1: 1
2: 0
3: 39
4: 242
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943331_1161943338 -7 Left 1161943331 19:7419304-7419326 CCACACTTGGCCCCCACACCCGG 0: 1
1: 0
2: 1
3: 22
4: 261
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943324_1161943338 12 Left 1161943324 19:7419285-7419307 CCCCCGCACCTGGGTGTGCCCAC 0: 1
1: 0
2: 2
3: 23
4: 257
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943330_1161943338 -6 Left 1161943330 19:7419303-7419325 CCCACACTTGGCCCCCACACCCG 0: 1
1: 0
2: 2
3: 21
4: 260
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943326_1161943338 10 Left 1161943326 19:7419287-7419309 CCCGCACCTGGGTGTGCCCACAC 0: 1
1: 0
2: 4
3: 51
4: 278
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943325_1161943338 11 Left 1161943325 19:7419286-7419308 CCCCGCACCTGGGTGTGCCCACA 0: 1
1: 0
2: 2
3: 14
4: 179
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943320_1161943338 23 Left 1161943320 19:7419274-7419296 CCCACACTCGGCCCCCGCACCTG 0: 1
1: 1
2: 0
3: 21
4: 164
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119
1161943329_1161943338 4 Left 1161943329 19:7419293-7419315 CCTGGGTGTGCCCACACTTGGCC 0: 2
1: 0
2: 2
3: 23
4: 229
Right 1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG 0: 1
1: 1
2: 0
3: 25
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161943338 Original CRISPR CACCCGGGTGTGCCCACACT TGG Intronic
900366478 1:2313885-2313907 CGCCCTGCTGTGCCCACCCTGGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900528792 1:3142628-3142650 CACCCTGGGGTCCGCACACTGGG - Intronic
900987253 1:6080355-6080377 CTCCCGGATGTGCCCACCCAGGG - Intronic
901140227 1:7024308-7024330 CACCCTGATGTGCCCACACATGG - Intronic
910066862 1:83164190-83164212 CACCTGGGAGTGTGCACACTTGG + Intergenic
916213391 1:162375861-162375883 CACCCTGGAGTGCTAACACTTGG + Intronic
922473451 1:225890461-225890483 CACCTGGGTCTGCCCAGATTGGG + Intronic
922800430 1:228362449-228362471 CGCCCAGGTGGGCCGACACTGGG - Intronic
924948749 1:248863724-248863746 CGGCCGGGTGTGCGCACACTCGG + Intergenic
1069152669 10:64984737-64984759 CACCCTGATGTGCCCACAGTTGG + Intergenic
1074528547 10:114281142-114281164 CACCCTGGGCTGCCCACACAGGG - Intronic
1075007429 10:118840951-118840973 CCCTGGGGTGAGCCCACACTTGG - Intergenic
1075007730 10:118842602-118842624 CAGCTGGGTGTGCACACACTCGG + Intergenic
1075578395 10:123597608-123597630 CACACGTGTGTGCACACACGTGG - Intergenic
1076821839 10:132943398-132943420 CACCCCGGGGTGGGCACACTAGG + Intergenic
1077076159 11:703158-703180 CACCCGGGATACCCCACACTGGG + Exonic
1081044176 11:38250944-38250966 CAGCCAGGTGTGTGCACACTTGG - Intergenic
1081799314 11:45847260-45847282 CACCCGGGCGGACCCACACATGG + Intronic
1087037974 11:93773401-93773423 CAGCCAGGTGTGCACACACTTGG - Intronic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1093514991 12:19974907-19974929 CACCCAGGTGTACCCAGAATGGG - Intergenic
1094675081 12:32612028-32612050 CGGCAGGGTGTGCACACACTTGG + Intronic
1097572963 12:61356345-61356367 AAGCTGGGTGTGCACACACTCGG - Intergenic
1099682266 12:85844095-85844117 CAGTCGGGTGTGTACACACTTGG + Intergenic
1099713815 12:86264850-86264872 CAGTCGGCTGTGCCCACTCTTGG + Intronic
1102349218 12:112179699-112179721 CACTGAGGTGTGCCCACCCTCGG - Intronic
1104805485 12:131586797-131586819 CAGCCAGGTGTGCACACACTTGG + Intergenic
1106431006 13:29680614-29680636 CACCCTTCTGTTCCCACACTTGG - Intergenic
1108002300 13:45915378-45915400 CATCTGGGTGTGTACACACTCGG + Intergenic
1109470578 13:62799246-62799268 CAGCTGGGTGAGCCCACGCTTGG + Intergenic
1115310643 14:31974923-31974945 CAGCTGGGTGTGCGTACACTTGG - Intergenic
1116448600 14:45039596-45039618 TAGCCGGGTGTGCACACACTTGG - Intronic
1119938321 14:78614156-78614178 CACCTGTGTGTTCCCACACATGG - Intronic
1120744800 14:88143634-88143656 CACCTGGGTGTGCCCACAACAGG + Intergenic
1124367965 15:29087509-29087531 CACCAGGGAGTGGCCACACCTGG - Intronic
1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG + Exonic
1129169363 15:73798357-73798379 GACGCGGCTTTGCCCACACTGGG - Intergenic
1130063274 15:80584671-80584693 CACTCAGATGTGCCCACGCTGGG - Intronic
1131441567 15:92463601-92463623 CACATGGGTGTGGCCAGACTTGG - Intronic
1132644131 16:990968-990990 CAGGCGGCTGTGCCCACAGTGGG + Intergenic
1135347394 16:21700817-21700839 CACCAGGGTGGGGCCACACTGGG + Intronic
1136267822 16:29131369-29131391 CCTCCGGGTGTGACCACACAGGG + Intergenic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1141828061 16:86494774-86494796 CACCCCGGTGTGGCCGCATTAGG + Intergenic
1142071126 16:88091716-88091738 CCTCCGGGTGTGACCACACAGGG + Intronic
1142320700 16:89380941-89380963 CAGCAGAGTGGGCCCACACTGGG - Intronic
1146425245 17:32732030-32732052 CAGCTGGGTATGCGCACACTTGG + Intronic
1150496166 17:65609461-65609483 CAGCCAGATGTCCCCACACTGGG - Intronic
1151178017 17:72305129-72305151 CACCAGGAGGTGCCCACACCAGG + Intergenic
1152530293 17:80914632-80914654 CAGCCGGCTGTGCACACGCTCGG + Intronic
1152856680 17:82668587-82668609 CATCCGGGTGGGTCCACACTTGG - Intronic
1155728155 18:29116061-29116083 CACCCACCTGTGCACACACTGGG + Intergenic
1159161410 18:64647059-64647081 CAGCTGGGTGTGCACACACTTGG - Intergenic
1160113417 18:76055258-76055280 AATCCGCATGTGCCCACACTTGG - Intergenic
1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG + Intronic
1161943300 19:7419203-7419225 TACCCCGATGTACCCACACTCGG + Intronic
1161943307 19:7419232-7419254 TACCCCGATGTACCCACACTCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1161943328 19:7419291-7419313 CACCTGGGTGTGCCCACACTTGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1161943488 19:7419966-7419988 ACCCCAGGTGCGCCCACACTCGG + Intronic
1162337943 19:10073207-10073229 CCCCAGGGTGACCCCACACTGGG - Intergenic
1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG + Intronic
1163712837 19:18857114-18857136 CAGCAGAGTGTGCGCACACTGGG + Intronic
1166339726 19:42130472-42130494 CACCCCAGTCTTCCCACACTGGG + Intronic
1167207623 19:48113240-48113262 CCCCTGGGTCTGCCCACACAGGG + Intergenic
924967449 2:91414-91436 CACCCAGTGGTACCCACACTGGG - Intergenic
932054812 2:68433138-68433160 CAGCCAGGTGTGCACACACTCGG - Intergenic
932644710 2:73488318-73488340 CAGCCAGGTGTGCGCACACTTGG - Intronic
932737418 2:74264066-74264088 TACCCGGGTGAGCCCACCTTAGG - Intronic
933093223 2:78146456-78146478 CAGCCGGGTGTGCACACATTTGG + Intergenic
935632789 2:105225677-105225699 CTCCCCGGTGTGTCCTCACTAGG - Intergenic
937756299 2:125542778-125542800 CACCTTGCTGTGCCCACACATGG - Intergenic
938722139 2:134076448-134076470 TGGCTGGGTGTGCCCACACTTGG - Intergenic
943345721 2:186734854-186734876 CAGCTGGATGTGCACACACTTGG - Intronic
943690886 2:190868696-190868718 CACCCCAGTGTGCCCAAAATTGG - Intergenic
943820286 2:192313964-192313986 CACCTGGGGCTGCCCACGCTAGG - Intergenic
948575472 2:238946954-238946976 CAACCAGGTGTGCACACACTTGG - Intergenic
1172346977 20:34209638-34209660 CAGCCGTGTGTGCATACACTTGG + Intronic
1172795722 20:37535871-37535893 CACAGGGGCCTGCCCACACTTGG - Intergenic
1175759887 20:61555012-61555034 CACACAGGTGTGCACACACATGG - Intronic
1176144844 20:63560994-63561016 CACCCGCGTCTGCACACACAGGG + Intronic
1181813658 22:25420975-25420997 CACCCAGGTGCGCCAACCCTTGG + Intergenic
1182662241 22:31933301-31933323 CACCCTGGTGGGCCCACGCCAGG - Intergenic
1182935929 22:34221546-34221568 GACTCAGGTGGGCCCACACTGGG - Intergenic
1183373592 22:37449423-37449445 CCCCCGCCTGTGCCCCCACTGGG - Intergenic
1184191742 22:42899543-42899565 CACCCACCTCTGCCCACACTTGG - Intronic
1184517621 22:44972466-44972488 CAGCCGCGTCTGCCAACACTCGG - Intronic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
951509716 3:23487165-23487187 GAGCTGGGTGTGCACACACTTGG - Intronic
953766487 3:45747186-45747208 CAGCAGGGTGTGTGCACACTTGG + Intergenic
955764566 3:62328382-62328404 CTCCAGGGTGTACCCCCACTAGG + Intronic
959484206 3:106908700-106908722 CAGCCAGGTGTGCCCACATTTGG + Intergenic
961193557 3:124982758-124982780 CAGCCGGGGGTGGGCACACTCGG + Intronic
965261290 3:166489423-166489445 CCTCCAGGTGTGCACACACTGGG + Intergenic
968689174 4:1981527-1981549 CACCCGTGTGCGCCCACAGGGGG + Exonic
968980847 4:3848631-3848653 CAGCCAGGTGTGCCTACCCTGGG - Intergenic
969518257 4:7660759-7660781 CACCAGGCTGTCCCCACACATGG - Intronic
971714172 4:30153765-30153787 CAGCTGGGTGTGCACACACTAGG - Intergenic
975913598 4:79297615-79297637 CATCCAGGTGTGCACTCACTCGG + Intronic
976729031 4:88244289-88244311 CGGCCAGGTGTGCACACACTTGG + Intergenic
979308927 4:119179213-119179235 CACCCAGCTGTATCCACACTGGG + Intronic
982901100 4:161003615-161003637 CAGCTGGGTGTGCACACGCTTGG - Intergenic
985509002 5:301291-301313 CACCCTTGTGTGCAGACACTAGG + Intronic
985739120 5:1604622-1604644 CACCCTTGTGTGCAGACACTAGG - Intergenic
990996212 5:61734576-61734598 CTCCCAGGTGGGACCACACTGGG - Intronic
991632146 5:68666873-68666895 CACCCGACTGTGCCCACCCTGGG + Intergenic
994157819 5:96523203-96523225 CTGCCTGGTGTGCCCACACATGG + Intergenic
999887237 5:155936923-155936945 GCCCCGGGTGTGCGCACACCTGG + Intronic
1002898549 6:1392862-1392884 CCCCCGGGCGTTCCCAGACTCGG - Intronic
1003193368 6:3893461-3893483 AACCCTGGTGTGTCCACAGTTGG + Intergenic
1005281034 6:24274003-24274025 CACGCCTGTGTGCCCACACATGG - Intronic
1005781869 6:29201314-29201336 TGGCCTGGTGTGCCCACACTTGG + Intergenic
1008270108 6:49481761-49481783 CACCCAGTGGAGCCCACACTGGG + Intronic
1015663650 6:135603409-135603431 CAGCTGGGTGTGTGCACACTTGG + Intergenic
1017764383 6:157594694-157594716 AACCCTGGTGTGCCCCCACATGG - Intronic
1021021191 7:15600200-15600222 CAGCCGGGTGTGCGCACTCTTGG - Intergenic
1022048431 7:26642368-26642390 CACATATGTGTGCCCACACTTGG - Intronic
1024264667 7:47597538-47597560 CACCTAGGTGTGCCCACAGAAGG + Intergenic
1029606545 7:101602639-101602661 CACCAGGCTGTGCACAGACTGGG + Intergenic
1034276472 7:149826090-149826112 GTCCCTGGTGTGCCCACACCAGG + Intergenic
1035263386 7:157675410-157675432 CGCCCGGGTGAGCCAACACCCGG - Intronic
1035731062 8:1853802-1853824 CTCCCGGGAGTGCCCACAGCCGG - Intronic
1038416905 8:27403710-27403732 CACCCAGACGTGCCCACACAGGG + Intronic
1039102090 8:33951641-33951663 CACTGGGCTGTGCCCACCCTTGG - Intergenic
1040661776 8:49582993-49583015 CAGCTGGGTGTGTGCACACTTGG + Intergenic
1041878133 8:62713199-62713221 CACCAGGGTGCACACACACTTGG + Intronic
1041955992 8:63558673-63558695 CAGCCAGGTGTGCGCACACTTGG + Intergenic
1043087231 8:75849727-75849749 TACGCGGGTGTGCACACACTCGG - Intergenic
1043195461 8:77287214-77287236 CAGCCAGGTGTGTTCACACTTGG + Intergenic
1045300801 8:100908411-100908433 CGGCCGGGTGTGCGTACACTCGG - Intergenic
1046187079 8:110734989-110735011 TACCCGAGTGTGCGCACACCTGG + Intergenic
1046187081 8:110734992-110735014 CAGCCAGGTGTGCGCACACTCGG - Intergenic
1046614759 8:116463786-116463808 CACTAAGCTGTGCCCACACTGGG - Intergenic
1049534304 8:143171075-143171097 GACCCGGCTCTCCCCACACTGGG + Intergenic
1050483922 9:6114398-6114420 CAGCTGGGTGTGCACACGCTTGG + Intergenic
1050829275 9:9990483-9990505 CACCTGGGTGTGCCCATTCCAGG + Intronic
1051609564 9:18948093-18948115 CACAAGGGTGTGCAGACACTGGG + Intronic
1055314870 9:75024086-75024108 CATCAGGGTGAGCCCACACCAGG + Intronic
1057468472 9:95337413-95337435 CAGCCAGGTGTGCACACACTTGG + Intergenic
1059627220 9:116080256-116080278 CACACGGGTGTGCCCACCATTGG - Intergenic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1060228214 9:121808992-121809014 CATCTGGTTGTGCCCACACCAGG + Intergenic
1061669542 9:132180869-132180891 CACACGTGTGTGCAAACACTGGG + Intronic
1200062693 X:153490617-153490639 CCCCCGAGGGTGCCGACACTGGG + Intronic